ID: 1004125245

View in Genome Browser
Species Human (GRCh38)
Location 6:12866692-12866714
Sequence TTTTATTTGCAGAGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 320}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004125245_1004125249 20 Left 1004125245 6:12866692-12866714 CCAGCTTCCCTCTGCAAATAAAA 0: 1
1: 0
2: 2
3: 30
4: 320
Right 1004125249 6:12866735-12866757 TGAGAAGAGACTCTGTGCTTTGG No data
1004125245_1004125250 23 Left 1004125245 6:12866692-12866714 CCAGCTTCCCTCTGCAAATAAAA 0: 1
1: 0
2: 2
3: 30
4: 320
Right 1004125250 6:12866738-12866760 GAAGAGACTCTGTGCTTTGGTGG 0: 1
1: 0
2: 2
3: 26
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004125245 Original CRISPR TTTTATTTGCAGAGGGAAGC TGG (reversed) Intronic
900598142 1:3491714-3491736 TTGTCTCTGCAGAGGGAAGTGGG - Intronic
900836989 1:5012617-5012639 TTGTATTTGCATAAGGAAGGGGG + Intergenic
901122277 1:6905549-6905571 CTTTATTATGAGAGGGAAGCGGG - Intronic
901469571 1:9446925-9446947 TTATATTTGCTGAAGGTAGCAGG - Intergenic
903044430 1:20554362-20554384 TTTTTTTTGCACAGGGAAGAAGG - Exonic
905279380 1:36839186-36839208 TGTCATTTGCAGAGGCAAGCTGG - Intronic
906256813 1:44356638-44356660 TTTAAATTGGAGAGGGAAGCTGG + Intergenic
906568056 1:46814410-46814432 TTATATTTGCTGAGGAAAGGGGG - Intronic
907849272 1:58238700-58238722 TTTTCTTTGAAGAGAGAGGCTGG - Intronic
909655375 1:78026021-78026043 TTTTTTTTGCATAGGGCACCAGG + Intronic
910675814 1:89815572-89815594 TTTTATTTAAATAGGGAAGGGGG + Intronic
912197769 1:107419609-107419631 TTTTTTTTGAAGAAGGAAGAAGG - Intronic
912391812 1:109308161-109308183 TTTAAAATGCAGAGGGATGCTGG - Intergenic
912393745 1:109323367-109323389 TTTGTTTTGAAGTGGGAAGCTGG + Intronic
913272101 1:117104446-117104468 TTTAGTTTGGAGAGGGATGCAGG + Exonic
913424998 1:118718687-118718709 GTTTTTTTGCAGAGGGTAGGGGG - Intergenic
915008605 1:152663865-152663887 TCTTCCTTTCAGAGGGAAGCTGG - Intronic
916837038 1:168556190-168556212 TTCTATTTGAAGAGGGAATGTGG - Intergenic
917311651 1:173685308-173685330 TTGTATTGGGAGATGGAAGCTGG + Intergenic
919413639 1:197278507-197278529 TTTTAATGGCAGAGGGAAAAAGG + Intronic
919605592 1:199678952-199678974 TTGAATTTGAATAGGGAAGCTGG + Intergenic
920536313 1:206738943-206738965 TTTTAGTGGCAGAGGGAAGAGGG - Intergenic
921075701 1:211698731-211698753 TCTTTTTTGCAGAGGGAGGGAGG + Intergenic
921507062 1:215984499-215984521 TTTAATTTTCACAGGGAAGCTGG + Intronic
921712648 1:218388149-218388171 TTTTATTGTCAGAAGGAAGCTGG - Intronic
922966406 1:229694537-229694559 CTTAATTTGCAGCAGGAAGCGGG + Intergenic
923485316 1:234424105-234424127 TTTTATTTTCTGAAGGTAGCAGG - Intronic
1064361126 10:14665774-14665796 TTCAATTTGCACTGGGAAGCAGG - Intronic
1065193850 10:23241673-23241695 TTTTTTTTAAAGAAGGAAGCAGG + Intergenic
1065225892 10:23543777-23543799 TTATAGTAGCAGAGGGAATCAGG + Intergenic
1066121211 10:32289411-32289433 CTTTTTTTGCAGGGGGAGGCGGG - Intronic
1066277937 10:33887152-33887174 TTTTTTTTGCAGGGGGTAGGGGG + Intergenic
1066678590 10:37914213-37914235 TGTTATTTCCAGAGGAAAGGAGG + Intergenic
1067959840 10:50836010-50836032 TTTTCTTTGCGGAGGCAGGCAGG + Intronic
1070521007 10:77253578-77253600 TTTCATCTTCAGAGGGTAGCAGG - Intronic
