ID: 1004125084

View in Genome Browser
Species Human (GRCh38)
Location 6:12865310-12865332
Sequence CTTGACAATGATGGTATCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 133}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004125084 Original CRISPR CTTGACAATGATGGTATCAT GGG Intronic
901941700 1:12667228-12667250 CTTGACAATGAAGATCTCAGAGG + Intergenic
904440786 1:30528310-30528332 CTTGATTATGATGATTTCATGGG - Intergenic
907534604 1:55138608-55138630 CTCGACAGTGAAGGTATCTTTGG + Exonic
908981449 1:69963984-69964006 CCTTAGAATGATGGTAGCATAGG - Intronic
909314314 1:74196773-74196795 CTTGACCAGGATGGTAGCAGTGG - Intronic
910407329 1:86903062-86903084 CTTGACAATCATGGTGGAATGGG + Intronic
910657825 1:89635829-89635851 CATGACAATGATGGTCTCATGGG + Intronic
911201194 1:95045418-95045440 ATTGACAATGTTGGAATAATAGG + Intronic
913493892 1:119409559-119409581 GCTGACAATAATGGTATGATAGG - Intergenic
917389148 1:174514171-174514193 CATGACAACAATGGAATCATGGG + Intronic
918069456 1:181124362-181124384 CTTCACACTGATGGTCACATGGG - Intergenic
918972696 1:191440226-191440248 CTTGGCATTGATGGTATTGTTGG + Intergenic
919097288 1:193053212-193053234 CTTGACACTGATAGAAACATAGG - Intronic
919555039 1:199041249-199041271 ATTGACAAACATGGTAACATAGG - Intergenic
921143533 1:212329474-212329496 ATATGCAATGATGGTATCATTGG - Intronic
923317558 1:232796020-232796042 CTTGACAATTATGGAATCTGTGG - Intergenic
924270619 1:242328816-242328838 CTTGCCAATGATGGGCTCTTTGG - Intronic
1064178591 10:13096642-13096664 TTTGATAATGAGGGTATCAGTGG - Intronic
1065081665 10:22135641-22135663 CTTGAATATGATGGGATCAAGGG - Intergenic
1066714327 10:38270042-38270064 CTTGCCAATGATGGGCTCTTTGG + Intergenic
1067013574 10:42737945-42737967 CTTAAAAATGATGGTATTTTGGG - Intergenic
1067310209 10:45105795-45105817 CTTAAAAATGATGGTATTTTGGG + Intergenic
1070945178 10:80384871-80384893 CTTGAAATTGGTGGTATTATGGG + Intergenic
1072935187 10:99705235-99705257 CTTGACAAAGAAGCCATCATGGG + Exonic
1074350984 10:112736918-112736940 CTTGGCAAGGATGCTATCAAAGG + Intronic
1076125692 10:127972107-127972129 CCTGACCATGAGGGTAACATGGG + Intronic
1076228331 10:128799098-128799120 CTTGACAATGATCTTGGCATAGG + Intergenic
1079446408 11:20560399-20560421 ATTGAAAAAGATGGTAACATTGG - Intergenic
1086894224 11:92293638-92293660 TTAGACAATGATGGTCACATGGG + Intergenic
1090907585 11:131090628-131090650 ACTGATAATTATGGTATCATTGG + Intergenic
1093400804 12:18744400-18744422 CTTGGCTGTGATGGTATCATGGG - Intergenic
1094225131 12:28036698-28036720 CTACACAATGATGGTATAACAGG + Intergenic
1095280045 12:40340365-40340387 CTTTGCAATGATGGCAGCATTGG - Exonic
1097675332 12:62595629-62595651 CTTGGCAGTGGTGGTAGCATAGG - Exonic
1100331267 12:93584650-93584672 CTTAATAATGATGCTATTATTGG + Intergenic
1105061670 12:133157982-133158004 CTTGAGAAAGAGGGTATCTTTGG - Exonic
1108117162 13:47141568-47141590 CTTGACATGGATGATATCATTGG + Intergenic
1112025951 13:95411123-95411145 CTTGATGGTGATGGTTTCATGGG + Intergenic
1113272343 13:108686982-108687004 CTTGACCATGGTGGAATCGTAGG - Intronic
1116216362 14:42022411-42022433 CTAGCCAATGATGGTAGCAGAGG + Intergenic
1118920498 14:70145621-70145643 TTTGACAGTGTTGCTATCATTGG - Intronic
1121579604 14:95017902-95017924 CTAGTCATTGATGATATCATGGG - Intergenic
1127860974 15:62994198-62994220 CTTTACAATGATGGCTTCACTGG - Intergenic
1131134727 15:89925351-89925373 CTTGACTATTTTGGTATCAAAGG + Intergenic
1131962328 15:97802862-97802884 CTTTACAGTGATGGAATCACTGG + Intergenic
