ID: 1004126818

View in Genome Browser
Species Human (GRCh38)
Location 6:12882121-12882143
Sequence ACAGGGGGATGGAGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1371
Summary {0: 1, 1: 0, 2: 8, 3: 131, 4: 1231}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004126811_1004126818 -7 Left 1004126811 6:12882105-12882127 CCCGAGGCTGAGAGGGACAGGGG 0: 1
1: 0
2: 9
3: 86
4: 811
Right 1004126818 6:12882121-12882143 ACAGGGGGATGGAGGGAAGCAGG 0: 1
1: 0
2: 8
3: 131
4: 1231
1004126813_1004126818 -8 Left 1004126813 6:12882106-12882128 CCGAGGCTGAGAGGGACAGGGGG 0: 1
1: 0
2: 5
3: 51
4: 527
Right 1004126818 6:12882121-12882143 ACAGGGGGATGGAGGGAAGCAGG 0: 1
1: 0
2: 8
3: 131
4: 1231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004126818 Original CRISPR ACAGGGGGATGGAGGGAAGC AGG Intronic
900051717 1:602214-602236 AGAGGGGGATGGAGGGGGGATGG - Intergenic
900204859 1:1427470-1427492 GCAGGGTGATGGAGGGGAGGGGG - Intronic
900291996 1:1927560-1927582 AGAGGGGCCTGGAGGGAAGCAGG + Intronic
900414438 1:2528557-2528579 ACAGGGGGAGGGAGGGATGGAGG - Intergenic
900491786 1:2952942-2952964 AGAGAGAGATGGAGGGAAGGGGG - Intergenic
900619785 1:3581429-3581451 CCAGGGGGCTGCAGGGAAGCCGG + Intronic
900654790 1:3751141-3751163 ACAGGGTGATGGTGGGGAGAAGG - Intergenic
900881685 1:5386260-5386282 TCAGGGGAAAGCAGGGAAGCAGG - Intergenic
900951077 1:5858590-5858612 GCAGGGGGATGGTGTGAAGAGGG - Intergenic
900951682 1:5861654-5861676 ACAGGAGGATGGAGGTTGGCGGG - Intergenic
900993178 1:6107155-6107177 ATGGAGGGATGGAGGGAAGGTGG + Intronic
900993574 1:6108742-6108764 ACAGAGGGATGGAGGGTTGGAGG + Intronic
901031976 1:6312422-6312444 AGAGGGGGAGGGAGGGAGGGAGG - Intronic
901079474 1:6575784-6575806 GCAGGGGAATGGAGTGAACCTGG - Intronic
901142191 1:7042414-7042436 ACAGGGAGAGGCAGGGAAACTGG - Intronic
901198985 1:7456144-7456166 ACAGAGGGATGGAGGAAGGGAGG + Intronic
901203777 1:7482488-7482510 TCAGGAGGATGGAGGGAGGTGGG - Intronic
901312803 1:8282473-8282495 ACAGGACGAAGGCGGGAAGCAGG + Intergenic
901426011 1:9182694-9182716 ACAGGGTGGTGGGGGGAAGGGGG + Intergenic
901439708 1:9270475-9270497 TCAGAGAGATGGAGGCAAGCTGG - Exonic
901519079 1:9768958-9768980 AAAGGGGGAAGGAGGGAAGAAGG + Intronic
901835491 1:11921438-11921460 ACAGGCACATGGGGGGAAGCTGG + Intronic
901843310 1:11966743-11966765 ACATGGGCATGGAGGGAGGGAGG - Intronic
901846125 1:11983664-11983686 CCAGGGTGATGCAGGGCAGCTGG - Intronic
902383807 1:16065202-16065224 AGTGGGGGATGGGGGGAAGGTGG - Intronic
902436795 1:16403288-16403310 ACAGAGGGAGGGATGGTAGCTGG - Intronic
902628314 1:17689503-17689525 AGAGAGGGAGGGAGGGAGGCAGG - Intronic
902628338 1:17689571-17689593 AGAGAGGGAGGGAGGGAAGGAGG - Intronic
902918258 1:19651634-19651656 ACAGAGGGAGGGAGGGAGGCTGG - Intronic
903304650 1:22404233-22404255 TGAAGGGGATGGAGGGAGGCAGG + Intergenic
903331712 1:22600058-22600080 AAGGGGGGATGGAGGGAGGAAGG + Intronic
903341666 1:22658760-22658782 ACAGAGGGATGGAGGGATGCAGG + Intronic
903350782 1:22715399-22715421 GCTGGGGGAGGGAGGGAGGCAGG - Intronic
903378736 1:22882637-22882659 ACAGTGGGAAGGAGCGGAGCTGG - Intronic
903463404 1:23534922-23534944 ACATGGGGATGGAGGGGAGGAGG - Intergenic
903632452 1:24786430-24786452 ACAGGGGTGTGAAGGGAAGAGGG + Intronic
903975896 1:27149979-27150001 ACAGTGGGAGGGAGGTCAGCTGG - Intronic
904043677 1:27598314-27598336 GAAGGGGGCTGGAGGGAGGCAGG + Intronic
904223170 1:28990388-28990410 AGAGGGGGAAGGAGGGAGGGAGG - Intronic
904337955 1:29810275-29810297 AGAGAGGGAGGGAGGGAAGGAGG - Intergenic
904629429 1:31829984-31830006 GCTGTGGGAAGGAGGGAAGCAGG + Intergenic
905341295 1:37279684-37279706 ACTGGAGGATGGAAGGAAGAAGG - Intergenic
905605962 1:39300393-39300415 ACAGGGGGAAGGAAGAAAGAAGG + Intronic
905933737 1:41807444-41807466 ACAGAGGGAGTGAGGGAAGGAGG + Intronic
905998394 1:42402021-42402043 TCAGCGGGATGGCGGGAAGCTGG + Intronic
906143648 1:43547712-43547734 TGAGGGGAGTGGAGGGAAGCGGG + Intronic
906291872 1:44624666-44624688 ACAGGGAGAAGGAGGGAGGGAGG + Intronic
906472614 1:46143912-46143934 AGAGGGGGATGAAGGGAGGTTGG - Intronic
906558919 1:46739574-46739596 AAAGGGGGAAGGAGGGAAGGAGG - Intergenic
906783987 1:48597887-48597909 AAAGAGGGAGGGAGGGAAGGAGG + Intronic
907014618 1:50999793-50999815 AGCGGGGGTTGGAGGGAAGTGGG + Intergenic
907074501 1:51566179-51566201 AAAGAGGCATGGAGGGAAGAGGG - Intergenic
907266304 1:53263595-53263617 ACAGGGGTAGGGATGGAGGCAGG + Intronic
907498665 1:54862230-54862252 ACAGGGTGATGGCTGGAGGCGGG - Intronic
907508080 1:54936569-54936591 AAAGAGGGAAGGAGGGAAGGAGG - Intergenic
908211308 1:61903171-61903193 TCAGGGGCAGGGATGGAAGCAGG + Intronic
908932161 1:69330770-69330792 TCAGGGGGTTGGGGGGAACCTGG - Intergenic
909604236 1:77492804-77492826 GCAGGGGGCTGGATGGAAGGTGG + Intronic
910920896 1:92345454-92345476 ACAGAGGGAGGGAGGGAAAGAGG + Intronic
912151210 1:106860796-106860818 ACGGAGGGAGGGAGGGAGGCAGG + Intergenic
912166816 1:107051214-107051236 ACAGGGGGAGGGAGAGCATCAGG + Intergenic
912308460 1:108595361-108595383 ACAGAGGGAGAGAGGGAAGGAGG + Intronic
912548897 1:110471566-110471588 ACTGGGGGCTGCAGGGAAGTGGG - Intergenic
912741838 1:112205284-112205306 AAAGGGGGATGGAGCCAAGATGG - Intergenic
912897474 1:113608227-113608249 AGAGAGGGAGGGAGGGAAGAAGG + Intronic
913693999 1:121306628-121306650 AGGGAGGGAGGGAGGGAAGCGGG - Intronic
914143565 1:144973439-144973461 AGGGAGGGAGGGAGGGAAGCGGG + Intronic
914347043 1:146808783-146808805 ACAGTGGGATGTGGGGAGGCTGG + Intergenic
914846986 1:151288869-151288891 CCATGGAGATGGGGGGAAGCAGG + Intronic
914960769 1:152204463-152204485 AGATGGGGAGGGAGTGAAGCAGG - Intergenic
915078855 1:153337477-153337499 TCAGGGGGAATGAGGGAGGCAGG + Intronic
915367266 1:155323352-155323374 GCAGAGGGAAGGAGGGCAGCGGG - Intronic
915722113 1:157993298-157993320 TCAGGCGGAGGGAGGGAGGCAGG + Intronic
916325949 1:163560177-163560199 ACAAGCTGATGGAGTGAAGCAGG - Intergenic
917016478 1:170537108-170537130 AAAGAGGGAGGGAGGGAAGAAGG - Intronic
917030991 1:170691514-170691536 AGAGAGGGAGGGAGGGAAGAAGG - Intronic
917482892 1:175427755-175427777 AAAGAGGGAAGGAGGGAAGAAGG - Intronic
917513334 1:175686631-175686653 AGAGGGGGATGGAGGGGACAAGG - Intronic
917643487 1:177006873-177006895 AAAGCGGGATGCAGAGAAGCAGG + Intronic
917709334 1:177668842-177668864 CCAAAGGGAAGGAGGGAAGCTGG - Intergenic
917725226 1:177821386-177821408 AGAAGGGGAGGCAGGGAAGCGGG + Intergenic
918162580 1:181915089-181915111 CCTGGGGGATGGAGGTAACCAGG + Intergenic
918286118 1:183056522-183056544 ACGGGGGGATGGGGGGAGGAGGG - Intronic
918625516 1:186652420-186652442 AGAGAGGGAGGGAGGGAAGGAGG - Intergenic
918725682 1:187919684-187919706 ACTGGAGGATGGAGGGTAGGAGG - Intergenic
918857754 1:189780666-189780688 AGGGAGGGATGGAGGGAAGAAGG + Intergenic
919163302 1:193860067-193860089 ACAGACGGATGGAGGGAGGGAGG - Intergenic
919509758 1:198447614-198447636 AAAGGGGGAGGGAGGGAAGGAGG - Intergenic
919935101 1:202245998-202246020 ACAGAGGGAAGGAGGGATGGGGG - Intronic
920023686 1:202976117-202976139 AAAGAGGGAAGGAGGGAAGGAGG - Intergenic
920481324 1:206325007-206325029 AGGGAGGGAGGGAGGGAAGCGGG - Intronic
920994702 1:210978130-210978152 ACAGGGGAATGGCGTGAACCAGG - Intronic
921090441 1:211836854-211836876 ACGTGGGGAGGGAGGGGAGCAGG - Intergenic
921370703 1:214419934-214419956 ATAGAGGGATGGAGGGAGGGAGG - Intronic
921556552 1:216604978-216605000 ACAGGTGGATGGAAGGAGGGAGG + Intronic
921836314 1:219782481-219782503 GCAGGGGGAAGTGGGGAAGCTGG - Intronic
922010485 1:221579629-221579651 ACAGGAGAATGGCGGGAAACTGG - Intergenic
922043081 1:221916216-221916238 ACAGGGTGATGGAGAGGAGCTGG + Intergenic
922414008 1:225403839-225403861 GCAGGGGGATCCAGGGGAGCTGG - Intronic
922414027 1:225403884-225403906 GCAGGGGGATCTTGGGAAGCTGG - Intronic
922456154 1:225775223-225775245 AAAGGGGGAGGGTGGGAAGATGG + Intergenic
922574335 1:226652158-226652180 GCTGGGGGAAGGAGGGAAGGAGG + Intronic
922854337 1:228761163-228761185 GCAGGGGGAGGGAGGGGAGACGG + Intergenic
922984709 1:229857350-229857372 ACAGGGGGGTGCAGGGAGGGTGG + Intergenic
923241985 1:232095069-232095091 CCAGGAGGATGGAGAGAAGGAGG - Intergenic
924600276 1:245482712-245482734 ACACTGGGTAGGAGGGAAGCGGG - Intronic
1063006815 10:1979570-1979592 CCAGGCAGATGGGGGGAAGCGGG + Intergenic
1063289963 10:4735116-4735138 AAAGAGGGAGGGAGGGAAGGAGG - Intergenic
1063379665 10:5576244-5576266 AGAGAGGGAGGGAGGGAAGGAGG - Intergenic
1063427086 10:5958946-5958968 ACAGGAGGAAGAAGGGAAGCAGG - Intronic
1063666403 10:8063222-8063244 AGAGGGGGAGGGAGGGAAAAAGG - Intronic
1063789634 10:9427560-9427582 AGAGAGGGAAGGAGGGAAGGAGG + Intergenic
1063808389 10:9675069-9675091 AAAAGGGGAGGGAGGGAAGGAGG - Intergenic
1063999848 10:11654294-11654316 AGAGAGGGAGGGAGGGAAGGAGG + Intergenic
1064288234 10:14011342-14011364 AAAGGGGGAGGCAGGGAGGCTGG + Intronic
1064405493 10:15058956-15058978 AGAGAGGGAGGGAGGGAAGGAGG - Intronic
1065246015 10:23758649-23758671 AAAGGGGGAGGGAGGGAGGGAGG - Intronic
1065926337 10:30436460-30436482 AAGGGGAGAGGGAGGGAAGCAGG - Intronic
1066263638 10:33753480-33753502 ACAGGGGGTTGCAGTGAGGCAGG + Intergenic
1066271384 10:33827551-33827573 GCAGGGGGATGGAGAGCATCAGG + Intergenic
1066361604 10:34737125-34737147 AAAGGGGGACGGAGAGAAGCAGG + Intronic
1066537470 10:36407582-36407604 ACAGGGGAATGGCGTGAACCCGG - Intergenic
1066959668 10:42209384-42209406 AGAGAGGGAGGGAGGGAAGGAGG - Intergenic
1067144359 10:43683245-43683267 ACAGGGGGATGGTGGCTAGAAGG + Intergenic