1072763267 10:98075794-98075816 TTATCTTTGGAGAGGGAAGTGGG + Intergenic
1073530094 10:104222792-104222814 TTTTATATCCAGCAGGAAGCAGG + Intronic
1073995660 10:109313196-109313218 TCTTAGTTCCAGAGGGAAGAAGG - Intergenic
1074641478 10:115388056-115388078 TTTTATGTGTAGTGGGAAGAAGG + Intronic
1074964141 10:118473905-118473927 TATTGTTTGCAGAGGCAAGGTGG - Intergenic
1075574105 10:123566011-123566033 TTTCCTTTGCAGAGCTAAGCTGG - Intergenic
1077490028 11:2856840-2856862 TTCCATTTGCATAGGGAGGCTGG - Intergenic
1078066818 11:8084025-8084047 TTTTACTTGCAGATGGGAGTGGG + Intronic
1079273344 11:19009760-19009782 TTTTATTCATAGAGGGATGCTGG + Intergenic
1079657068 11:22997499-22997521 TTCCATTAGCAGAGGGTAGCTGG - Intergenic
1081999436 11:47385521-47385543 TGTTATTTCTAGAGGGAAGTAGG - Intergenic
1082861101 11:57857568-57857590 TTTTATTTGGTGGGGGAAGGAGG - Intergenic
1084113203 11:67026579-67026601 TCTAATTTTCAAAGGGAAGCTGG + Intronic
1084675471 11:70631426-70631448 TTTTATTTGGAGAAGGCAGGTGG - Intronic
1086931609 11:92699710-92699732 TATCATCTGCAGAGGGAAGTAGG + Intronic
1088277775 11:108106822-108106844 TTTTTTTTGGAGGGGGAGGCTGG - Exonic
1090861090 11:130653026-130653048 TTTTATGTACACTGGGAAGCTGG + Intergenic
1091123496 11:133076414-133076436 TTTTCTTTGCAGGTGGAAGTGGG - Intronic
1092565689 12:9662843-9662865 TTTGCTTTTCAGAGAGAAGCTGG + Intergenic
1094747576 12:33363302-33363324 GTTTATTTGGAGATGGTAGCTGG - Intergenic
1095732209 12:45518591-45518613 TTTTACTAGAAGAGGGAAGCCGG + Intergenic
1096196674 12:49653042-49653064 TTTTAGTTGGAGAGGAAAGGTGG - Intronic
1096370326 12:51063957-51063979 TCTGATTTACAGAGGGCAGCTGG + Exonic
1096740160 12:53687456-53687478 TTTGTTTTGCTGAGGGTAGCAGG + Intergenic
1097175538 12:57140704-57140726 TTTGATGAGCTGAGGGAAGCAGG - Intronic
1097733361 12:63153500-63153522 TTTTATATACAAAGGAAAGCAGG + Intergenic
1099143511 12:79010284-79010306 TTTTATTTTCTGAGAGAAGCTGG - Intronic
1099963923 12:89424692-89424714 TTTTCTTTGCAAAGGTAAACTGG + Intronic
1100313416 12:93419648-93419670 TTTCATTTGCAAAGGAAAGGTGG - Intronic
1100501868 12:95182230-95182252 TTTTTTTTGGAGATGGAAGCTGG + Intronic
1100687799 12:97005547-97005569 TTTTATTTGGAGGAGGATGCAGG - Intergenic
1100985972 12:100201941-100201963 TTTTTTTTGGAGAGGGAGTCTGG + Intronic
1101491168 12:105210984-105211006 TGTCATTTGCTGAGGGTAGCAGG - Intronic
1102827418 12:115961182-115961204 GGTTATTTGCAGAGTGTAGCAGG + Exonic
1102885571 12:116519176-116519198 TTTTGTTTGCAGGGAGAAGAAGG - Intergenic
1103208858 12:119152147-119152169 TTCTTTTTGCAGAGGAAAGCTGG - Intronic
1104217358 12:126747295-126747317 TTTTATTTGCAGAAGTCTGCAGG + Intergenic
1104662240 12:130619760-130619782 TTTTGTTTGCACCGGGGAGCTGG + Intronic
1104717766 12:131027637-131027659 GTTTATTTACTGAGGGGAGCAGG + Intronic
1107232779 13:38130334-38130356 TTTTATTAGCAGAGTGAAAACGG + Intergenic
1107602124 13:42024322-42024344 TTTTATTGGTATAGGGAAACAGG + Intergenic
1107822387 13:44297435-44297457 TTTGATTAACAGAGGCAAGCAGG + Intergenic
1108837869 13:54573421-54573443 TTTTTTTTTCAGACGGAATCTGG - Intergenic
1109419588 13:62094077-62094099 TTTTCCTTGGAGAGGGAAGCTGG - Intergenic
1109720535 13:66269988-66270010 TTTTATTTTCAGATACAAGCAGG - Intergenic