1137800761 16:51260049-51260071 GATGACAATGATGGTAGTATTGG + Intergenic
1139275586 16:65724689-65724711 CCTGACATTGCTGGTATCATTGG - Intergenic
1147141444 17:38462873-38462895 CTTGACAAAGATGGTGTCCATGG - Exonic
1149165539 17:53747963-53747985 CATTACAATGATTGTATAATAGG + Intergenic
1150011588 17:61509644-61509666 CTTCATAAAAATGGTATCATAGG - Intergenic
1150551592 17:66215686-66215708 CATGACACTGATGGGATCAAGGG + Intronic
1155907765 18:31472992-31473014 ATTGACAATGGTGGCATCAATGG - Intronic
1158433776 18:57417985-57418007 CTTGGGAATTATGGTACCATGGG + Intergenic
1159690065 18:71476657-71476679 GCTGAGAATGATGGTTTCATGGG - Intergenic
1166607508 19:44157923-44157945 CTTCACAATTACAGTATCATAGG + Exonic
1168557987 19:57359522-57359544 CTTGACTGTGGTGGTTTCATAGG - Exonic
925877650 2:8326788-8326810 ATTGACAATGTTTGTGTCATAGG - Intergenic
926841343 2:17083907-17083929 CTTGAAAATGCTGGTGTCATGGG - Intergenic
928064619 2:28150933-28150955 CTTGCCAATGATAGTTTGATAGG + Intronic
931456699 2:62415172-62415194 CTTGACAGTCATGGTTTCAGAGG + Intergenic
932516387 2:72354464-72354486 CTTGACAAGGATGGCATCTTAGG + Intronic
933644074 2:84795576-84795598 GTTGACAATGTAGGTATCACAGG + Intronic
935594152 2:104866866-104866888 CTTTACAATGGTGGTATGGTGGG + Intergenic
935855952 2:107274143-107274165 CTTGACTATGATGGTATCTCAGG + Intergenic
943696706 2:190943394-190943416 CTTTAAAATGATGGTTTCTTAGG - Intronic
945310934 2:208312400-208312422 TTTGATTATGGTGGTATCATGGG + Intronic
946584499 2:221169745-221169767 CTTAACCATGATACTATCATTGG - Intergenic
947585108 2:231350764-231350786 CTTGTCAATGATGATCTCAATGG + Intronic
947585369 2:231353014-231353036 CTTGTCAATGATGATCTCAATGG + Intronic
1169560948 20:6800179-6800201 CCTGAAAATGAAGGTAACATAGG - Intergenic
1169832872 20:9843480-9843502 CTTGACAATGTCAGTATCATTGG + Intergenic
1175187142 20:57186407-57186429 TTTGACAATGATGAGGTCATTGG + Intronic
1175831692 20:61968059-61968081 CTTGACTGTGATGGTTTCACAGG - Intronic
951637292 3:24793643-24793665 ATTGACAATGATGATGTTATTGG - Intergenic
951742607 3:25940857-25940879 CTTGAAAATGATGCAGTCATGGG + Intergenic
951957342 3:28271764-28271786 CTTGACAATGGTAGTGTAATGGG + Intronic
952211760 3:31235266-31235288 CTTGACACTGATGGTATGAGTGG - Intergenic
954541401 3:51395180-51395202 CTTGATAATGACGGTTTCCTAGG + Exonic
961771898 3:129256132-129256154 CTGGACCATGATGTTATCACTGG - Exonic
961916345 3:130378982-130379004 CTTGAGAATGATGGTGGCAGTGG + Intronic
962670142 3:137696622-137696644 CTTGAAAAGGGTGGTACCATGGG + Intergenic
963753733 3:149211479-149211501 CTTAACAATGATGGTAAAAAAGG - Intronic
963962042 3:151320529-151320551 TTTGACAAGATTGGTATCATTGG + Intronic
964579979 3:158223038-158223060 CTTGACAATGGAGGTTTCAGCGG - Intronic
964821577 3:160776375-160776397 CTAGAGAAAGATGGTCTCATAGG + Intronic
964879096 3:161403900-161403922 CTTGACAATGAAGCTATAAAAGG + Intergenic
965224358 3:165969773-165969795 AATGTCAATGATGGTTTCATAGG + Intergenic
967317356 3:188161782-188161804 CTTGGAAATTATGGTATCTTAGG + Intronic
970572275 4:17394510-17394532 TTTAAAAATGATCGTATCATAGG - Intergenic
978407233 4:108393304-108393326 TTTAACAATGATGATATCTTCGG - Intergenic
983428028 4:167611622-167611644 CTTGACAACGTTGATATTATTGG + Intergenic
984186147 4:176546149-176546171 CTTTCCATTGAAGGTATCATGGG - Intergenic
986038885 5:3967703-3967725 CTTGACAATGTAGGGATTATGGG - Intergenic
988071254 5:26290579-26290601 CTTAACATGGATGGTACCATTGG + Intergenic
988389697 5:30611892-30611914 CTTTATAAGGATGATATCATTGG - Intergenic