1067216608 10:44309427-44309449 AGAGGGGGAGGGAGGGAAGGAGG + Intergenic
1067230196 10:44400975-44400997 AAAGGGGGAGGGAAGGAGGCAGG - Intergenic
1067660872 10:48235469-48235491 ACAGGGGGGTGCATGGAAGCTGG + Intronic
1067667815 10:48293460-48293482 AGAGGGAGAGGGAGGGAAGAAGG + Intergenic
1067800103 10:49352880-49352902 AGGGAGGGATGGAGGGAGGCAGG + Intergenic
1068079525 10:52302707-52302729 CTAGGGGGATGGAGGGACGGAGG - Intergenic
1068450383 10:57178885-57178907 AGAGAGGGAGGGAGGGAAGGAGG + Intergenic
1068840801 10:61611777-61611799 ACAGGGAGAGGGAGGGGAGAAGG + Intergenic
1068850357 10:61731757-61731779 ACAGAGGGAGGAAGGGAAGGAGG + Intronic
1069200379 10:65607760-65607782 AGAGAGGGAGGGAGGGAAGAAGG - Intergenic
1069200413 10:65608000-65608022 AGAGAGGGAGGGAGGGAAGAAGG - Intergenic
1070432482 10:76354936-76354958 GCAGGGGGATGAAGAGAGGCTGG - Intronic
1070661784 10:78311749-78311771 ACAGAGGGAGGGAGGGAGGAAGG - Intergenic
1070681328 10:78451416-78451438 ACAGGGGGCTACAGGGAAGAAGG - Intergenic
1070799212 10:79235238-79235260 ACAAGGGGCTGGAAGGGAGCAGG + Intronic
1071444772 10:85735806-85735828 AAGGAGGGATGGAGGGATGCAGG + Intronic
1071503960 10:86221931-86221953 ACAGGGGTAGGGAGGGCAGGGGG + Intronic
1071564897 10:86666725-86666747 GGAGGCGGATGGAGGGAGGCCGG + Intronic
1071720943 10:88145614-88145636 AGAGAGGGAGGGAGGGAAGAAGG - Intergenic
1072539893 10:96390331-96390353 ATAGGGGGATGGAGGGATCAAGG + Intronic
1072770014 10:98130046-98130068 GCAGAGGGATGGAGAGAAGTGGG - Intergenic
1072794499 10:98344121-98344143 ACAGAGGCATAGTGGGAAGCAGG - Intergenic
1072811486 10:98466026-98466048 ACAGGTGGGCGGAGGGTAGCGGG - Intronic
1072905268 10:99447164-99447186 GCAGGGGGATGAAGGGAAGTTGG + Intergenic
1073055517 10:100698295-100698317 ATCGGAGGATGGAGGGAAGTTGG - Intergenic
1073164088 10:101428570-101428592 ACTGAGGGATGGATGGAGGCAGG + Intronic
1073471868 10:103727523-103727545 AAAGGGAGAAGGAGGGACGCAGG + Intronic
1073578443 10:104643034-104643056 ACCGCGGGAGGGAGGGAAGTCGG - Intronic
1073591872 10:104765554-104765576 ACAGGGGGCTGGCTGGAAGAAGG - Intronic
1073597691 10:104817336-104817358 AGAGGGGGGAGGAGGGAGGCAGG - Intronic
1073851215 10:107620554-107620576 AGTGAGGGATGGAGGGAAGGAGG - Intergenic
1074107826 10:110401744-110401766 CCATGGGGAGGGAGGGAGGCAGG - Intergenic
1074160829 10:110835128-110835150 AAAGGCAGAGGGAGGGAAGCTGG - Intronic
1074326380 10:112455320-112455342 AAGGGGGGAAGGAGGGAAGGAGG - Intronic
1074326407 10:112455381-112455403 AAGGGGGGAAGGAGGGAAGGAGG - Intronic
1074609129 10:115004429-115004451 ACGGAGGGAGGGAGGGAAGCAGG - Intergenic
1075172209 10:120126575-120126597 ACAGGAGAATGGAGACAAGCTGG - Intergenic
1075614475 10:123881453-123881475 AGAGGGGAAGGAAGGGAAGCAGG + Intronic
1075908018 10:126099357-126099379 AGAGAGGGAGGGAGGGAAGGAGG - Intronic
1076156757 10:128210834-128210856 AGCGGGGGTTGGAGGGAAGGGGG - Intergenic
1076254615 10:129012212-129012234 ACATGGGGATGGAAGGATGGGGG + Intergenic
1076572438 10:131441411-131441433 ACAGAGGGAGGGAAGGAAGGAGG + Intergenic
1076611901 10:131731330-131731352 ACAGGGTGACTGAGGGCAGCAGG + Intergenic
1076778081 10:132709253-132709275 TGAGGGGGATGGAGGGAGGGAGG + Intronic
1076940199 10:133600278-133600300 ACAGGGTGATGGCGGGGAGAAGG - Intergenic
1077007871 11:367464-367486 GCTGGGTGATGGAGGGAGGCCGG - Intergenic
1077163237 11:1123060-1123082 TCAGGAGGAAGGAGGGAAGAGGG - Intergenic
1077211013 11:1370974-1370996 ACCAGGGACTGGAGGGAAGCTGG + Intergenic
1077227452 11:1444639-1444661 AGAGGGGGAGGGAGGGAAGCTGG - Intronic
1077287984 11:1776041-1776063 AGAGGGGGATGGAGAGGAGATGG + Intergenic
1077288017 11:1776141-1776163 AGAGGGGGATGGAGAGGAGATGG + Intergenic
1077288028 11:1776175-1776197 AGAGGGGGATGGAGAGGAGATGG + Intergenic
1077288043 11:1776220-1776242 AGAGGGGGATGGAGAGGAGATGG + Intergenic
1077288058 11:1776265-1776287 AGAGGGGGATGGAGAGGAGATGG + Intergenic
1077289550 11:1782579-1782601 ACAGGAGGATGGGGTGAAGGGGG - Intergenic
1077301432 11:1848941-1848963 TCCGGGGGATGGAGCCAAGCAGG - Intergenic
1077337225 11:2010828-2010850 ACATGGGGAGGGAGGGAGGCAGG - Intergenic
1077337443 11:2011715-2011737 ACGGGGGGCAGGAGGGAAGGGGG + Intergenic
1077347691 11:2071676-2071698 GCAGGAGGGAGGAGGGAAGCTGG - Intergenic
1077434578 11:2532656-2532678 ACAGTGAGAAGGAGGTAAGCTGG + Intronic
1077457966 11:2692291-2692313 CAATAGGGATGGAGGGAAGCAGG - Intronic
1077480875 11:2813964-2813986 ATAGAGAGATGGAGGGAAGGAGG + Intronic
1078106771 11:8362823-8362845 AGAGAGGGATGGAGGGAGGAAGG - Intergenic
1078411172 11:11120086-11120108 AGAGAGGGAGGGAGGGAAGGAGG - Intergenic
1078488565 11:11747694-11747716 ACAGAGGGAAGGAGGGAGGGAGG + Intergenic
1078804834 11:14688144-14688166 AGAGAGGGATGGAGGGAGGGAGG - Intronic
1079588310 11:22152436-22152458 GCAGGGGAATGGCGGGAACCCGG - Intergenic
1079629339 11:22654364-22654386 AGAGAGGGAGGGAGGGAAGGAGG - Intronic
1080352345 11:31399891-31399913 ACAGGGGGAGGGAGAGCATCTGG - Intronic
1080864718 11:36183125-36183147 ACGGTGGGATGGTGGGAAGGTGG + Intronic
1081063185 11:38505163-38505185 GCAGGAGAATGGAGGGAACCCGG - Intergenic
1081642060 11:44762897-44762919 ACAGTGGGAGGGATGTAAGCAGG - Intronic
1082134733 11:48534057-48534079 ACAGGGGGGTGGAGCCAAGATGG - Intergenic
1082866136 11:57901753-57901775 ACAGGGGTCAGGAGGGAGGCTGG + Intergenic
1083041053 11:59687901-59687923 ACGTGGGGTTGGAGGGAAGGTGG + Intergenic
1083146065 11:60759855-60759877 ACAGGGTGATGGTGGGGAGAAGG - Intronic
1083203347 11:61132926-61132948 AGAGGTGGCCGGAGGGAAGCAGG + Intronic
1083266578 11:61549836-61549858 CCAGGGGGAGGGCGGGCAGCAGG - Intronic
1083610782 11:64003177-64003199 AGAGGAGGGTGGAGGGAAGAAGG - Intronic
1083634809 11:64114779-64114801 ACAGGTGGATGGATGGTAGGTGG + Intronic
1083853006 11:65378807-65378829 AGGGGTGGATGGAGGGAAGAGGG - Intronic
1083875704 11:65523526-65523548 ACAGGGTGATGGTGGGAAGAAGG - Intergenic
1083880479 11:65546007-65546029 ACAGCGGGATGGGAGGAAGGAGG - Intronic
1083953843 11:65971582-65971604 AGAGGGGGATGGTGGGATTCAGG + Intronic
1084268186 11:68015499-68015521 AGGGGGGCATGGAGGGCAGCTGG + Intronic
1084655847 11:70517701-70517723 TCAGGGGGAGGGAAGGAAGGTGG + Intronic
1084748605 11:71189186-71189208 GCTGGTGGATGGCGGGAAGCCGG - Intronic
1084919544 11:72458070-72458092 AAAGAGGGAGGGAGGGAAGGAGG + Intergenic
1084959702 11:72710037-72710059 ACAGGGAGAGGAAGGGAAGGTGG + Intronic
1085287075 11:75370032-75370054 AGAAGAGGAAGGAGGGAAGCAGG - Intergenic
1085383289 11:76140066-76140088 AGAGGGGGAGGGAGGGAGGGAGG - Intronic
1085571455 11:77561370-77561392 ACAGCGGGATGGAGGGTGACAGG + Intronic
1085975833 11:81653658-81653680 ACAGGGGGATGGAGGGAGAGAGG - Intergenic
1085998209 11:81947968-81947990 TGAGAGGGAGGGAGGGAAGCGGG + Intergenic
1086062344 11:82712693-82712715 ACAGGGAGTTGGAGGCAATCTGG + Intergenic
1086092060 11:83014787-83014809 AGAAGGGGAGGGAGGGAGGCAGG + Intronic
1086307154 11:85493765-85493787 AGAGAGGGAGGGAGGGAAGGAGG + Intronic
1087034848 11:93744914-93744936 ACAGGGTGATGGTGGGGAGAAGG + Intronic
1087191364 11:95258011-95258033 ACAGGAGAATGGAGTGAAACCGG - Intergenic
1087217540 11:95510188-95510210 ACAGAGAGATGGAGGAAAACAGG - Intergenic
1087565893 11:99856993-99857015 AGAGAGGGAAGGAGGGAAGGAGG - Intronic
1087813586 11:102634222-102634244 ACATAGAGATAGAGGGAAGCTGG - Intergenic
1088173027 11:107018539-107018561 AAAGGGAGAAGGAGGGAGGCAGG - Intergenic
1088537218 11:110874420-110874442 AGGGAGGGAGGGAGGGAAGCAGG - Intergenic
1088714269 11:112535055-112535077 ACATGGGGGTGGAGGGGAGAGGG + Intergenic
1088756513 11:112889742-112889764 ACAGAGGTCTGGAGAGAAGCTGG + Intergenic
1088848612 11:113687890-113687912 ACAGGGGCAGGGAGGGGAGAGGG + Exonic
1088907832 11:114168255-114168277 TCCTGGGGCTGGAGGGAAGCAGG - Intronic
1088979714 11:114851296-114851318 AGAGAGGGAGGGAGGGAAGCAGG - Intergenic
1088984631 11:114894677-114894699 ACAGGGTGAGGGAGGGGAGGAGG + Intergenic
1089163281 11:116455955-116455977 AGAGGAGGATGGACGGAGGCTGG + Intergenic
1089303506 11:117512816-117512838 CCAGGGAGAGGGAGGGAAGTGGG - Intronic
1089400025 11:118159053-118159075 ACAGGGGTATAGAGGGGACCTGG + Intergenic
1089610381 11:119665352-119665374 AGAGGGGGTGGGAGGGAGGCAGG + Intronic
1090328513 11:125910035-125910057 AGAATGGGATGTAGGGAAGCTGG - Intronic
1090373156 11:126270815-126270837 GCAGGGGGTAGGATGGAAGCGGG + Intronic
1090386369 11:126359748-126359770 CCACGGGGAAGGAGGGAAGGAGG - Intronic
1090683153 11:129083565-129083587 GCAGGGGGATGATGGGAAGAAGG + Intronic
1090727851 11:129543866-129543888 ACTGAGGGAGGGAGGGAAGGAGG + Intergenic
1090748659 11:129727298-129727320 ACATGGGGATGGAGGGCAGGGGG + Intergenic
1090752641 11:129760657-129760679 ACAATGGGATGGTGGAAAGCAGG + Intergenic
1202816776 11_KI270721v1_random:49755-49777 CCAGGGGGTTGGGGGGGAGCCGG - Intergenic
1202820209 11_KI270721v1_random:66010-66032 ACATGGGGAGGGAGGGAGGCAGG - Intergenic
1202820427 11_KI270721v1_random:66897-66919 ACGGGGGGCAGGAGGGAAGGGGG + Intergenic
1091461547 12:647052-647074 ACAGGGGTAGGGAGGGCAGGGGG - Intronic
1091524434 12:1284035-1284057 AGAGGGGGATGAAGGGAGGTTGG - Intronic
1091658861 12:2366459-2366481 ATTGGGTGCTGGAGGGAAGCAGG + Intronic
1091781042 12:3214884-3214906 TCAGGGGGATGGGGGGAAGGAGG - Intronic
1091841181 12:3621980-3622002 ACAGGGGCAGGGAGAGGAGCTGG + Intronic
1092277796 12:7075343-7075365 ACAGAAGGAGGGAGGGAAGAAGG - Intergenic
1092778893 12:11967260-11967282 GCGGGGGGATGGAAGAAAGCTGG - Intergenic
1092886534 12:12929319-12929341 AAAGGGAGATGGGGGGAAGGAGG + Intergenic