1111023764 13:82490946-82490968 TTTTATTGTCAGAGGCAAGATGG + Intergenic
1111201909 13:84949071-84949093 CTTTCTTTGCAGAGAGCAGCAGG + Intergenic
1111815125 13:93143142-93143164 TTTTTTTTTTAGAGAGAAGCTGG + Intergenic
1112077048 13:95926455-95926477 TTTTATTTCTAGAGCAAAGCAGG + Intronic
1112468586 13:99667784-99667806 TTTTGTTTTTAGAGGGAATCAGG - Intronic
1112807010 13:103173922-103173944 TTCTATTTGTAGAGCAAAGCTGG - Intergenic
1113146894 13:107217628-107217650 TCTTCTTTTCGGAGGGAAGCAGG + Intronic
1118921098 14:70150676-70150698 CTCTCTTTGCAGAGGAAAGCAGG + Intronic
1119573034 14:75693165-75693187 TTTTAGATGGAGAGGAAAGCAGG + Intronic
1121098182 14:91232545-91232567 CTTTATTTGCAGACTGAAGTGGG + Exonic
1121460193 14:94069802-94069824 TTTTAATTGTAAAGGGATGCTGG - Intronic
1121806444 14:96829215-96829237 TTTTTTTTTGAGAGGGAAGTGGG + Intronic
1122297620 14:100714136-100714158 CTGTGGTTGCAGAGGGAAGCCGG - Intergenic
1122515601 14:102306234-102306256 TTTTTTTTTAAGAGGGAAGTGGG - Intergenic
1123929917 15:25161769-25161791 TGTTATTGGCAGATGGAAGGTGG + Intergenic
1124560232 15:30766694-30766716 TTTTTTTTTTAGAGGGAGGCTGG + Intronic
1125197212 15:37060857-37060879 TTTTATCTGCCAAGGGAATCTGG + Intronic
1125680758 15:41528811-41528833 TTTTGTGAGCAGAGGGAAGCTGG + Intronic
1126367295 15:47908304-47908326 CTGCCTTTGCAGAGGGAAGCTGG + Intergenic
1126385085 15:48086016-48086038 TATTAGCTGCAGAGGGCAGCGGG - Intergenic
1130040708 15:80403953-80403975 ATTTAGATTCAGAGGGAAGCCGG - Intergenic
1130261345 15:82355999-82356021 TTTTTTTTGCAAAGGCAAACCGG + Intergenic
1130279890 15:82513014-82513036 TTTTTTTTGCAAAGGCAAACCGG - Intergenic
1130471265 15:84229201-84229223 TTTTTTTTGCAAAGGCAAACCGG - Intergenic
1130478759 15:84343772-84343794 TTTTTTTTGCAAAGGCAAACCGG - Intergenic
1130493011 15:84444359-84444381 TTTTTTTTGCAAAGGCAAACCGG + Intergenic
1130593560 15:85233831-85233853 TTTTTTTTGCAAAGGCAAACCGG - Intergenic
1131222621 15:90597812-90597834 TCTCATTTGCTGAGGGAAACAGG + Intronic
1131472408 15:92708607-92708629 TTGAAGTTGAAGAGGGAAGCAGG - Intronic
1132329557 15:101002743-101002765 TTTTATTTTGAGATGGAATCTGG + Intronic
1133222823 16:4326484-4326506 GTCTCTTTGCAGAAGGAAGCGGG - Intronic
1133450993 16:5903909-5903931 CTGTCTTTGCTGAGGGAAGCTGG + Intergenic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1133641764 16:7724005-7724027 TTTTACTTGCTGAAGGAAGCTGG - Intergenic
1135054328 16:19218483-19218505 TTGTATCTGCAAAGGGAAGAAGG + Intronic
1136054845 16:27680686-27680708 CTTTTTTTGCAGAGGGAGGGTGG + Intronic
1136387275 16:29936845-29936867 TTTTATATGCAGAGGTTACCAGG - Intergenic
1137994001 16:53188622-53188644 TTTTTTTTTGAGATGGAAGCTGG + Intronic
1139345045 16:66297357-66297379 TTTTATTTGTAGAAGGAAACAGG - Intergenic
1141494116 16:84395164-84395186 TTTTACTCACAGAGGGAAGTCGG + Intronic
1142732166 17:1867096-1867118 TTTAAATTGGAGAGGGAATCGGG + Intronic
1142934158 17:3313248-3313270 TATTATTTGAGGAGGGCAGCAGG + Intergenic
1145076976 17:19863839-19863861 TTTTATTTGGAATGGGAAGTAGG - Intronic
1145237496 17:21219077-21219099 TTTTATTTGCAATGGGTACCAGG - Intergenic
1145944386 17:28762037-28762059 TTTTTTTAGCAGAGGCAAGGGGG + Intronic