988407129 5:30837921-30837943 TTTAACAAGGATGGTAGCATTGG + Intergenic
993985351 5:94590742-94590764 ATTGTCAATGTTGGTAACATTGG + Intronic
995947182 5:117662548-117662570 CTTGGCAATGTTTGTAACATGGG - Intergenic
999916293 5:156265827-156265849 CTTGACAATGGAGATATCCTGGG + Intronic
1003545776 6:7057068-7057090 CTGGACAAGGATAGTATCAATGG + Intergenic
1004125084 6:12865310-12865332 CTTGACAATGATGGTATCATGGG + Intronic
1004132976 6:12938633-12938655 CTTGATTGTGATGGTTTCATGGG - Intronic
1004308316 6:14521347-14521369 CGTGACAATGATGAGAGCATTGG + Intergenic
1006722925 6:36171125-36171147 CTTGATTGTGATGGTTTCATGGG + Intergenic
1010117920 6:72337320-72337342 CTTGAAAATGAAGGCATTATTGG + Intronic
1012153041 6:95779731-95779753 CTTCACAATGAAGGTACAATAGG - Intergenic
1015010981 6:128347313-128347335 CGTGAGAATGATATTATCATAGG + Intronic
1016732653 6:147443175-147443197 ATTGACAAAGATGGTGTCCTAGG + Intergenic
1018778386 6:167040254-167040276 CTTAACACTGATGTTTTCATGGG - Exonic
1020641791 7:10763623-10763645 TTTGGCAATGATGGTGTCATGGG - Intergenic
1023305420 7:38820829-38820851 CTTGTCAGTGATGGCTTCATTGG - Intronic
1031121494 7:117727449-117727471 CTTCCCAATGATGGGATTATAGG + Intronic
1031240511 7:119232307-119232329 CTTGGCAATGCTGGTATACTTGG - Intergenic
1031508288 7:122614999-122615021 CTAGATAATGATGTTATAATTGG - Intronic
1033718241 7:144025983-144026005 CTTGTAAAGGATGGTATAATTGG - Intergenic
1034457517 7:151179065-151179087 CATCCCAATGAGGGTATCATTGG - Intronic
1034760590 7:153668544-153668566 CTTGACATTGATGGGGTGATGGG + Intergenic
1035406310 7:158600108-158600130 CTGGAAAATGATGGTGTAATTGG - Intergenic
1038833779 8:31095032-31095054 TTTGAGAGTGATTGTATCATGGG + Intronic
1041011487 8:53548042-53548064 TTTGACAATGATGGTACCCGCGG + Intergenic
1041925977 8:63236833-63236855 CAAGACAATGAATGTATCATGGG + Intergenic
1043569729 8:81589180-81589202 CTTGCCAATGCTGGAGTCATGGG + Intergenic
1054926585 9:70595514-70595536 CTTGACACTGCTGATATCGTGGG - Intronic
1055372507 9:75615389-75615411 TTTGAGAATGATGTTCTCATGGG + Intergenic
1055891566 9:81129582-81129604 CCTGCCAATGATACTATCATTGG - Intergenic
1059758635 9:117317614-117317636 CTTGACACTCTTGATATCATAGG - Intronic
1060884449 9:127140634-127140656 CTTCACAGTGATGGGATTATAGG + Intronic
1062042276 9:134409600-134409622 CTTGACAATTTTGGTGACATCGG - Intronic
1185563280 X:1077051-1077073 CGTGACAATGAGTGTTTCATAGG + Intergenic
1185907091 X:3945124-3945146 CTTCACATAAATGGTATCATAGG + Intergenic
1186299470 X:8184028-8184050 CTTGACGATGATGATATAAAAGG - Intergenic
1188499925 X:30814425-30814447 CTTGACAGTGATGCTTTCACAGG - Intergenic
1189052982 X:37665831-37665853 CTAGACAAGGCTGGAATCATGGG - Intronic
1189082066 X:37984632-37984654 CTGGGCAATGCTGGCATCATAGG - Intronic
1189593503 X:42540365-42540387 CTTGACAAAGCAGGTGTCATTGG - Intergenic
1192606761 X:72526719-72526741 CGTGATAATGATGTCATCATTGG - Intronic
1193368941 X:80669370-80669392 CATGACTATGAGGATATCATGGG + Intergenic
1194339291 X:92689958-92689980 CTTGAAAATGATGGGAGCAGTGG - Intergenic
1197397699 X:125947747-125947769 CTTGACAATGATATTCCCATAGG - Intergenic
1198550014 X:137735599-137735621 CATAATAATGATGGTCTCATTGG + Intergenic
1199172100 X:144744308-144744330 CCTGAAAAAAATGGTATCATGGG + Intergenic
1200647678 Y:5806739-5806761 CTTGAAAATGATGGGAGCAGTGG - Intergenic
1200702085 Y:6410945-6410967 CTTCACAAGGATGATCTCATGGG - Intergenic
1201032026 Y:9753753-9753775 CTTCACAAGGATGATCTCATGGG + Intergenic