1093206649 12:16259397-16259419 ACTGGGGGAGGGAGGGACGAAGG - Intronic
1093717005 12:22394100-22394122 ACAGGGGGTTAGAGGGAAAGGGG - Intronic
1093832253 12:23776628-23776650 ACAGGGGGATGGTGGAAGGGAGG + Intronic
1094072267 12:26430872-26430894 GCAGAGGGATGGAGAGAAACAGG - Intronic
1094072549 12:26433806-26433828 GCAGAGGGATGGAGAGAAACAGG + Intronic
1094177278 12:27553776-27553798 ACAGGCAGATGGAGTTAAGCTGG + Intronic
1094589790 12:31809431-31809453 GGAGGGTGAGGGAGGGAAGCAGG - Intergenic
1095223408 12:39647547-39647569 GCTGGAGGATGGAGAGAAGCAGG + Intronic
1095454682 12:42370687-42370709 ACAGGCTGAAGGAGGGAAGATGG - Intronic
1095874473 12:47065543-47065565 AGAGAGGGAGGGAGGGAAGAAGG + Intergenic
1095969913 12:47894550-47894572 GCAGGGGAGTGAAGGGAAGCAGG - Intronic
1096104535 12:48989168-48989190 ACAGTGGGATACAGGGAAGGGGG - Intergenic
1096121444 12:49091790-49091812 TCAGGCGGAGGGAGGGGAGCCGG - Intronic
1096217977 12:49808975-49808997 GCAGGGGGAGGGAGAGAAGGAGG + Intronic
1096250401 12:50028366-50028388 ACAGGGGGAAGGAGAAAAGTGGG - Intronic
1096311411 12:50524547-50524569 GCGGGAGGATGGAGGGAGGCAGG - Intronic
1096760295 12:53836137-53836159 AGTGGGGAATGGAGGGAAGCCGG + Intergenic
1096806703 12:54145383-54145405 ACAGATGGATGGAGGGATGGAGG + Intergenic
1096861564 12:54532430-54532452 GTAGGGGGATGGAGAGAAGTGGG + Intronic
1096869561 12:54584845-54584867 ACAGGGGAATGGGGGCATGCAGG - Intronic
1096943190 12:55372469-55372491 AAGGAGGGAAGGAGGGAAGCAGG + Intergenic
1097149882 12:56968821-56968843 ACAGGGTGATGGTGGGGAGAAGG + Intergenic
1097167945 12:57095509-57095531 ATAGGGGAGTGAAGGGAAGCTGG + Exonic
1097394155 12:59053589-59053611 ACATGAGGATGGATGGTAGCAGG - Intergenic
1097904062 12:64902236-64902258 AGAGAGGGAGGGAGGGAAGTAGG - Intergenic
1099005716 12:77232913-77232935 AAAGAGGGAGGGAGGGAAGGAGG - Intergenic
1099224175 12:79949399-79949421 ACAGAGGGAAGGAGGAAAGGAGG - Intergenic
1099385735 12:82010980-82011002 GCAGGAGGATGGTGTGAAGCTGG - Intergenic
1099609413 12:84848502-84848524 AAAGAGGGATGGATGGAAGGAGG + Intergenic
1100299931 12:93297452-93297474 GGAGGAGGATGGAAGGAAGCTGG + Intergenic
1100370820 12:93967098-93967120 AGGGAGGGATGGAGGGAAGGGGG - Intergenic
1100447617 12:94675922-94675944 AGAGGGGCATGGAGGAAGGCGGG - Intergenic
1100821821 12:98438937-98438959 GCAGGGGGATTAAGGGAAGAAGG + Intergenic
1101148185 12:101861521-101861543 AGGGGGGGAGGGAGGGAAGGAGG - Intergenic
1101255598 12:102973817-102973839 AGAGAGGGAAGGAAGGAAGCTGG - Intergenic
1101345335 12:103880941-103880963 GCAGGGGAGTGGAGGGAAGGGGG - Intergenic
1101525311 12:105523219-105523241 ACAGAGGGAGGGAGGGAGGGAGG + Intergenic
1101527209 12:105542262-105542284 ACAGGGGAATGCGGGGATGCAGG + Intergenic
1101662052 12:106774636-106774658 AAAGAGGGAAGGAAGGAAGCTGG + Exonic
1101952413 12:109187058-109187080 AAAGGGGGATGGAGGGAGGGAGG + Intronic
1102026813 12:109718383-109718405 AGAGGGGGCTGGAGGGAGGTTGG - Intronic
1102454959 12:113065528-113065550 AGAGGAGGAGGGAGGGAAGAAGG - Intronic
1102490401 12:113286912-113286934 ACAGGGCCAGGGAGGGGAGCAGG + Intronic
1102556020 12:113727205-113727227 GCAGGGGGAGGGAAGGAAGAAGG - Intergenic
1102599208 12:114016246-114016268 ACAGGAGGGAAGAGGGAAGCTGG + Intergenic
1102759642 12:115374471-115374493 ACATGGGGAAGGAAGGAAGGAGG + Intergenic
1102781474 12:115569799-115569821 AGAGGGAAATGCAGGGAAGCTGG - Intergenic
1102932428 12:116872852-116872874 AGAGAGGGAGGGAGGGAGGCAGG + Intronic
1102991990 12:117322288-117322310 ACAGAGGGAGGGAAGGAAGGAGG - Intronic
1102992091 12:117322646-117322668 ACGGAAGGAGGGAGGGAAGCAGG - Intronic
1103215672 12:119199721-119199743 ACGGAGGGAGGGAGGGAAGGAGG - Intronic
1103652444 12:122443464-122443486 AAAGAGGGAAGGAGGGAAGGAGG - Intergenic
1103737715 12:123070940-123070962 ACAGGGGGATGCAGGGAAGGAGG + Intronic
1103846933 12:123908295-123908317 AGAGGGGGATGGAGGGACAGAGG - Intronic
1103978231 12:124717746-124717768 ACAGGAGGAGGGAGAGGAGCAGG + Intergenic
1103989010 12:124785959-124785981 TCAGGGGGATTGAGGGGGGCTGG - Intronic
1104189104 12:126460713-126460735 ACAGATGGATGGAGGGATGGAGG + Intergenic
1104262171 12:127194343-127194365 ACAGGGGGAAGGAGGGAAGGAGG - Intergenic
1104514122 12:129408046-129408068 ACAGGCAGACGGAGGGACGCAGG - Intronic
1104571423 12:129929555-129929577 AGTGCGGGATGGAGGGAGGCAGG - Intergenic
1104668854 12:130666984-130667006 ACAGAGGGAGGAAGGGAAGGAGG + Intronic
1104772874 12:131375161-131375183 AGAGAGGGATGGAGGGAAGATGG + Intergenic
1104878750 12:132054739-132054761 ACAGTGGGATGGAGGGTCCCTGG + Intronic
1104910109 12:132236256-132236278 ACAGGCGGCTGGCGGGGAGCGGG + Intronic
1105209122 13:18247515-18247537 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1105326029 13:19371178-19371200 ACATGGGGATGTAGGGGAGGAGG + Intergenic
1105514687 13:21078382-21078404 AAAGAGGGAGGGAAGGAAGCGGG + Intergenic
1105603711 13:21909805-21909827 AGAGTGGGATGGAGGGTTGCGGG + Intergenic
1105828195 13:24141434-24141456 ACAGCAGGTGGGAGGGAAGCAGG - Intronic
1105869538 13:24491981-24492003 ACAGAGGGACGGAAGGAGGCTGG + Intronic
1105880318 13:24599972-24599994 AGAGGGGGATGGAGGGAGAAGGG - Intergenic
1105896021 13:24718086-24718108 AAAGGGGGGTGGAGGGAGGGAGG + Intergenic
1105919516 13:24948894-24948916 AGAGGGGGATGGAGGGAGAGGGG + Intergenic
1106386055 13:29287274-29287296 GAAGGGGGATGGTGTGAAGCAGG + Intronic
1106570513 13:30923313-30923335 AGAGGAGGAAGGAGGGAAGGAGG - Intronic
1106726312 13:32490050-32490072 GGAGGGGGATGGAGGGGAACTGG - Intronic
1107044732 13:35982429-35982451 AGAGGGGGAGGGAGGGAGGGAGG + Intronic
1107485173 13:40819729-40819751 AGAGGGGGATGGAGGGAGAGGGG + Intergenic
1107835571 13:44410102-44410124 CCACGTGGAGGGAGGGAAGCAGG - Intergenic
1107936921 13:45353028-45353050 ACAGGAGGATGGCGTGAACCCGG - Intergenic
1107993340 13:45837602-45837624 ACAGAGGGAGGGAGGGAGGAAGG + Intronic
1108190093 13:47929473-47929495 GCAGGGAAATGAAGGGAAGCAGG + Intergenic
1108332685 13:49405768-49405790 ACAGAGGGAGGGAGGGAGGGAGG + Intronic
1108550857 13:51542526-51542548 AGAGGGGGTTGTAGGGAAGGGGG - Intergenic
1108829293 13:54456918-54456940 AAAGAGGGAGGGAGGGAAGGAGG - Intergenic
1109281083 13:60356432-60356454 AGAGAGGGAGGGAGGGAAGGAGG + Intergenic
1110552946 13:76828131-76828153 AGAGGGGAAGGGAGGGAAGGAGG + Intergenic
1110641526 13:77830203-77830225 AGGGGGGGAGGGAGGGAAGAAGG - Intergenic
1110834966 13:80073178-80073200 AGAGGGGAAGGCAGGGAAGCTGG - Intergenic
1110843972 13:80173137-80173159 ACGGAGGGAGGGAGGGAAGAAGG + Intergenic
1111529860 13:89522133-89522155 AGAGAGGGAAGGAGGGAAGGAGG + Intergenic
1111904977 13:94244792-94244814 AGAGGGGGATGTAGGGAATGTGG + Intronic
1112138135 13:96606592-96606614 ACAGAGGGAGGGAGGGAGGGAGG + Intronic
1112248256 13:97754163-97754185 ACTGGGGGAGGAAGGGCAGCAGG - Intergenic
1112465703 13:99642733-99642755 AGGGAGGGAGGGAGGGAAGCAGG - Intronic
1112573358 13:100613805-100613827 AGAGGGGGAGGGAGGGAGGAAGG - Intronic
1112716842 13:102196830-102196852 AAAGGGGGATGGATGGAAAGGGG - Intronic
1112924740 13:104660431-104660453 TCTGGGAGATGGAGGGAGGCTGG - Intergenic
1113049978 13:106200130-106200152 ACAGAGGGAGGGAGGGAAGGAGG - Intergenic
1113206894 13:107926688-107926710 ACAGGGGGAAGGAGCCAAGATGG - Intergenic
1113251544 13:108458540-108458562 GAAGGGGGAGAGAGGGAAGCGGG - Intergenic
1113680686 13:112242227-112242249 ACAGAGGGATGGAGGGAAGGAGG + Intergenic
1113990424 14:16023888-16023910 ACAGAGGGAGGGAGGGAGACAGG - Intergenic
1114041859 14:18686260-18686282 ACAGAGGGAGGGAGGGAGGGAGG - Intergenic
1114452137 14:22834331-22834353 ACAGGGTGAGGAAGGGAGGCAGG - Exonic
1114460591 14:22883815-22883837 AAAGGGGGCTAGAGGGAGGCTGG - Intronic
1114664402 14:24369448-24369470 AGAGGGGGAAAGAGAGAAGCAGG - Intronic
1114739536 14:25081085-25081107 AAAGAGGGAGGGAGGGAAGAAGG - Intergenic
1114984017 14:28203292-28203314 ACAGGGGGGTGGGGGGAGGGTGG + Intergenic
1115026801 14:28756145-28756167 AAAGAGGGAAGGAGGGAAGGAGG + Intergenic
1115054669 14:29108822-29108844 AAAGAGGGAGGGAGGGAAGTAGG + Intergenic
1115343284 14:32315425-32315447 ACAGGGGGTTGAGGGGAAGTGGG - Intergenic
1115389939 14:32842841-32842863 AGAGAGGGAGGGAGGGAAGAAGG + Intergenic
1115509129 14:34122767-34122789 AGAGAGGGAGGGAGGGAAGGAGG + Intronic
1115744082 14:36418259-36418281 ACAGGAGGCTGTAAGGAAGCAGG + Intergenic
1115921777 14:38382288-38382310 ACAGGGGGAGGGAGGGCATCAGG + Intergenic
1116136749 14:40934575-40934597 ATTGGGGGATGGAGGGTGGCAGG - Intergenic
1116429191 14:44826463-44826485 ACAGGGGGAGGGAGAGTATCAGG + Intergenic
1116481340 14:45394328-45394350 ACAGAGTGATGGTGGGAAGAAGG - Intergenic
1116981189 14:51172550-51172572 GCAGGGGGCTGGAGGGAGGTGGG - Intergenic
1117115043 14:52502585-52502607 ACAGGGGGGTGGAGCCAAGATGG + Intronic
1118328474 14:64797528-64797550 ACAGGGGGATTGAAGGAGGGTGG + Intronic
1118734856 14:68693997-68694019 ACAAGGGGATGGGAGGGAGCAGG + Intronic
1119115280 14:72014822-72014844 AGACGGGTATGGAGGGAAGCGGG - Intronic
1119156685 14:72418030-72418052 ACAGGCAGATGGAGGAAAGGTGG - Intronic
1119377611 14:74207158-74207180 AGAGGTGGATGGCGGGAAGTAGG - Intergenic
1119424708 14:74528021-74528043 GCACGGGGCTGGAGGGAGGCTGG - Intronic
1119589085 14:75868173-75868195 AGAGTGGGAGGGAAGGAAGCAGG - Intronic
1119600958 14:75976703-75976725 ACAGGGAGAGGGAGGGGACCTGG - Intronic
1120134520 14:80850047-80850069 ATAGAGGGAGGGAGGGAAGGAGG + Intronic
1120215885 14:81680179-81680201 ACAGGGGGAAGCAGGAAAGAGGG - Intergenic