1146437999 17:32869272-32869294 TTTTATTTCCTGTAGGAAGCAGG - Intronic
1146929334 17:36766695-36766717 TTCTCTATGCAAAGGGAAGCTGG + Intergenic
1147637083 17:41970683-41970705 TTTTATTTGTAAAGGAAAACTGG + Intronic
1149503385 17:57172372-57172394 ATTTAACTGCAGAGGGAAGAGGG + Intergenic
1149794350 17:59505676-59505698 TCTTACTGGGAGAGGGAAGCAGG + Intergenic
1150474863 17:65467218-65467240 TTTTATTTTTAGAGGACAGCTGG + Intergenic
1151315257 17:73317899-73317921 TTTTCCCTGCAGAGGGAAGGAGG - Intergenic
1151402396 17:73864355-73864377 CTTCATTTACAGATGGAAGCTGG + Intergenic
1151878850 17:76882484-76882506 TTTTATTTAAAGAGGAAAACAGG - Intronic
1152012413 17:77726709-77726731 TTTGAGGTGCAGAGTGAAGCTGG - Intergenic
1152014061 17:77737933-77737955 TGTTATTTGCAGATGGAAATTGG + Intergenic
1152307587 17:79530331-79530353 ATTTATTCGCAGAGGGACGAGGG - Intergenic
1155946154 18:31853935-31853957 TTTTTTTGACAGAGTGAAGCAGG - Exonic
1156878132 18:42041574-42041596 TTTTTTTTACAAAGGGAAGCAGG - Intronic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1158476450 18:57784210-57784232 TGGAATTTGCAGGGGGAAGCCGG + Intronic
1159129953 18:64270127-64270149 TTTGATCTGAAGAGGGAAACAGG + Intergenic
1160014729 18:75131850-75131872 TTTTATTTTCAGAGGAAACCTGG + Intergenic
1160421257 18:78747278-78747300 TTGTATTTGCAGAGTTGAGCAGG + Intergenic
1161253274 19:3292894-3292916 TTTTTTTTGCAGAAGGGAGTGGG - Intronic
1162094643 19:8303126-8303148 TTTTTTTTGGAGAGGGAGTCTGG + Intronic
1164188271 19:22892043-22892065 TTTTAACTTCAGAGGAAAGCAGG + Intergenic
1164319810 19:24133649-24133671 TTTTACTTTCAAAGGGATGCTGG + Intergenic
1167706116 19:51082218-51082240 TTTTGTTGTCAGAGGGAAGGTGG - Intronic
925122708 2:1431885-1431907 TCTAACTTGCAGAGGGAAGGAGG + Intronic
926511752 2:13790044-13790066 TTTTTTTTGAATAGGGAAACAGG + Intergenic
927098866 2:19771438-19771460 CTTTATTCGAAGAGGAAAGCTGG - Intergenic
927165330 2:20314135-20314157 ATTTATTTGCAGTGGGGAGCAGG - Intronic
928500137 2:31882745-31882767 TTTTATTTCCAGAGGTAAAGGGG + Intronic
929259021 2:39844264-39844286 TTTTATTCTGAGAGGGGAGCAGG + Intergenic
929603260 2:43218134-43218156 TTTTATGGGGAGAGGGAACCCGG - Intergenic
930154418 2:48091645-48091667 TTTTATTTGCACAAGGAGCCTGG + Intergenic
930764829 2:55074503-55074525 TTTTTTTTGGTGAGGGCAGCAGG - Intronic
933842347 2:86297828-86297850 TTTTATTTTGAGAGGGACCCAGG - Intronic
935050810 2:99523433-99523455 TTTTTTTTGCAGATGGAGTCTGG - Intergenic
935233732 2:101120495-101120517 TATTATTTGCACAACGAAGCAGG + Intronic
935677856 2:105611044-105611066 TTTTATTTGCAGAGAGGATTTGG + Intergenic
936057987 2:109275754-109275776 TGTCATTAGCACAGGGAAGCAGG - Intronic
936408843 2:112235798-112235820 TTTAATTTCCAGAGGGAGCCAGG + Intronic
936869828 2:117122946-117122968 ATTTATTTGCAGAGGCAAAGGGG + Intergenic
937670616 2:124533734-124533756 CTTTGTTTGTAGTGGGAAGCAGG - Intronic
938234762 2:129696750-129696772 CTTTATTTGCAGAGTGAAAATGG + Intergenic
938951575 2:136259424-136259446 TTTTATTTTCAGCAGGCAGCTGG + Intergenic
940655160 2:156479517-156479539 TTTTATTTTCTAAGGGAAACAGG + Intronic
940904313 2:159155263-159155285 TTTTATTTTGATAGGAAAGCTGG - Intronic
941593637 2:167449790-167449812 TTTTATTCGTAGAGGAATGCTGG + Intergenic
942547417 2:177079476-177079498 TTATATTTGCAGAGAGGAGCTGG - Intergenic
944084057 2:195823600-195823622 TTTCATTTACAGAGGCAAGCAGG - Intronic
944561270 2:200940902-200940924 TTTCTTTTGCAGGGGGAAGAGGG - Intronic
946575365 2:221070269-221070291 TTTTATGTGCATTGGGAAACTGG + Intergenic
1169437469 20:5605733-5605755 TTTTTTTTGGAGGGGGAGGCAGG - Intronic
1170141854 20:13132666-13132688 GTTTATTTGCTGAGGTAAGAGGG - Intronic
1170215224 20:13884517-13884539 TTTTATTTTTAGAGGGAGTCTGG + Intronic
1170883768 20:20320087-20320109 ATTTATTTGTTGAGGGAATCAGG - Intronic
1171233045 20:23502543-23502565 TCTTATGTGCAGCAGGAAGCAGG - Intergenic
1172493146 20:35357762-35357784 TTTGTTTTGCAGTGGGTAGCAGG - Intronic
1174712509 20:52722262-52722284 TATTATTCACGGAGGGAAGCAGG + Intergenic
1175613985 20:60376965-60376987 GTTTATCAGCAGAGGGAAGAAGG + Intergenic
1175878678 20:62243864-62243886 TTTTTTTTGCAGAGGGTAGGGGG + Intronic
1178140112 21:29673078-29673100 CTTTATTCCCAGAGGGCAGCTGG + Exonic
1178454006 21:32729810-32729832 TTTAATTTGAAGAAAGAAGCTGG - Intergenic
1178625347 21:34212075-34212097 TTTTATTGGCGGAGGGTGGCAGG + Intergenic
1178881032 21:36450220-36450242 TTTTAATTGGAGGGGGATGCAGG - Intergenic
1179373000 21:40824413-40824435 TTTTTTTTGGAGACAGAAGCTGG + Intronic
1179430992 21:41321087-41321109 TTGTATTTGGAGAAGGAAACTGG - Intronic
1179443183 21:41410439-41410461 TTTTTTTTTCAGAGGGAAAATGG + Intergenic
1182003245 22:26938508-26938530 TTTTATTGAGAGAGGGAAGGAGG - Intergenic
1182186752 22:28412085-28412107 TTTTAGTTGGTGAAGGAAGCTGG + Intronic
1183259209 22:36783417-36783439 TTCTATTTGCAGAGGGAAGAAGG - Intergenic
949661947 3:6289984-6290006 TTTTATTTGCAGGTGGAAGGTGG + Intergenic
951551487 3:23879495-23879517 ATTTATTTGCAGTGGGAAATTGG - Intronic
953030392 3:39176101-39176123 TTTCATCAGGAGAGGGAAGCTGG - Intergenic
953386256 3:42507673-42507695 CTTTATTTGCAGAGGAACACAGG - Intronic
954050834 3:47975746-47975768 TTTTATTTGGGGAGGGAAGGTGG - Intronic
954062999 3:48084582-48084604 TTTTTTTTGCAGGGGTGAGCAGG + Intronic
954127389 3:48539522-48539544 TTTGCTTTCCAGAGGGAAGGGGG - Intronic
955694304 3:61620388-61620410 TTGAATTTGCAGAGGGAAAATGG + Intronic
956391394 3:68776571-68776593 TATTAGTTGCAGAGAGAAGGGGG - Intronic
961804023 3:129475969-129475991 CTATATTTGCAGAGGGAGGGGGG + Intronic
961809408 3:129513332-129513354 TTTTCCTTACAGAGGGAAGGTGG - Intronic
962555934 3:136551437-136551459 TTTTTTTGGCAGGGGGAAGAGGG + Intronic
963397461 3:144751675-144751697 TTTTATATGGAGATGGTAGCTGG + Intergenic
963781502 3:149491281-149491303 TTTTTTTTGTAGAGGGGCGCTGG - Intronic
964083135 3:152784871-152784893 TTTTATTTGGGGAGGGAAAAGGG - Intergenic
964898830 3:161632250-161632272 TTTTATTTGTAGAGATAAGAGGG + Intergenic
966506775 3:180712174-180712196 ATTTATTTGCAGAGTTCAGCTGG - Intronic
966649496 3:182283454-182283476 TTTTATTTGTAGAATGAAGAAGG + Intergenic
966847919 3:184144812-184144834 GTTTATCTGCCGAGGGGAGCAGG + Intronic
967603783 3:191420002-191420024 TTTTATGTGCACTGGGAAACCGG + Intergenic
969319760 4:6404632-6404654 TCTGAGTTGCAGAGGGATGCTGG + Intronic
969352110 4:6603963-6603985 TCTGATTTGGAGAGGGAGGCTGG - Intronic