1120362023 14:83516246-83516268 ACAGGAGAATGGTGGGAACCCGG - Intergenic
1120393346 14:83936374-83936396 AGAGAGGGAGGGAGGGAAGAAGG + Intergenic
1120544360 14:85792400-85792422 GAAGGGGGAGGGAGGGAAGTGGG + Intergenic
1121104390 14:91271091-91271113 GCAGGGGGGTGGAGGGGCGCAGG + Intergenic
1121104399 14:91271109-91271131 GCAGGGGGGTGGAGGGGCGCAGG + Intergenic
1121334025 14:93065829-93065851 ACATAGGGATGGTGGGAAGCTGG + Intronic
1121430932 14:93888038-93888060 ACAGAGGGAGGGAGGGAAGCAGG - Intergenic
1121564310 14:94897000-94897022 GCAGGGGGAAGGAAGAAAGCTGG - Intergenic
1121575115 14:94978323-94978345 ACTGAGGGTTGGAGGGAAGCAGG - Intergenic
1121578726 14:95010404-95010426 ACAGAGGGAAGGAGGGAAGGAGG + Intergenic
1121584957 14:95056972-95056994 GCAGAGGGAAGGAAGGAAGCTGG - Intergenic
1121612807 14:95293144-95293166 AGAGAGGGAAGGAGGGAAGAAGG - Intronic
1121680470 14:95788995-95789017 ACAGGGGGATGGGGTAGAGCTGG + Intergenic
1122447827 14:101782024-101782046 AGAGAGGGAGGGAGGGAAGGAGG - Intronic
1122535714 14:102460786-102460808 GCAGGAGGATGGCGTGAAGCTGG - Intronic
1122631052 14:103107930-103107952 GCTGGGGGGTGGAGGGAACCAGG + Intronic
1122804751 14:104250651-104250673 AAAGGGGGAAGGAGGGAGGGAGG + Intergenic
1122811920 14:104293403-104293425 ACCGGGGGCTGGAGGGACCCGGG + Intergenic
1122855759 14:104559420-104559442 AGATGGGGATGGAGGGAGGCCGG - Intronic
1122899521 14:104776579-104776601 ACACGGGGATGGCGGGGTGCTGG - Intronic
1123123194 14:105927473-105927495 AGAGCGGGAGGGAGGGAAGGAGG + Intronic
1202933255 14_KI270725v1_random:59333-59355 AGAGAGGGAGGGAGGGAAGGAGG + Intergenic
1123405849 15:20018979-20019001 AGAGAGGGAGGGAGGGAAGGAGG + Intergenic
1123410919 15:20058399-20058421 AAAGAGGGAGGGAGGGAAGAAGG + Intergenic
1123490603 15:20777369-20777391 ACAGAGGGAGGGAGGGAGGGAGG - Intergenic
1123547105 15:21346456-21346478 ACAGAGGGAGGGAGGGAGGGAGG - Intergenic
1124035636 15:26051543-26051565 ACAAAGAGATGGATGGAAGCAGG - Intergenic
1124153094 15:27199888-27199910 AAAGAGGGAAGGAAGGAAGCAGG - Intronic
1124177688 15:27441668-27441690 TCAGGGGGATTGGGGGAGGCAGG + Intronic
1124366187 15:29072972-29072994 AGTGGGGGATGCAGGGGAGCGGG - Intronic
1124622025 15:31279244-31279266 ACAGGGGGTGTGAAGGAAGCAGG - Intergenic
1124624275 15:31299175-31299197 ACAGGGGAATGCAGGGAAGGAGG + Intergenic
1124670311 15:31633254-31633276 ACAGGGGGGTGGAGCCAAGATGG - Intronic
1124789341 15:32712843-32712865 AGAGAGGGATGGAGGGAGGAAGG - Intergenic
1125164498 15:36686758-36686780 ACAGAGGGATGGAGGGCAGAGGG + Intronic
1125574316 15:40744921-40744943 ACAGAGAGATGGAGGGAGGGAGG + Intronic
1125886764 15:43235263-43235285 AGAGAGGGAGGGAGGGAAGGAGG + Intronic
1126680027 15:51193406-51193428 ACAGGGGGATGCAGGTGAGCAGG - Intergenic
1126691168 15:51289932-51289954 ACAGAGGCATGGTGGGAAGTTGG - Intronic
1126835961 15:52665106-52665128 CGAGGGGAATGGAGGGAGGCAGG + Intronic
1127121644 15:55777066-55777088 AGAGAGGGAGGGAGGGAAGGAGG + Intergenic
1127319686 15:57831042-57831064 ACAAGGGTGTGGAAGGAAGCGGG + Intergenic
1127512578 15:59657366-59657388 GCAGGGTTAGGGAGGGAAGCAGG - Intronic
1127854236 15:62941567-62941589 GCAGGGGAGTGAAGGGAAGCAGG - Intergenic
1127919469 15:63481983-63482005 GCAGGGGGATGGAGGGAAAAGGG - Intergenic
1128109218 15:65066153-65066175 AGAGAGGGATGAAGGGAAGGAGG + Intronic
1128228047 15:66016189-66016211 ACAGGATGGAGGAGGGAAGCGGG - Intronic
1128270805 15:66307790-66307812 AGATGGAGATGGAGGGAAGGTGG + Intronic
1128550699 15:68596345-68596367 ACAGGGGCATGGGGGGTAGGGGG + Intronic
1128688490 15:69705373-69705395 ACAGGGGAATGGAAGGACACAGG + Intergenic
1128793522 15:70449539-70449561 ATGGGTGGATGGAGGGAAGGAGG + Intergenic
1128998399 15:72313603-72313625 ACGTGAGCATGGAGGGAAGCTGG - Intronic
1129020513 15:72513724-72513746 GGAGGGGGAGGGAGGGAAGGAGG - Intronic
1129020550 15:72513798-72513820 AGAGGGGGAGGGAGGGAAGGAGG - Intronic
1129156162 15:73719493-73719515 ACATGGTGCTGGAGGGAAGAGGG - Intergenic
1129519779 15:76178319-76178341 AGAGGGGGCTGCAGGGAAGTGGG + Intronic
1129696480 15:77743213-77743235 ATAGGTGGATGGAGGGAGGAGGG - Intronic
1129880051 15:79000349-79000371 ACAGTGGGATGGAGAGAGGATGG + Intronic
1130000481 15:80042228-80042250 AAAGAGGGAGGGAGGGAAGTAGG - Intergenic
1130000490 15:80042256-80042278 AGAGAGGGAGGGAGGGAAGGAGG - Intergenic
1130044846 15:80435602-80435624 ACAGAGGGAGGGAGGGAACCTGG - Intronic
1130231514 15:82100812-82100834 ACAGGGTGAGGGAGGAATGCTGG - Intergenic
1130788846 15:87130230-87130252 AAAGGGAGATGGAGGGAGGGAGG - Intergenic
1130839216 15:87682050-87682072 AGGGAGGGATGGAGGGAAGAAGG + Intergenic
1130906217 15:88242549-88242571 ACAGGTGAATGGAGGGAGGCAGG - Intronic
1131016397 15:89061082-89061104 AAATGGGGAGGGAGGGAAGGAGG + Intergenic
1131066173 15:89436172-89436194 ACAGAGTGAAGGAGGGAAGAGGG + Intergenic
1131330630 15:91496012-91496034 AGAGAGGGATGGAGGGAAGGAGG - Intergenic
1131354744 15:91734926-91734948 AAAGAGGGAGGGAGGGAAGAGGG + Intergenic
1131527964 15:93167650-93167672 AGAGAGGGAAGGAGGGAAGAAGG - Intergenic
1131925883 15:97383370-97383392 AGAGAGGGATGGAGGGCAGGAGG + Intergenic
1202955435 15_KI270727v1_random:73672-73694 ACAGAGGGAGGGAGGGAGGGAGG - Intergenic
1132880874 16:2161196-2161218 GCAGGGGGACGGAGGGAGGGAGG - Intronic
1132892160 16:2209769-2209791 ACTGGGGGTTGGAGGGTACCCGG - Intronic
1132982420 16:2745294-2745316 ACACTGGCCTGGAGGGAAGCTGG + Intergenic
1133002389 16:2857949-2857971 AGAGAGGGAGGGAGGGAAGGAGG + Intronic
1133007821 16:2894530-2894552 ACAGGGCGATGTGGGGATGCCGG - Intronic
1133013480 16:2927959-2927981 ACAGGGTGATGGTGGGGAGAAGG + Intronic
1133175967 16:4014839-4014861 ACTGGGAGAGAGAGGGAAGCTGG - Intronic
1133301671 16:4786446-4786468 ACAGGGGAATGGCGTGAATCTGG - Intronic
1133304643 16:4801593-4801615 ACAGAGGGAAGGAGGGGAGCTGG + Intronic
1133663040 16:7937458-7937480 AGAGAGGGAGGGAGGGAAGAAGG - Intergenic
1133839301 16:9394145-9394167 AGAGAGGGAGGGAGGGAAGCAGG - Intergenic
1133924559 16:10182483-10182505 AGAGGGGGAGGGAAGGACGCGGG + Intronic
1134291744 16:12907154-12907176 GAAGGGGGATGGAGGGAAGGAGG - Intronic
1134384212 16:13756898-13756920 ACTTGAGGAGGGAGGGAAGCCGG - Intergenic
1134443054 16:14310797-14310819 CCAGGGGGCTGGTGGGCAGCTGG - Intergenic
1134770108 16:16800785-16800807 ATAGGTGGAAGGAGGGAAGGAGG + Intergenic
1135004477 16:18806741-18806763 ACAGAGGAATGGAGGGAAAGGGG + Exonic
1135595287 16:23737630-23737652 AGAGAGGGAGGGAGGGAAGGAGG - Intergenic
1135620688 16:23952839-23952861 TCTGGATGATGGAGGGAAGCTGG + Intronic
1135760740 16:25136207-25136229 ACAGGGAGATGGAGAAAAGTAGG - Intronic
1135939610 16:26809808-26809830 AGAGAGGGAGGGAGGGAAGGAGG + Intergenic
1136998135 16:35205327-35205349 ACAGGGTGATGGTGGGGAGAAGG - Intergenic
1137534757 16:49311585-49311607 AAAGGGGGTTGGAGGGAAAAAGG - Intergenic
1137637789 16:50002231-50002253 AAAGAGGGAGGGAGGGAAGGTGG - Intergenic
1137751230 16:50862575-50862597 GAAGGGGGTTGGATGGAAGCAGG + Intergenic
1137765400 16:50973927-50973949 ACTTGGAGATGGAGGGCAGCAGG - Intergenic
1137798634 16:51242625-51242647 AAAGGGAAAGGGAGGGAAGCAGG - Intergenic
1137858123 16:51817345-51817367 ACTTGAGGATGGAGGGAAGGAGG - Intergenic
1137885448 16:52098206-52098228 ACAGGGTGATGGTGGAAATCTGG - Intergenic
1138133249 16:54500080-54500102 ACTGTGTGATGGAGGGAAGAGGG - Intergenic
1138490981 16:57376540-57376562 ACAGATGGATGGATGGAAGAAGG + Intronic
1138547530 16:57728774-57728796 ATAGGGGGATGGATGGATGTAGG + Intronic
1138687604 16:58739226-58739248 AAAGGGGGGTGGAGGGAGACTGG - Intergenic
1138755222 16:59475996-59476018 GCAGGAGAATGGCGGGAAGCCGG + Intergenic
1139028403 16:62848381-62848403 TTTGGGGGATGGAGGGAAGAGGG - Intergenic
1139146447 16:64330978-64331000 ACAGGAGGATGGCGTGAATCCGG - Intergenic
1139256819 16:65550580-65550602 AGAGAGGGAGGGAGGGAAGAAGG - Intergenic
1139303090 16:65961918-65961940 AGAGAGGGAGGGAGGGAGGCAGG + Intergenic
1139303133 16:65962052-65962074 AGAGAGGGAGGGAGGGAGGCAGG + Intergenic
1139495512 16:67314229-67314251 AGAGGGGGAAGGAGGGAGGGAGG - Intronic
1139960517 16:70714931-70714953 CCAGTGGGACGGAGGGAAGTGGG - Intronic
1139986942 16:70906487-70906509 ACAGTGGGATGTGGGGAGGCTGG - Intronic
1140315449 16:73891878-73891900 ACAGGGGGAGGGAAGAAAGGAGG + Intergenic
1141093315 16:81145423-81145445 AAAGGGGCATGAAGGGAACCAGG + Intergenic
1141148365 16:81547590-81547612 GCAGGTGGAGGGTGGGAAGCGGG + Intronic
1141338459 16:83179556-83179578 GCAGGGGAATGGAGTGAACCCGG + Intronic
1141518139 16:84559894-84559916 ACTGGAGGAGGGAGGGAAGAGGG + Intergenic
1141568392 16:84918917-84918939 CCACTGGGATGGAGAGAAGCTGG + Intronic
1141800351 16:86303879-86303901 CCAGGGGCATGGAGGAAAGCTGG + Intergenic
1141891742 16:86930796-86930818 ACAGCGTGATGGAGGAAAGGAGG - Intergenic
1141992450 16:87618307-87618329 GCAGGAGGAGGGAGGGAGGCCGG + Intronic
1142046039 16:87925869-87925891 GCAGGCGGCTGGAGGGGAGCAGG - Intronic
1142202391 16:88767517-88767539 GCAGGGGTTTGTAGGGAAGCTGG - Intronic
1142231270 16:88901318-88901340 CCAGTGGGAAGCAGGGAAGCTGG + Intronic
1142254337 16:89006737-89006759 AGAGGGGGAGGGAGGGGAGGGGG - Intergenic
1142254362 16:89006798-89006820 AGAGGGGGAGGGAGGGGAGGGGG - Intergenic
1142336696 16:89493978-89494000 ACAGGAGGATGCAGAGAGGCCGG + Intronic
1142434592 16:90048041-90048063 ACGGGGGGATGGGGGGATGGAGG + Intergenic
1142603566 17:1069722-1069744 ACAGGGCGGGGGAGGGAGGCCGG - Intronic
1142690709 17:1604879-1604901 ACCGGTGGAGGCAGGGAAGCTGG - Intronic