970645024 4:18109829-18109851 TTGATTTTGCAGATGGAAGCAGG - Intergenic
970856504 4:20655336-20655358 TTTTATTTACAAAGGGATGCTGG - Intergenic
972071943 4:35032091-35032113 TTTTATGCCCAGAGAGAAGCTGG - Intergenic
972615103 4:40690680-40690702 TTTTTTTTAGAGGGGGAAGCAGG - Intergenic
972778316 4:42264111-42264133 TTTGATTTTCACAGGGAAGGAGG + Intergenic
975187059 4:71416010-71416032 ATTTATTAGCTGAGGGACGCTGG - Intronic
975536010 4:75451481-75451503 TATTATTTCCAAAGGCAAGCAGG + Intergenic
975890448 4:79021030-79021052 TTTAATATGAAGAGGAAAGCAGG + Intergenic
976226127 4:82797209-82797231 TTTTATTTCCAGAGGGGAAGAGG - Intronic
976384765 4:84443938-84443960 TTTTGTTGGCAGATGGAAGAGGG + Intergenic
978609862 4:110525855-110525877 ATTAATTGGGAGAGGGAAGCAGG + Intronic
979689529 4:123546080-123546102 TTTTGTTAGCAGAGAGAAGTTGG - Intergenic
979916768 4:126444880-126444902 TTCTATTGGCAGATGGAAGTGGG - Intergenic
980854857 4:138427127-138427149 TTTAATTTGCTGAGGGAATGAGG + Intergenic
981052259 4:140320741-140320763 TTTAATCTGCAAAGGGAAGTTGG + Intronic
982224856 4:153155987-153156009 TCTGATTTGCCAAGGGAAGCTGG + Intronic
982395285 4:154909313-154909335 TTTTAGTTAGAGAGAGAAGCAGG + Intergenic
982614356 4:157622154-157622176 TTTTTTTTGCGGGGGGGAGCTGG + Intergenic
983679114 4:170331483-170331505 TTTTTTTTCCAGAGGTAAGATGG + Intergenic
984645515 4:182215506-182215528 TTTGATTGGCTGTGGGAAGCTGG - Intronic
984911064 4:184674565-184674587 TTTTATCTGCATAGAGAAGTTGG - Intronic
985189788 4:187360316-187360338 TTGTATTTGGGGAGGGAAGAAGG + Intergenic
985732176 5:1555524-1555546 TGGTGTTTGCAGAGGGAGGCAGG - Intergenic
987284564 5:16442981-16443003 TTTTGTTTGAAGAGGGATGGAGG - Intergenic
988605026 5:32671966-32671988 TTTTATTTATACAGGGAAGGAGG - Intergenic
988701145 5:33676018-33676040 TTTTGTTTGCAGAGGAAATGAGG - Intronic
988715754 5:33825942-33825964 TTCAATTTGCAGAGGTGAGCTGG - Intronic
988779520 5:34507374-34507396 TGTGATTTGCAGAGGATAGCAGG - Intergenic
989446228 5:41532714-41532736 TTTTATTTGTAGAGGGTTGACGG - Intergenic
989713338 5:44428174-44428196 TTCTAGTTGGAGAGGGAACCTGG - Intergenic
989822632 5:45812828-45812850 TTTTCCTTGCAGAGGGACACTGG + Intergenic
990172026 5:53062200-53062222 TTTTCTAGGCAGAGGGAAGTGGG - Intronic
990253720 5:53943334-53943356 TTTTATTTTCTCAGGGAAACAGG + Intronic
990767866 5:59207267-59207289 TTTAATATACAGAGGGAAGAGGG + Intronic
991481794 5:67089247-67089269 TTAAACATGCAGAGGGAAGCAGG + Intronic
992795886 5:80255239-80255261 GTTTATTTGCAAAGAGAGGCAGG + Intronic
993784220 5:92108852-92108874 TTTTATTTGTAAAGAGAATCAGG + Intergenic
994759436 5:103834677-103834699 TTTTATTTTCACAGCAAAGCTGG + Intergenic
995676083 5:114663883-114663905 TTTTTTTTGGAGATGGAATCTGG - Intergenic
996570265 5:124926459-124926481 TTTTCTTTTGAGAGGGAATCTGG + Intergenic
997083480 5:130768557-130768579 TTTTATTTGCAGAGGATTACTGG - Intergenic
997154125 5:131533643-131533665 TTCATTTTGCAAAGGGAAGCTGG + Intronic
997493393 5:134298873-134298895 TTTTTTTTGCGGGGGGCAGCGGG + Intronic
997685218 5:135783727-135783749 CTTAATTTCCAGAGGGAAGGAGG + Intergenic
1000486339 5:161848783-161848805 ATTTATTTGCAAGGGGGAGCTGG + Intronic
1001689962 5:173625626-173625648 ATTTATTTCCAGAGGGAGCCTGG + Intergenic