1142890841 17:2941491-2941513 AGAGGGGGTTGGAAGGAGGCAGG + Intronic
1143160688 17:4868398-4868420 GCAGGGGGATGAAGAGAGGCTGG - Intronic
1143278345 17:5731284-5731306 GCAGGGGGAAGGAGGGAGGAGGG - Intergenic
1143536485 17:7543383-7543405 ACAGAGGGAGGCAGGGAAGGAGG + Intergenic
1143582415 17:7834864-7834886 GCAGGGGGGTGGTGGGAAGAAGG - Intergenic
1143817483 17:9529022-9529044 ACAGGGACATGGAGGGAAGAGGG + Intronic
1144242123 17:13322845-13322867 AAAGAGGGACGGAGGGAAGAAGG - Intergenic
1144590243 17:16517621-16517643 ACAGTGAGTGGGAGGGAAGCTGG - Intergenic
1144705166 17:17363341-17363363 ACAGGAGCTTGGAGGGGAGCAGG - Intergenic
1144742353 17:17591050-17591072 CCTGGGGGATGGACGGGAGCAGG + Intronic
1145124009 17:20285743-20285765 ACAGGGAGGGGGAGGGAAGAAGG - Intronic
1145256779 17:21329530-21329552 AGAGAGGGAGGGAGGGAAGAAGG - Intergenic
1146323998 17:31869823-31869845 ATAGGGGGAAGGAGGGTAGGAGG - Intronic
1146908601 17:36633494-36633516 GCAGGGGGATGGAGGAAGGAGGG + Intergenic
1147115335 17:38295041-38295063 ACAGGAGAATGGAGTGAACCTGG - Intergenic
1147388863 17:40097264-40097286 AGTGGGGGATGGTGGGAAGTAGG + Exonic
1147425569 17:40344465-40344487 CCAGAGGGCTGGAGAGAAGCTGG + Intronic
1147487679 17:40833481-40833503 AGCAGGGGAGGGAGGGAAGCAGG - Intronic
1147653231 17:42073654-42073676 ACAGGGGCATGGAGCCAACCAGG + Intergenic
1147742081 17:42675499-42675521 GAGGGGGGAGGGAGGGAAGCAGG - Intronic
1148157569 17:45432504-45432526 TCTGGGGGCTGGAGGGAAGCAGG - Intronic
1148231935 17:45941615-45941637 AAAGAGGGAAGGAGGGAAGGGGG - Intronic
1148414344 17:47494553-47494575 ACAGGAGAATGGAGTGAACCTGG + Intergenic
1148439803 17:47706040-47706062 ACAAGGGGAGGGAGGCAAGCAGG + Intronic
1148895970 17:50839449-50839471 ACAGGGAGAAGGAGGAAAGGAGG - Intronic
1148996137 17:51711630-51711652 AAAAGGGGAAGGAGGAAAGCGGG + Intronic
1148998988 17:51737754-51737776 AAGGGGGGCTGTAGGGAAGCAGG - Intronic
1149283714 17:55137280-55137302 ACAGAGGGAGGGAGGGAGGGAGG - Intronic
1149655566 17:58308106-58308128 ACAGTGGGAGGGAGGGCAGGAGG + Intronic
1149732450 17:58959503-58959525 ACAGGAGAATGGAGTGAACCTGG + Intronic
1149939381 17:60846782-60846804 AGAGAGGGAGGGAGGGAAGAAGG - Intronic
1149999213 17:61422459-61422481 AGAGAGGGAGGGAGGGAAGAAGG + Intergenic
1150249559 17:63698485-63698507 GCAGGGGGAAGGTGGGAAGGAGG - Exonic
1150775122 17:68075125-68075147 AGGGAGGGATGGAGGGAAGCAGG - Intergenic
1151100501 17:71550797-71550819 AGAGAGGGAGGGAGGGAAGGAGG + Intergenic
1151144761 17:72030581-72030603 GCTAGGGGAAGGAGGGAAGCAGG + Intergenic
1151606806 17:75142642-75142664 AGGGGGGGATGGAGGGAAGGGGG + Intronic
1151617139 17:75220851-75220873 ATGGTGGGATGGAGGGAGGCAGG - Intronic
1151708810 17:75787946-75787968 TTATGGGGGTGGAGGGAAGCAGG - Intronic
1151898533 17:76996696-76996718 AGAGGGGGTTGGGGGGAAGGAGG + Intergenic
1152013703 17:77735935-77735957 AGGGAGGGATGGAGGGAGGCGGG + Intergenic
1152036411 17:77875812-77875834 ACAGAGGGATGCAGTGAAGCCGG + Intergenic
1152204546 17:78967556-78967578 CCGTGTGGATGGAGGGAAGCCGG + Intergenic
1152264201 17:79284502-79284524 ACAAGGAGATGGCTGGAAGCAGG + Intronic
1152404597 17:80089544-80089566 ACAGGGGGAGGGAGGGAGATGGG - Intronic
1152737337 17:82003979-82004001 ACGGTGGGAGGGAGGGAGGCCGG + Intronic
1152747164 17:82046393-82046415 ACAGGGGTGAGGAGGGAACCAGG - Intergenic
1152870391 17:82750885-82750907 ACAGGAGGATGGGGGGACGGGGG - Exonic
1152923847 17:83079002-83079024 CCGGGAGGAGGGAGGGAAGCCGG + Intergenic
1153186120 18:2488411-2488433 ACAGGGGGAGGAAGGAATGCTGG - Intergenic
1153319791 18:3761239-3761261 GCTGGGGGAGGGAGGGAAACGGG - Intronic
1153722747 18:7923366-7923388 ACAGGGAGATGGAAGGCGGCGGG + Intronic
1153790716 18:8577076-8577098 ATAAGGGGATGGAGGGATGGAGG - Intergenic
1153808105 18:8727875-8727897 AGGGAGGGAGGGAGGGAAGCAGG - Intronic
1155357517 18:24967659-24967681 ACAGGGGGAAGGAGGAAATTTGG + Intergenic
1155923594 18:31630087-31630109 GGAGGGGGAAGGAGGGGAGCGGG + Intronic
1155939111 18:31785649-31785671 GCAGGAGGATGGCGTGAAGCCGG - Intergenic
1155945154 18:31840372-31840394 ACAGAGGGAGGGAGGGAGGGAGG + Intronic
1156450676 18:37264632-37264654 ACAGGGGGAGGGAGGGGCCCAGG + Intronic
1157187043 18:45549496-45549518 AAAGGGAGAGGGAGGGAAGCAGG + Intronic
1157597733 18:48874175-48874197 ACTAGGGGATGGAGGGAATCTGG - Intergenic
1157744479 18:50122609-50122631 AGAGAGGGAGGGAGGGAAGGGGG + Intronic
1157818817 18:50750651-50750673 ACAGTGGACTGAAGGGAAGCAGG + Intergenic
1158346182 18:56519236-56519258 ACAGAGGGAGGGAGGGAGGGAGG + Intergenic
1158500407 18:57995752-57995774 ACAGGAGGAGGGAGGGAGGAAGG + Intergenic
1158984963 18:62804691-62804713 AGAGGGGGATGGGGGGATGGGGG - Intronic
1159451200 18:68604337-68604359 AGAGAGGGAGGGAGGGAAGGAGG + Intergenic
1159626383 18:70700149-70700171 AAGGGGAGATGGAGAGAAGCTGG - Intergenic
1159881734 18:73864805-73864827 AGAGGAGGATGGAGGGAAAGGGG - Intergenic
1160391470 18:78536707-78536729 AGGGAGGGAGGGAGGGAAGCAGG + Intergenic
1160668734 19:345703-345725 ACTCGCTGATGGAGGGAAGCTGG + Intergenic
1160728093 19:627243-627265 GCAGGAGGATGGAGTGAACCTGG - Intronic
1160842067 19:1150662-1150684 ACTGGGGGACTCAGGGAAGCAGG - Intronic
1160952478 19:1674361-1674383 ACAGAGGGAGGGAGGGATGAAGG - Intergenic
1161021390 19:2013296-2013318 ACCGGGGAGTGGAGGGAACCTGG + Intronic
1161058291 19:2201352-2201374 GCAGGGAGAAGGAGGGGAGCGGG - Intronic
1161122891 19:2539896-2539918 AAAGAGGGAGGGAGGGAAGGAGG - Intronic
1161158299 19:2746646-2746668 GCAGGGGAATGGAGTGAACCTGG - Intergenic
1161233769 19:3188180-3188202 CCGGGGGGCTGGAGGGAGGCCGG - Intronic
1161255991 19:3310039-3310061 AGAGAGGGATGGAGGGAGGGAGG - Intergenic
1161329187 19:3678306-3678328 ACGGAGGGATGGAGGGACGGAGG + Intronic
1161329196 19:3678338-3678360 ACAGAGGCATGGAGGGATGGAGG + Intronic
1161458304 19:4381116-4381138 GCAGGGGGATAGAGAGAGGCAGG - Intronic
1161708612 19:5834428-5834450 CCAGGGGGCTGGAGGGAGACAGG + Intronic
1161940387 19:7399256-7399278 ACTGGGTGAGGGAGGGAAACTGG + Intronic
1162134745 19:8548430-8548452 AAAGAGGGCTGGAGGGAAACTGG - Intronic
1162204683 19:9046934-9046956 AAAGAGGGAGGGAGGGAGGCAGG - Intergenic
1162371252 19:10280965-10280987 GCAGGAGGATGGAGTGAACCCGG - Intronic
1162473164 19:10884544-10884566 ACAGGGGGAGGGGGGGCAACTGG - Intronic
1162555811 19:11384757-11384779 AGAGGGGGAAGGAGGGAAGGAGG - Intronic
1162626660 19:11889842-11889864 ACAGGGTGATGGTGGGGAGAAGG + Intronic
1162717053 19:12640754-12640776 AGAGAGGGAGGGAGGGAAGGAGG + Intergenic
1162723179 19:12674428-12674450 ATAAGAGGATGGAGGGAACCGGG + Intronic
1162926452 19:13932744-13932766 GCAGGGGGATGGAGGGGCCCTGG + Exonic
1163148791 19:15399275-15399297 GCAGAGGGGTGGAGGGAAGCTGG + Intronic
1163242710 19:16074194-16074216 AGAGAGGGAGGAAGGGAAGCTGG + Intronic
1163417334 19:17194652-17194674 TCAGGCGGCTGGAGGGCAGCAGG + Exonic
1163741128 19:19013569-19013591 ACAAGGGGAAGGAGGGAGGTAGG - Intronic
1164017417 19:21265071-21265093 TCGGGGGGATGGTGGGCAGCCGG - Intronic
1164596963 19:29536598-29536620 ACTGTGGGAAGGAGGAAAGCCGG - Intronic
1165099618 19:33431201-33431223 AGAGAGGGAGGGAGGGAAGGAGG + Intronic
1165318470 19:35071950-35071972 ACAGGAGAATGGCGTGAAGCCGG + Intergenic
1165461575 19:35946935-35946957 GCAGGAGAGTGGAGGGAAGCTGG + Intergenic
1165880381 19:39038457-39038479 ACAGGGCGGTGGAGGACAGCAGG + Intergenic
1166201217 19:41238979-41239001 AGAAGGGGATGGAGGGATACAGG + Intronic
1166203458 19:41253524-41253546 ACAGAGGGATGGAGGGAGGAGGG + Intronic
1166329499 19:42069949-42069971 AGAGGAGGATGGAGAGGAGCAGG + Intronic
1166373538 19:42314989-42315011 ACAGGGTGATGGATTGCAGCTGG + Exonic
1166421215 19:42638739-42638761 AAAGGGGGAGGGAAGAAAGCAGG - Intronic
1167025683 19:46916026-46916048 ACAGGAGAATGGAGTGAACCCGG - Intergenic
1167530521 19:50013071-50013093 GCAGGAGGATGGAGAGAACCCGG + Intronic
1167552385 19:50170014-50170036 ACAGAGGGAGGGAGGGAGGGAGG - Intergenic
1167673996 19:50873482-50873504 ACAAGGCGATGGAGAGAACCAGG - Exonic
1167716085 19:51143652-51143674 ACAGGGGGCTGGAGAGGGGCTGG - Intronic
1167763215 19:51462249-51462271 TCAGGGGGATGGAGGCAAAGGGG + Intergenic
1167768659 19:51500452-51500474 ACAGGGGGCTGGAGAGGAGCTGG + Intronic
1167916012 19:52740666-52740688 ACAGGGTGATGGTGGGGAGAAGG + Intergenic
1167921743 19:52787764-52787786 ACAGGAGAATGGAGTGAACCCGG + Intronic
1168181620 19:54665864-54665886 AGAGGAGGAGGGAGAGAAGCAGG - Exonic
1168246537 19:55115535-55115557 GCAGGGGGTGGGAGGGAAGGGGG - Intronic
1168614880 19:57829707-57829729 ACAGGGTGATGGTGGGGAGAAGG - Intronic
925212457 2:2061561-2061583 CCAGAGGGATGGAGGGAAGAGGG + Intronic
925263515 2:2548023-2548045 ACAGGGGGACAGAGAGAAGATGG - Intergenic
925291524 2:2751461-2751483 AGAGGGGTCTGGAGGGAAGAGGG - Intergenic
925356673 2:3246786-3246808 ACGGAGGGAGGGAGGGAGGCAGG + Intronic
926092764 2:10061330-10061352 CCAGGAGGATGGTGGGAAACAGG - Intronic
926180569 2:10639326-10639348 ACAGGAGAATGGCGTGAAGCCGG + Intronic
926191577 2:10732206-10732228 AGGGAGGGATGGAGGGAAGAAGG - Intronic
926244662 2:11113787-11113809 ACAGAGGGAGGGAGGGAAGAAGG - Intergenic
926891398 2:17642400-17642422 GCAGGAGGATGGTGTGAAGCTGG - Intronic
927081404 2:19634307-19634329 AGAGGGGGATGGAGCGAGGCTGG - Intergenic
927183955 2:20468729-20468751 ACAGGGGGAGGAAGGGAGCCTGG + Intergenic
927271906 2:21220112-21220134 ACAGCTGGAGGGAGGGAAGTGGG - Intergenic
927608221 2:24508610-24508632 AAAAGGGGATGGGGGGAAGAGGG - Intronic
927835477 2:26394718-26394740 ACTGGGGGAAGGCGGGCAGCAGG - Exonic
928171364 2:29006627-29006649 CCAGGGAGATGGAGGGAATGAGG - Intronic
928174471 2:29024469-29024491 AGGGAGGGAGGGAGGGAAGCAGG + Intronic
928352168 2:30568599-30568621 GCAGGGGAATGGCGGGAACCTGG - Intronic
928740202 2:34342627-34342649 AGAGGGGGAAGGAAGGAAGATGG - Intergenic
928789006 2:34928727-34928749 ACAGAGGGAGGGAGGAAAGAAGG - Intergenic
929063686 2:37950174-37950196 ACAGGGGTGTGGAAGGCAGCTGG + Intronic
929223339 2:39487930-39487952 AAAGGGGGAGGGAGGGAAAAAGG - Intergenic
929332671 2:40702603-40702625 TCAGGGGAAAGGACGGAAGCAGG + Intergenic
929372969 2:41249620-41249642 AAAGAGGGAGGGAGGGAAGGAGG + Intergenic
929401873 2:41592228-41592250 AGAGAGGGAGGGAGGGAAGGAGG + Intergenic
929685151 2:44027008-44027030 ACAGAGGGAGGGAGGGAGGGAGG + Intergenic
929793865 2:45043512-45043534 ACAGAGGGAGGGAGGGAGGGAGG - Intergenic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
930014414 2:46960485-46960507 GTAGGGGGATGGGGGGAAGCAGG + Intronic
930272383 2:49272010-49272032 AGAGGGGGAGGGAGGAAAGGTGG - Intergenic
930312220 2:49755870-49755892 AGAGAGGGAGGGAGGGAAGGGGG + Intergenic
930424966 2:51201634-51201656 ACAAAGGGAAGGAGGGAAGGAGG - Intergenic
930654206 2:53992095-53992117 AGAGAGGGAGGGAGGGAAGGAGG - Intronic
930914663 2:56672314-56672336 CCAGGGGGTTGGAGGCAAGATGG + Intergenic
931139874 2:59445602-59445624 ACAAGAGAATTGAGGGAAGCTGG - Intergenic
931152316 2:59587997-59588019 AGGGAGGGATGGAGGGAAACAGG + Intergenic
932577110 2:72968727-72968749 AAAGAGGGAGGGAGGGAAGGAGG - Intronic
932906676 2:75761190-75761212 GCAGGGGGATGGAGAGAATTAGG - Intergenic
933069293 2:77836904-77836926 AGAGAGGGAGGGAGGGAAGAAGG + Intergenic
933211786 2:79579203-79579225 ATAGAGGGAGGGAGGGAAGGAGG - Intronic
933345976 2:81086228-81086250 AGGGAGGGAGGGAGGGAAGCAGG - Intergenic
933498785 2:83086147-83086169 ACAGAGGGAGGGAGGGAGGGAGG - Intergenic
933576159 2:84070883-84070905 AGAGGGGGAGGGAGGAAAGGGGG + Intergenic
933747077 2:85579184-85579206 ACTGGGGGCTGGAGGAAAACAGG + Intronic
934641476 2:96029656-96029678 ACAGGGGCAGTGAGGGAAGTAGG - Intronic
934659584 2:96136125-96136147 ACAGGGGGAGTGAGGGAAGCAGG + Intronic
934812351 2:97291269-97291291 ACAGAAGAATGGAGGGAAGAAGG - Intergenic
934825343 2:97416654-97416676 ACAGAGGAATGGAGGGAAGAAGG + Intergenic
934937646 2:98476938-98476960 ACAGGGGGATGGAGGCACTCAGG - Intronic
934944839 2:98532906-98532928 GCAGGTGGATGGATGGATGCTGG - Intronic
935210861 2:100938554-100938576 AAGGGGGGAGGGAGGGAAGGAGG - Intronic
935367190 2:102307270-102307292 AGAGGGGGAGGGAGGGAGGGAGG - Intergenic
935846078 2:107166919-107166941 ACATAGGGATGTAGGGAAGGTGG - Intergenic
935878759 2:107539930-107539952 AAAGGGGGATGGAGGGCATCTGG + Intergenic
936462266 2:112722344-112722366 ACAGAGGGAGGGAGGGAGGAAGG + Intronic
936980878 2:118264081-118264103 TCAGGAGGATGGAGAGAGGCCGG - Intergenic
937044556 2:118844279-118844301 AAAAGGAGAGGGAGGGAAGCAGG + Intronic
937065709 2:119015541-119015563 ACTGGGGCATGGCGGGAGGCGGG - Intergenic
937072321 2:119073508-119073530 AGAGAGGGAGGGAGGGAAGAAGG + Intergenic
938137972 2:128774832-128774854 ACTTTGGGATGGAGGGAGGCTGG + Intergenic
938537701 2:132258592-132258614 ACAGGAGGATGGCGTGAACCCGG + Intergenic
938671214 2:133588474-133588496 AGAGAGGGAGGGAGGGAAGGAGG - Intergenic
938708790 2:133957274-133957296 AAAGGGGGATGTAGGGCAGTAGG + Intergenic
938917816 2:135961046-135961068 ACTGGGGGAGGGAGGGAAGGAGG + Intronic
938936094 2:136128818-136128840 ATAGGAGGATGGAAGGAAGGGGG - Intergenic
939131117 2:138237116-138237138 ACAGGAGGAGGGAGAGAATCAGG - Intergenic
939696329 2:145329262-145329284 ACAGAGGGATGGAGGTTTGCCGG + Intergenic
939875044 2:147568279-147568301 ATGGGTGGATGGAGGGAAGGAGG + Intergenic
939914383 2:148021218-148021240 TCAGGGGGGTGGGGGGAAGGCGG + Intronic
940331082 2:152475586-152475608 ACAGGAGAATGGCGGGAACCTGG - Intronic
940579845 2:155564704-155564726 AGAGAGGGAGGGAGGGAAGGAGG - Intergenic
941336039 2:164245066-164245088 ACAGGAGGAAGGAAGGAAGGAGG - Intergenic
941339322 2:164287014-164287036 AGAGGGGGAGGGAGGGAGGAAGG + Intergenic
941994874 2:171592867-171592889 ACAGTAGCATGCAGGGAAGCTGG - Intergenic
942280358 2:174356588-174356610 AAAGAGGGAGGGAGGGAAGAAGG + Intronic
942447043 2:176085172-176085194 AAAGGGGAAGGGAGGGCAGCGGG - Intergenic
942462449 2:176177913-176177935 CGAGGGGGATTGAGGGAAGATGG - Intergenic
942774739 2:179567825-179567847 ACAGTGACATGGATGGAAGCAGG - Intronic
942966937 2:181906282-181906304 ACAGGGGGAAGGAGCACAGCGGG + Intronic
943446301 2:187992044-187992066 AGAGAGGGAGGGAGGGAGGCAGG + Intergenic
943687557 2:190834784-190834806 AGAGAGGGATGGAGGGAGGAAGG - Intergenic
945037374 2:205715634-205715656 ACAGGGGGCTGGAGGGAGATGGG + Intronic
945305755 2:208256981-208257003 ACAGGGTGATGGTGGGGAGAAGG + Intronic
945414931 2:209559224-209559246 ACAGAGGGAGGGAGGGAAGGAGG - Intronic
945929733 2:215842809-215842831 AGAGGGGCAGGGATGGAAGCTGG - Intergenic
946200414 2:218068091-218068113 GCAGGGGGCTGGAGGACAGCAGG + Intronic
946200469 2:218068235-218068257 GCAGGGGACTGGAGGGAGGCAGG + Intronic
946451603 2:219784747-219784769 TCAGTGGGATGGATGGGAGCTGG + Intergenic
946508365 2:220326129-220326151 ACAGAGGCAGGGAGGGAAGAAGG - Intergenic
946895428 2:224319079-224319101 ACAGGGGGTTGCAGAGAGGCAGG - Intergenic
947565329 2:231189780-231189802 ACAGAGGGAGGGAGGGAGGGAGG + Intergenic
947860337 2:233353792-233353814 ATAAGGGGATGGAAGGCAGCAGG - Intergenic
948088215 2:235267968-235267990 TCAGGGGGCTGGAGGCAGGCTGG - Intergenic
948273233 2:236689531-236689553 AGAGAGGGATGGAGGGAGGGAGG - Intergenic
948353100 2:237356998-237357020 ACTGGGGGAGGGAGGGAATAAGG - Intronic
948618411 2:239216695-239216717 ACAGGAGGAAGGAGTGCAGCAGG - Intronic
948718188 2:239879783-239879805 ACAGGGGAAAGGAGGGACTCAGG - Intergenic
949076911 2:242065622-242065644 ACAGGGGTGTGGAGGAGAGCCGG + Intergenic
1168953548 20:1818721-1818743 ACAGAGGGATGGAGAGAGGCAGG - Intergenic
1168974362 20:1953088-1953110 AGAGGGGGATGGAGGGAGGGAGG + Intergenic
1169009816 20:2241230-2241252 AAAGAGGGAGGGAGGGAAGAAGG - Intergenic
1169068096 20:2705843-2705865 ACAGATGAATGGATGGAAGCTGG + Intronic
1169248974 20:4045946-4045968 AGAAAGGGATGGAGGGAAGCAGG - Intergenic
1169252884 20:4073606-4073628 TCTTGGGGATGGAGGGAAGCAGG + Intronic
1169266075 20:4168064-4168086 AGAGGGAGTGGGAGGGAAGCTGG - Intronic
1169545413 20:6645243-6645265 AGAGAGGGAGGGAGGGAAGTGGG - Intergenic
1169599058 20:7236158-7236180 ACAGGGGGAGGGAGAGCATCAGG + Intergenic
1169664356 20:8018445-8018467 AGAGGGGGAGGGAGGGAGGGAGG + Intronic
1169922777 20:10753181-10753203 AGAGGGGGATAGAGGGAGGGAGG + Intergenic
1170292165 20:14782731-14782753 ACAGTGGAAGTGAGGGAAGCAGG - Intronic
1170427277 20:16247415-16247437 TCAGGGAGAGGCAGGGAAGCTGG + Intergenic
1170431450 20:16280356-16280378 ACCAGGGGATGGAGGGAAGGAGG + Intronic
1170502242 20:16986680-16986702 AGAGAGGGAAGGAGGGAAGAAGG + Intergenic
1170822441 20:19765918-19765940 ACAGAGGGAGGGAGGGAAGGAGG + Intergenic
1171201537 20:23245995-23246017 ACAGAGGGAGGGAGAGAAGGAGG + Intergenic
1171272145 20:23825692-23825714 AAAGGGAGGTGGAGGCAAGCGGG + Intronic
1171290295 20:23979230-23979252 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1171379051 20:24719250-24719272 GCAGAGGGAGGGAGAGAAGCTGG - Intergenic
1171538587 20:25923328-25923350 ACAGGAGGATGGCGTGAAGCCGG - Intergenic
1171771459 20:29325786-29325808 ACAGAGGGAGGGAGGGAGACAGG + Intergenic
1172118036 20:32583470-32583492 AGCGGGGGAGGGAGGGAGGCCGG + Intronic
1172310562 20:33915191-33915213 ACTGGGGGGTGGGGGGAAGCTGG - Intergenic
1172348142 20:34220659-34220681 ACACGGGGAATCAGGGAAGCAGG + Intronic
1172357458 20:34290212-34290234 GCAGGGGGATGGGGAGAAGAGGG - Intronic
1172374434 20:34425746-34425768 ACAGGGTGATGGTGGGGAGAAGG - Intronic
1172788655 20:37487209-37487231 AGAGAGGGAGGGAGGGAAGGAGG - Intergenic
1172858744 20:38030248-38030270 AAGGAGGGAGGGAGGGAAGCAGG + Intronic
1172898324 20:38316209-38316231 AAAAGGGGAAGGAGGGAAGAGGG - Intronic
1173669200 20:44786099-44786121 AAAGGGGGCTGTAGGGCAGCAGG - Intronic
1173848579 20:46203249-46203271 TGAGTGGGAGGGAGGGAAGCAGG + Intronic
1173874597 20:46362404-46362426 TTAGGAAGATGGAGGGAAGCAGG - Intronic
1173876773 20:46377676-46377698 TCAGGGGGAGGGAGGGATGCAGG - Intronic
1173879476 20:46400992-46401014 ATAGGGGGAAGGAGGGGAGCTGG - Intronic
1173997942 20:47353800-47353822 AAGGGGGGTTGGGGGGAAGCAGG + Intronic
1174221543 20:48959522-48959544 ACAGAGGGAGGGAGGGAAAGAGG - Intronic
1174432015 20:50477215-50477237 ACAGGGGCAGGGAGGGAGGCAGG + Intergenic
1174614519 20:51825485-51825507 GCAGGAGGATGGCGGGAACCTGG + Intergenic
1174741067 20:53014807-53014829 TCAGGGAGGTGGAGGGGAGCAGG - Intronic
1174750177 20:53104242-53104264 ACTGGGGGGTGGGGGGAAGGTGG + Intronic
1174832702 20:53827735-53827757 ACAGAGGGAAGGAGGGAGGGAGG - Intergenic
1175028814 20:55931642-55931664 ATAGGGGGAGGGAGGGAGGGAGG + Intergenic
1175392499 20:58636081-58636103 ACAGAGAGAGGGAGGGAAGAAGG + Intergenic
1175392536 20:58636201-58636223 ACAGAGAGAGGGAGGGAAGAAGG + Intergenic
1175523420 20:59617786-59617808 ACAGAGGGAGGGATGGAAGGAGG - Intronic
1175765355 20:61588647-61588669 AAAGGGGGATGGTGAGCAGCGGG - Intronic
1176594658 21:8681506-8681528 AGAGAGGGAGGGAGGGAAGGAGG + Intergenic
1176741527 21:10608013-10608035 AGAGGGGGATGGAGGGAGAGGGG - Intergenic
1176893361 21:14345990-14346012 AGAGAGGGAGGGAGGGAAGGAGG + Intergenic