1002182722 5:177439624-177439646 TTTTTTTTGCAGAGTGGGGCAGG - Intronic
1002515270 5:179753463-179753485 TTTTATTTGTAAAGGGAATAAGG + Intronic
1002827859 6:790101-790123 TTTTAATTGGAGAGGGAAAAGGG + Intergenic
1003007569 6:2396039-2396061 TTTTGCTTGCAGACGGAAGAAGG + Intergenic
1003084254 6:3048909-3048931 TTTCCTTTCCAGAGTGAAGCTGG + Intergenic
1003447239 6:6195788-6195810 TTGTTTTTGCAGAGGTAAGCAGG - Exonic
1003571816 6:7261098-7261120 TTTTATTTGCAAAGCGAAGCGGG - Intergenic
1003604411 6:7545989-7546011 TTGGATAGGCAGAGGGAAGCTGG + Intronic
1003814034 6:9817057-9817079 ATTTATTTGCAGAGCCCAGCTGG - Intronic
1004125245 6:12866692-12866714 TTTTATTTGCAGAGGGAAGCTGG - Intronic
1004350683 6:14887873-14887895 TTTTTTTTTCAGAGGGAGACAGG + Intergenic
1004407932 6:15351870-15351892 TGTCATCAGCAGAGGGAAGCGGG - Intronic
1004808680 6:19234161-19234183 CTTAATCTGCAGAGGGAAGGGGG + Intergenic
1006401442 6:33820161-33820183 TTTTATTTTCAAAGTGATGCTGG - Intergenic
1008139355 6:47814073-47814095 ATTGAGTTGCAGAGTGAAGCAGG + Intronic
1008180282 6:48319773-48319795 TTCTATTTTCTCAGGGAAGCAGG + Intergenic
1009893171 6:69713787-69713809 TGTTATTTGCAGAGCAAAGATGG - Exonic
1009927840 6:70141881-70141903 TTTTATTTACAGGGAGAACCTGG + Exonic
1010512842 6:76741879-76741901 TTTTAATTACAAAGGGATGCTGG + Intergenic
1013839816 6:114378037-114378059 TTTTGTTTGCAGTGGGAAGGTGG - Intergenic
1014397291 6:120940811-120940833 TTTCTTTTGAAGAGGGAAGGTGG + Intergenic
1014880223 6:126714797-126714819 TTAGATCTGCCGAGGGAAGCTGG + Intergenic
1015029922 6:128582616-128582638 TCTTTTTTGCAGAGGCAAGTAGG - Intergenic
1015152663 6:130056264-130056286 TTTTATTTCCAGGAGGAAACCGG + Intronic
1015195151 6:130517639-130517661 TTTGGTTTGCAGGGGGATGCTGG - Intergenic
1015799128 6:137043401-137043423 TTTTAATCGAAGAGAGAAGCTGG - Intronic
1015868086 6:137747970-137747992 TTTTCTTAGAAGAGGGAAGCAGG + Intergenic
1017276983 6:152581232-152581254 TTTTATTTGCACAGGTAAGAGGG + Intronic
1019275803 7:175004-175026 TTTTTTTTTAAGAGGAAAGCTGG + Intergenic
1021116678 7:16753256-16753278 TCTTATTTTCTGAGAGAAGCAGG + Intergenic
1021127536 7:16869687-16869709 TTTTTTTTGCAGGGGGCAGGGGG + Intronic
1021822906 7:24515893-24515915 TTTTTTTTGCGGGGGTAAGCAGG + Intergenic
1022220133 7:28306394-28306416 CTATAGTTTCAGAGGGAAGCTGG - Intronic
1022753471 7:33258101-33258123 TTTTATTGGCAGAGAGAATGGGG + Intronic
1026069799 7:67108611-67108633 TTTTATTTTCTGAGAGAAACGGG + Intronic
1026116306 7:67498607-67498629 TTTTATTGAGAGAGGGCAGCAGG + Intergenic
1026393222 7:69924416-69924438 TTTTATTATCAGAGTGATGCTGG + Intronic
1027772420 7:82424207-82424229 TTTTATTTTCAGAGTGCTGCTGG - Intronic
1028231319 7:88309588-88309610 TTTTATATGCAGAAGGCTGCTGG + Intergenic
1028819215 7:95186714-95186736 TTTTAATTGTAAAGGGATGCTGG + Intronic
1030604361 7:111623433-111623455 ACTTATTTGATGAGGGAAGCAGG - Intergenic
1030686904 7:112496439-112496461 TTTTATTTGCAGAAAGAAGGGGG + Intergenic
1030837629 7:114309090-114309112 TTTTATTTGCAGCAGAGAGCAGG + Intronic
1031384380 7:121129730-121129752 TTTTATTTGCGGGGGAAAGAGGG + Intronic
1032056190 7:128686199-128686221 TTTTATTTTGAGACGGAATCTGG - Intronic
1033286834 7:140048647-140048669 TATTTCTTGCAGAGGGAACCTGG + Intronic