1177046895 21:16182539-16182561 AAGGAGGGATGGAGGGAGGCAGG - Intergenic
1177205835 21:18010201-18010223 ACAGGAGAATGGCGGGAACCCGG + Intronic
1177429626 21:20975145-20975167 ACAGGAGAATGGCGGGAACCCGG - Intergenic
1178100350 21:29261484-29261506 AGAGAGGGAGGGAGGGAAGGAGG + Intronic
1178460203 21:32795985-32796007 AAAGAGGGAAGGAGGGAAGGAGG - Intronic
1179055438 21:37927720-37927742 ACAGACGGATGGAGGGAGGGAGG + Intergenic
1179081676 21:38176973-38176995 AAAGAGGGATGAAGGGAGGCAGG + Intronic
1179554661 21:42164501-42164523 TCAGGGTGATGGAGGGATGGAGG - Intergenic
1179654622 21:42837631-42837653 CCAGCGGGAGGGAGGGCAGCGGG - Intergenic
1179987589 21:44930192-44930214 ACAGGGGGAGGGAGGGGGGAGGG - Intronic
1180277510 22:10658635-10658657 AGAGAGGGAGGGAGGGAAGGAGG + Intergenic
1180316847 22:11283638-11283660 ACAGAGGGAGGGAGGGAGACAGG + Intergenic
1180657551 22:17435960-17435982 ACAGAGGGAGGGAGGGAGGAAGG - Intronic
1180767133 22:18351782-18351804 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1180779178 22:18510597-18510619 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180811897 22:18767917-18767939 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181016585 22:20073131-20073153 GCAGGGGAATGGAGTGAACCTGG - Intergenic
1181151688 22:20888458-20888480 ATGGGGGGCTGGAGGGAAGCGGG - Exonic
1181198052 22:21202161-21202183 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181401693 22:22653643-22653665 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181546997 22:23607779-23607801 ATAGGAGGATGCAGGGAGGCTGG - Intergenic
1181618012 22:24068205-24068227 AGAAGGGGGTGGAGGGAAGGAGG + Intronic
1181647857 22:24243457-24243479 ATGGGGGAATGGAGGGAAGAAGG + Intronic
1181703651 22:24634736-24634758 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181839214 22:25641338-25641360 ACAAGGAGAGGGAGGGAAGTCGG - Intronic
1181977046 22:26737584-26737606 AAAGTGGGATGGAGGGAAAAGGG - Intergenic
1182031600 22:27163305-27163327 AAAGGGGGAGGGAGGAAAGGAGG + Intergenic
1182100716 22:27655676-27655698 AGAGAGGGAGGGAGGGAAGAAGG + Intergenic
1182190607 22:28456310-28456332 ACTGGGGGATGGAGGCAATGAGG + Intronic
1182331721 22:29555717-29555739 GCAGGGGGAGGGAGGCAGGCAGG + Exonic
1182864567 22:33592110-33592132 ACAGAGGGAGGGAGGGAGGGAGG + Intronic
1183266287 22:36827973-36827995 AGCGGGGGCTGGAGGGAAGGAGG + Intergenic
1183318540 22:37149792-37149814 ACAGGGGCCGGGAGGGAGGCAGG + Intronic
1183374447 22:37454815-37454837 ACAGAGGGAGGAAGGGAGGCTGG - Intergenic
1183509564 22:38226994-38227016 ACGGAGGGATGGAGGGACGGAGG + Intronic
1183561972 22:38582211-38582233 AGAGGGGATAGGAGGGAAGCTGG - Exonic
1183598371 22:38825788-38825810 ACCTGGGGATGGAGGGAGGAAGG - Intronic
1183955653 22:41379242-41379264 GCAGGAGAATGGCGGGAAGCCGG + Intronic
1183966570 22:41446206-41446228 AGTGGGGTCTGGAGGGAAGCTGG + Intronic
1184293171 22:43508923-43508945 AGATGGGGATGGAGGGATGGGGG - Intergenic
1184454185 22:44599736-44599758 GCAGGAAGAGGGAGGGAAGCTGG + Intergenic
1184492940 22:44820615-44820637 ACAAGGGGAGGGAGGAAAGCGGG - Intronic
1184513607 22:44946885-44946907 ACAGAAGGATGGAGGGTAGCAGG + Intronic
1184516706 22:44966611-44966633 ACAGACGGATGGAGGGACCCAGG - Intronic
1184642384 22:45879461-45879483 GAAGGGGGAGGGAGGGAAGGAGG - Intergenic
1184741690 22:46432204-46432226 CCAGGGAGGTGGAGGGACGCCGG + Intronic
1184840880 22:47051742-47051764 AAAGGAGGAGGGAGGGGAGCTGG - Intronic
1184934433 22:47710384-47710406 AGAGAGGGAGGGAGGGAGGCAGG - Intergenic
1184943100 22:47783003-47783025 ACAGGGGCCAGGAGGGAAGAAGG - Intergenic
1185172954 22:49304176-49304198 ACAGGAGGGTGGAGGGACGCTGG + Intergenic
1185284456 22:49994116-49994138 TCAGGGGCATGGGGGGATGCAGG - Intergenic
1185288647 22:50013432-50013454 GCAGGGGGTTGGAGAGAACCAGG + Intergenic
1203228755 22_KI270731v1_random:92676-92698 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
949180322 3:1122341-1122363 AGAGAGGGAAGGAGGGAAGGAGG + Intronic
949353054 3:3145407-3145429 GCAGGAGGATGGCGGGAACCCGG + Intronic
949401098 3:3665944-3665966 ACAGGGGGAGGGAGGGAGGGAGG + Intergenic
949508060 3:4745115-4745137 AGAGAGGGAGGGAGGGAAGGAGG - Intronic
949538448 3:5013543-5013565 ACAGGGAGAAGGAGGAAACCTGG - Intergenic
949734774 3:7159536-7159558 AGAGGGGGAAGGTGGGAAGCAGG - Intronic
950034474 3:9875281-9875303 GCAGGAGAATGGTGGGAAGCCGG + Intronic
950175659 3:10872390-10872412 AAATGGGGATGGAAGGAAGACGG - Intronic
950236269 3:11323370-11323392 ACAGCTGGTAGGAGGGAAGCTGG - Intronic
950587701 3:13907213-13907235 ACAGGGGGAAGGAGAGCATCAGG + Intergenic
950602974 3:14051561-14051583 ACAGGGTGATGGAAGGGAGGGGG - Intronic
950727355 3:14925205-14925227 GCAGTGGGATTGAGGGAGGCTGG - Intronic
950899763 3:16486981-16487003 AGAGAGGGAGGGAGGGAAGACGG - Intronic
951354458 3:21647345-21647367 AGAGGGGGAGGGAGGGAGGAAGG - Intronic
951596648 3:24325953-24325975 AAAGGGAGAGGGAGGGAAGGAGG - Intronic
952268353 3:31808219-31808241 ACAGGAGGTTGGAGGGAAAGGGG + Intronic
952345134 3:32476670-32476692 ACAGAGGGAGGGAGGGAAGGAGG + Intronic
952598471 3:35048512-35048534 ACTGGGGTTTTGAGGGAAGCTGG - Intergenic
952905163 3:38135199-38135221 ACAGGGTGATGGTGGGGAGAAGG - Intronic
953038935 3:39237796-39237818 CCGGAGGGAGGGAGGGAAGCAGG - Intergenic
953881389 3:46693183-46693205 GCAGGGAGAGGAAGGGAAGCTGG - Intronic
954133812 3:48572924-48572946 TCAGGGGGAGACAGGGAAGCCGG - Exonic
954413298 3:50380668-50380690 AAATGGGGAGGGAGGGGAGCAGG + Intronic
954455063 3:50593284-50593306 ACTAGGGGATGGACGCAAGCTGG - Intergenic
954687667 3:52379414-52379436 CCAGGGAGATGCAGGGAAGCTGG + Intronic
954910186 3:54099060-54099082 ATGGGGGGATGGGGAGAAGCCGG - Intergenic
955496449 3:59538291-59538313 ACAGAGGGAGGGAGGGAGGGAGG - Intergenic
955516948 3:59735383-59735405 CCAGTGGGATGGAAGAAAGCAGG - Intergenic
955582065 3:60434410-60434432 ACAGGATGAAGGAGGAAAGCAGG - Intronic
955753282 3:62203761-62203783 ACGGGCGGAAGGAGGGATGCCGG + Exonic
955830486 3:62996398-62996420 ACAGAGGGAGGGAGGAAAGAAGG + Intergenic
955956335 3:64293641-64293663 ACAGGGAAATGGAGGGAAAATGG - Intronic
956837648 3:73108654-73108676 ACTGGGGGAGGGAGGGAATGGGG - Intergenic
956860218 3:73315867-73315889 GCAGGGGGCTGGAGGGAGGAGGG - Intergenic
957220833 3:77380652-77380674 AGAGAGGGAGGGAGGGAAGAGGG - Intronic
957515164 3:81240724-81240746 AGAGAGGGAAGGAGGGAAGGAGG + Intergenic
957629474 3:82700981-82701003 ACAGGGGAATGGTGTGAACCCGG - Intergenic
957672826 3:83327600-83327622 ACAGGGGGAAGGAGGGCATTAGG + Intergenic
958005253 3:87802133-87802155 AGAGAGGGAGGGAGGGAAGAAGG - Intergenic
958005272 3:87802200-87802222 AGAGAGGGAGGGAGGGAAGAAGG - Intergenic
958258416 3:91351603-91351625 AGAGAGGGATGGAGTGAAACAGG + Intergenic
958732590 3:97974527-97974549 GAAGGGGGAGGGAGGGAAGGAGG + Intergenic
959905158 3:111703201-111703223 AAAGGGGGTTGGAGGGATGCAGG + Intronic
960673834 3:120176247-120176269 AGAGAGGGAGGGAGGGAAGGAGG - Intronic
960747813 3:120908797-120908819 AGAGGTGGAGGGAGGGGAGCAGG + Intronic
960883227 3:122367110-122367132 ACAGGGAGAGGGAGGAAGGCAGG + Intronic
960891407 3:122452495-122452517 ACAGACGGAAGGAGGGAAGGAGG + Intronic
960969083 3:123126328-123126350 AGCGGGGGATGGGGGGAAGTAGG - Intronic
961198890 3:125028173-125028195 GTAGGAGGATGGAGGGAACCTGG - Intronic
961486834 3:127222584-127222606 GCAGTGGGAGGGAGGGGAGCAGG + Intergenic
961620511 3:128220512-128220534 ACCAGGGAATGGGGGGAAGCAGG - Intronic
961871911 3:129994562-129994584 AAAGGGGAATTGAGGGAACCTGG - Intergenic
961990368 3:131183421-131183443 CCAGGGGGAGGGAGAGAATCAGG - Intronic
962209762 3:133467460-133467482 AAAGGGGGAGTGAGGAAAGCAGG - Intronic
962366942 3:134793174-134793196 TTAAGGGGAGGGAGGGAAGCTGG + Intronic
962970747 3:140399857-140399879 ACAGGGGGAGGGAGGCAGGGAGG - Intronic
963303090 3:143620627-143620649 ACAGGGGGGTGGAGCCAAGATGG + Intronic
964236428 3:154535889-154535911 ACAGGGGAAAGGAGAGAAGGAGG - Intergenic
964242451 3:154612578-154612600 ACAGGATGATGGAGGGAAGTAGG + Intergenic
964603470 3:158530598-158530620 AGAGAGGGATGGAGGGAGGGAGG + Intronic
965241036 3:166198053-166198075 ACAGGAGGATGGTGTGAACCCGG - Intergenic
965514681 3:169608307-169608329 ATAGGGGTATGCAGGAAAGCTGG - Intronic
965942451 3:174201291-174201313 AAAGGGGGAGGGAGGGAGGAAGG + Intronic
966568515 3:181411709-181411731 ACAGAGAGATGGAAGGAGGCAGG + Intergenic
966987555 3:185195775-185195797 AAAGGGGGAGTGAGGGAAGACGG + Intronic
966988588 3:185205320-185205342 ACAGGGGAAGGGAGGGAGGATGG - Intronic
967154291 3:186678399-186678421 ATAGGGGGAGGGTGGGAAGCAGG - Intergenic
967721082 3:192817401-192817423 AGAGAGGGAAGGAGGGAAGGAGG + Intronic
967955890 3:194876918-194876940 CTTGGGGGATGCAGGGAAGCTGG + Intergenic
968047517 3:195632331-195632353 AAAGGAGGAGGGAGGGAAGAAGG - Intergenic
968086941 3:195878045-195878067 AAAGGGTGGTGGAGGGAAGCTGG + Intronic
968116548 3:196094813-196094835 ATAGGGGGTTGGAGGGGACCTGG - Intergenic
968163309 3:196444614-196444636 AGAGAGGGAGGGAGGGAAGGAGG + Intergenic
968307095 3:197657593-197657615 AAAGGAGGAGGGAGGGAAGAAGG + Intergenic
968615729 4:1577004-1577026 ACAGAGGGCTGGAGGGAGGGAGG - Intergenic
969170570 4:5359400-5359422 ACAGGTGGATGGAGGGAGGGAGG - Intronic
969457542 4:7308690-7308712 ACAGGGTGCTGGTGGGAAGAGGG - Intronic
969668497 4:8575949-8575971 AGAGGGGGAGGGAGGGAGGGAGG - Intronic
970708676 4:18836264-18836286 AGATGGGGATGGATGGTAGCTGG + Intergenic
971192609 4:24441683-24441705 ACAGAAGGAAGGAGGGAAGAAGG + Intergenic