1033289556 7:140071759-140071781 GTTTTTCTGCAAAGGGAAGCAGG + Intergenic
1033541389 7:142358933-142358955 TTTTTTGTGCAGAGAGCAGCTGG - Intergenic
1033544390 7:142386663-142386685 CTTTTTGTGCAGAGGGCAGCTGG - Intergenic
1034019899 7:147630766-147630788 TTTTATTCGTAAAGGGATGCTGG - Intronic
1036196557 8:6721816-6721838 TTTTACATGCACAGGGAAGGAGG + Intronic
1037785475 8:21900443-21900465 TCTTATTTGTAGGTGGAAGCAGG + Intergenic
1038933739 8:32224502-32224524 TGTAATTTGCAAGGGGAAGCTGG - Intronic
1042858145 8:73287829-73287851 TTTTATATTAAGAGGGAGGCAGG + Intergenic
1045926611 8:107583552-107583574 TTTAATTTGCAGAAGGAAAGAGG - Intergenic
1046811961 8:118543106-118543128 TTTTCTTTGGAGAGGGAACTAGG - Intronic
1047278688 8:123426022-123426044 TCTTTTTTGCAGGGGGGAGCGGG - Intronic
1047812823 8:128428976-128428998 TTTCAGTGCCAGAGGGAAGCAGG + Intergenic
1048262012 8:132953188-132953210 TGTGAGTTGCAGAGGGGAGCTGG + Intronic
1048302564 8:133262336-133262358 TTTTATCAGCAGAGGAAAGTGGG - Intronic
1049285827 8:141774730-141774752 TTTTCCTTGGAGAGGGAGGCTGG + Intergenic
1050688078 9:8194270-8194292 TTTTATTGGCAGGGTGATGCTGG - Intergenic
1050745962 9:8876732-8876754 TCTTATTTGCAAAGGGTACCTGG - Intronic
1052398272 9:27968110-27968132 TTTTATATGCAAAGTGGAGCTGG + Intronic
1052474837 9:28945684-28945706 TTTTAAATACAGAGGGTAGCAGG - Intergenic
1054928806 9:70615367-70615389 TTTGTTCTGCAGAGGGAAGGGGG - Intronic
1056697539 9:88872505-88872527 TTTTATTTTTTGAGGGAAGGGGG + Intergenic
1057415032 9:94854187-94854209 TTTTATTTTCAGAGAGCAGGTGG + Intronic
1057466156 9:95316912-95316934 TTTTATTCCCGGAGGGAGGCGGG - Intronic
1060029585 9:120202880-120202902 TTTTGTTCACAGAGAGAAGCAGG + Intergenic
1061298035 9:129687543-129687565 TTGAGTGTGCAGAGGGAAGCCGG - Intronic
1061488351 9:130931739-130931761 TTTTATTTGCAGTGTGATTCTGG - Intronic
1062446656 9:136598076-136598098 TTTTTTTAGCAGCAGGAAGCTGG - Intergenic
1185757711 X:2665115-2665137 TTGAAATTGCAGAGGGGAGCAGG + Intergenic
1186447243 X:9642078-9642100 TTTAAATGTCAGAGGGAAGCAGG + Intronic
1186776886 X:12873721-12873743 TTGTATTTGCAGAGAAAAGTAGG - Intronic
1187070610 X:15883776-15883798 TTTTTTTTTCAGAGGGGAGGAGG - Intergenic
1187817635 X:23249944-23249966 TTTGATTTGCAGAGTGAAACTGG + Intergenic
1189407511 X:40738074-40738096 TTTAATTTGCATAGAGAGGCAGG + Intergenic
1189894841 X:45644746-45644768 TTCCATTTCCAGAGGGAAACAGG - Intergenic
1189992642 X:46609269-46609291 CACTCTTTGCAGAGGGAAGCAGG + Intronic
1190241086 X:48658760-48658782 TTTTATTTGCAGAAGGTAAAAGG - Intergenic
1192812393 X:74558949-74558971 TGTTATTTACAGGGGTAAGCGGG - Intergenic
1194053253 X:89099731-89099753 TTTTATTTTGAGAGGGAGTCTGG + Intergenic
1194690864 X:96982546-96982568 TTTTCTTTGAAAAGAGAAGCTGG + Intronic
1196410675 X:115414854-115414876 TTTTATTTTCAGATGGAGTCTGG - Intergenic
1196421644 X:115528289-115528311 TTTTTTTTGCAGAGGGGTTCAGG + Intergenic
1198237826 X:134752250-134752272 TTTTTTTTAGAGAGGGAAGTGGG + Intronic
1199874549 X:151920241-151920263 TGGGATTGGCAGAGGGAAGCCGG + Intronic
1199891317 X:152085535-152085557 TTTTCTTTGCGGATGGAAGAAGG + Intergenic
1201607135 Y:15799472-15799494 TTTATTTTGCACTGGGAAGCAGG - Intergenic