971307323 4:25494946-25494968 AAAGGGGGAGGGAGGGAGGAAGG + Intergenic
971361197 4:25940108-25940130 ACAGAGGGATGGAGAGGTGCAGG + Intergenic
971425724 4:26513288-26513310 ACAGGAGGATGGGGAGAAGTTGG - Intergenic
971501807 4:27326298-27326320 AGAGGGGGAAGGAGGGAGGGAGG + Intergenic
972055523 4:34797185-34797207 AGGGAGGGATGGAGGGAAGAAGG - Intergenic
972241558 4:37198810-37198832 ACTGGAGGATGGAGGGTAGAAGG - Intergenic
972723159 4:41721023-41721045 ACAGGGGGAGGGAAGGCAGGAGG + Intergenic
972789471 4:42357259-42357281 AGAGGGGGAGGGAGGGAGGCGGG + Intergenic
973069167 4:45835746-45835768 TCAGGGAAATGGGGGGAAGCCGG + Intergenic
973239170 4:47938937-47938959 AGAGAGGGATGGAGGGAGGGAGG + Intronic
973803645 4:54502751-54502773 ACAGGGAGATGGAGGCAAGCTGG - Intergenic
973968917 4:56191388-56191410 ACAGAGGGAGGGAGGGAGGAAGG - Intronic
974020557 4:56688344-56688366 AGAGAGGGAGGGAGGGAAGGAGG + Intergenic
974095496 4:57359467-57359489 AGAGAGGGATGGAGGGAAGTTGG + Intergenic
974142762 4:57908701-57908723 AAGTGGGGATGGAGAGAAGCAGG + Intergenic
974281588 4:59801930-59801952 GTTGGGGGATGGAGAGAAGCAGG + Intergenic
974385405 4:61198438-61198460 ACAGAGGTCTGGAGGGATGCAGG - Intergenic
974404532 4:61448765-61448787 AGAGAGGGAAGGAGGGAAGGAGG + Intronic
974840102 4:67289454-67289476 ACAGATGGAAGGAGGGAAGAAGG + Intergenic
976168197 4:82276772-82276794 AGGGAGGGATGGAGGGAGGCAGG + Intergenic
977290299 4:95158857-95158879 ACTGAGGGAGTGAGGGAAGCTGG - Intergenic
977514996 4:98011090-98011112 ACAGGGGGAGGGAGAGAATCAGG - Intronic
977555910 4:98487151-98487173 AGGGGGGGATGGAGGGAAGGAGG + Intronic
978626983 4:110697545-110697567 GCAGGGGGTTGGGGGGAATCAGG - Intergenic
978733811 4:112062526-112062548 ACAGAGGGAGGGAGGGAGGGAGG + Intergenic
978815888 4:112905017-112905039 TCAAGGGGAAGGAGGGAAGAAGG + Intronic
979263198 4:118671716-118671738 ACAGTGAGATGGAGGGAGGTGGG + Intergenic
979652733 4:123154960-123154982 AAAGAGGGAAAGAGGGAAGCAGG - Intronic
979783050 4:124680499-124680521 ACAGGAGGGTAGAGGGAAGGTGG + Intronic
980078618 4:128320513-128320535 AAGGAGGGAGGGAGGGAAGCAGG - Intergenic
980521897 4:133946755-133946777 AGAGAGGGAGGGAGGGAAGAAGG + Intergenic
980638305 4:135538775-135538797 ACAGGGTGATGGTGGGGAGAAGG - Intergenic
980813809 4:137917097-137917119 GCAGGAGAATGGCGGGAAGCCGG + Intergenic
980962758 4:139492720-139492742 AAAGAGGGAGGGAGGGAAGGGGG - Intergenic
981514019 4:145587739-145587761 AGAAGGGGAAGTAGGGAAGCAGG + Intergenic
981936789 4:150247896-150247918 ACAAGAGGATGGAGGGAAACTGG - Intronic
982294105 4:153808871-153808893 AGAGAGGGAGGGAGGGAAGGAGG - Intergenic
982294132 4:153808939-153808961 ACAGAGGGAAGGAGGGAAGGAGG - Intergenic
982529262 4:156517989-156518011 AAGGAGGGAGGGAGGGAAGCAGG + Intergenic
982720130 4:158850626-158850648 AGTGGGGGCTGGAGGGAAGGAGG + Intronic
982930544 4:161401616-161401638 ACAGGGGAATGGCGTGAACCTGG - Intronic
982967341 4:161929115-161929137 ACAGAGGGAGGGAGGGAAGGAGG - Intronic
983107644 4:163709205-163709227 ATGGCGGGATTGAGGGAAGCAGG + Intronic
983257014 4:165411322-165411344 GAAGAGGGATGGAGGGAAGAAGG - Intronic
983330993 4:166329084-166329106 GCAGGGGAAGGGAGGGAAGAAGG + Intergenic
983536653 4:168864493-168864515 ACATGTGGATGGAAGGAACCGGG - Intronic
983671286 4:170240834-170240856 ACAGGAGCAAGGAGGGAAACAGG - Intergenic
984335660 4:178386418-178386440 ACAGGGGGAAGGAGAGCATCAGG + Intergenic
984460826 4:180034620-180034642 AGAGAGGGATGGAGGGAGGAAGG + Intergenic
984546583 4:181111725-181111747 ATAGTGGGTTGGAGGGAAGCTGG - Intergenic
984831249 4:183976552-183976574 AGAGGGGGAGGGAGGGAGGGAGG + Intronic
985293757 4:188412678-188412700 GCAGGAGAATGGCGGGAAGCCGG - Intergenic
985571921 5:651581-651603 ATAGGGGGATGGTGAGAAGGGGG + Intronic
985652425 5:1113000-1113022 ACAGGGTGATGCAGGGAAGGTGG + Intergenic
985744100 5:1636833-1636855 AAAGGAGGAGGGAGGGAAGAAGG + Intergenic
985873910 5:2580967-2580989 AAAGGGAGATGGAGGGAGGGAGG - Intergenic
986016406 5:3761370-3761392 CCAGGGAGATGGAGGGAGGAGGG - Intergenic
986065662 5:4231365-4231387 CCAGGGCGAGGGTGGGAAGCGGG - Intergenic
986642214 5:9883230-9883252 ACAGGGGGAGGGAGAGCATCAGG + Intergenic
986881846 5:12183921-12183943 ACTGGGGAATGAAGAGAAGCAGG + Intergenic
987706188 5:21464117-21464139 ACAGGGGGATGCTGGGGAGTTGG - Intergenic
987734219 5:21818519-21818541 TCTGGGGGAAGGAGGGAAGAAGG - Intronic
987752032 5:22052427-22052449 ACAGGGGATTAGAGGGAGGCAGG - Intronic
988058459 5:26133533-26133555 ACAAGGGGAGGGAGGGTATCAGG - Intergenic
988340850 5:29969152-29969174 ACAGGAGGGTGGAGGGCAGGAGG + Intergenic
989060163 5:37402923-37402945 ACGGAGGGAGGGAGGGAAGGAGG - Intronic
990087574 5:51997588-51997610 AGAGAGGGATGGAGGGAGGAAGG + Intergenic
990358500 5:54995137-54995159 GCAGGTGGATGAAGGGGAGCAGG - Intronic
991172291 5:63642572-63642594 AGAGAGGGAGGGAGGGAAGGAGG - Intergenic
991493792 5:67208545-67208567 GAAGGGGTCTGGAGGGAAGCAGG + Intergenic
991592347 5:68266142-68266164 GCAGGGGGATGGAGAGGAACTGG - Intronic
991942132 5:71863222-71863244 ACAGAGGGAAGGAGGGAAGGAGG - Intergenic
992228910 5:74644135-74644157 GAAGGGGAAGGGAGGGAAGCAGG + Intronic
992605100 5:78447928-78447950 AGAGGGGGAAGGAGGGAGGAAGG - Intronic
992893257 5:81223545-81223567 ACAGGAGGATGGCGTGAACCCGG + Intronic
994742816 5:103642460-103642482 GCAGGGGAATGGCGGGAACCTGG + Intergenic
994846473 5:104994786-104994808 AGAGGGGGAAGGAGGAAAGGAGG - Intergenic
995127091 5:108589016-108589038 AGAGGGGCGTGGAGGGGAGCGGG + Intergenic
995183361 5:109249010-109249032 AGAAGGGGAGTGAGGGAAGCAGG + Intergenic
995207446 5:109497433-109497455 CAAGAGGGATGGAGGGAAGAAGG + Intergenic
995324496 5:110875202-110875224 AAAGAGGGAGGGAGGGAAGGAGG - Intergenic
996136062 5:119843931-119843953 AGAGAGGGAGGGAGGGAGGCTGG - Intergenic
996418300 5:123233900-123233922 AAAGAGGGAGGGAGGGAAGAAGG - Intergenic
996506059 5:124268801-124268823 TCAGGGGGAGGGAGGGCATCAGG - Intergenic
996564310 5:124863551-124863573 AAAGGGGGGGGGAGGGAAGCAGG - Intergenic
996904204 5:128578716-128578738 ACAGGGGAATGGATGGTAGCTGG - Intronic
997194623 5:131970311-131970333 TCAGGGCGATGGAGGGAGGGAGG + Intronic
997357363 5:133271889-133271911 GCAGAGGGAGGGAGGGATGCAGG + Intronic
998114447 5:139525432-139525454 ACAGGGGGTAGGAGAAAAGCAGG + Intergenic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
998341966 5:141426293-141426315 ACAGGGTGAAGCAGAGAAGCAGG + Intronic
998471328 5:142386228-142386250 CCATGGGGATGAAGGGAAGGAGG + Intergenic
998596050 5:143531609-143531631 GCAGGGGGATGGAGAGCATCAGG - Intergenic
998884243 5:146677532-146677554 ACAGAGGGAGGGAGGGAGGGAGG - Intronic
999275114 5:150325069-150325091 AGAGAGGGAAGGAGGGAAGAAGG + Intronic
999850600 5:155533896-155533918 AGAGGAGGAGGGAAGGAAGCAGG - Intergenic
1000194295 5:158942960-158942982 GGAGGGGGAAGGAGGGAAGGAGG + Intronic
1000614677 5:163413917-163413939 AGAGGGGAAGGGAGGGAAGGAGG + Intergenic
1000673819 5:164095594-164095616 ACAGGGTAGTGGAGGAAAGCAGG + Intergenic
1001015641 5:168138624-168138646 ACAGGGAGAGAGAGGAAAGCAGG + Intronic
1001333237 5:170777106-170777128 ACAGGGCGATTGAGGGAAAGTGG - Intronic
1001408712 5:171495303-171495325 ACAGAGGGAGGGAGGGAGGGAGG + Intergenic
1001593522 5:172882762-172882784 ACAGGGGTAGGGAGGCAGGCTGG - Intronic
1002030755 5:176428225-176428247 AGAGGGGGAGGGAGGGAGGGAGG - Intergenic
1002130936 5:177081261-177081283 AGAGGGGGAGGGAGGGAGGAAGG + Intergenic
1002172506 5:177383390-177383412 ACGGGGGAATGGAGAGAAACAGG + Intronic
1002370060 5:178744820-178744842 ACTGGAGGATGGAGGGAGGGCGG + Intergenic
1002451448 5:179321352-179321374 GCAAGGGAGTGGAGGGAAGCTGG - Intronic
1002639042 5:180621983-180622005 AGAGAGGGAGGGAGGGAGGCAGG - Intronic
1002899556 6:1399481-1399503 GCAGGGGGAGGGAGGTAAGGAGG + Intergenic
1002963940 6:1943501-1943523 GCAGGGAGAGGGAGGGGAGCAGG + Intronic
1003286051 6:4734681-4734703 GGATGGGGATGGAGGGAAGATGG + Intronic
1003540001 6:7010224-7010246 AGAGAGGGAGGGAGGGAGGCAGG + Intergenic
1003583760 6:7367152-7367174 GAAGGGGGATGGAGGGAAGAGGG - Intronic
1003860813 6:10320085-10320107 ACAGAGGGAGGGAGGGAGGGAGG - Intergenic
1004126818 6:12882121-12882143 ACAGGGGGATGGAGGGAAGCAGG + Intronic
1004487616 6:16082173-16082195 ACTGGGGAAAGGAAGGAAGCTGG + Intergenic
1004632414 6:17434633-17434655 TCAGGGGTATGGAGGGAAATGGG - Intronic
1005044519 6:21629172-21629194 GCAGGGGAATGGAGTGAACCCGG - Intergenic
1005132035 6:22520475-22520497 ACAGGGGAAGGGAGGGGAGGAGG + Intergenic
1005301592 6:24476376-24476398 TGAGGGGCATGGAGGGAAGGAGG - Intronic
1005441445 6:25873517-25873539 GCAGTGGGAAGGAGGGAATCAGG - Intronic
1005477357 6:26220614-26220636 ACAGGCACTTGGAGGGAAGCAGG - Intergenic
1005786728 6:29251690-29251712 AAAGGGGAATGGAGGGCAGAAGG + Intergenic
1005814385 6:29538925-29538947 AGAGAGGGATGGGGGCAAGCAGG - Intergenic
1006266817 6:32932485-32932507 AGAGAGGGAGGGAGGGGAGCGGG - Intergenic
1007043094 6:38743558-38743580 ACAGAGGGCTGGGGGGAAGGGGG - Intronic
1007339436 6:41181157-41181179 AGAGGAGGATGGAGAGAAGAAGG - Intergenic
1007375937 6:41456772-41456794 AGAGGGAGATGGAAGGAAGGAGG - Intergenic
1007408358 6:41647583-41647605 ATCGGGGGAGGGTGGGAAGCAGG - Intronic
1007662009 6:43492550-43492572 ACTGGGGGCTGGTGGCAAGCAGG + Intronic
1007923199 6:45629243-45629265 CCAGTGGGATGGAGGTGAGCAGG + Intronic
1008888201 6:56454386-56454408 ACAGAGCAATGGAAGGAAGCGGG - Intergenic
1008996845 6:57669084-57669106 AGAGAGGGATGGAGTGAAACAGG - Intergenic
1009021937 6:57955529-57955551 ACAGGGGGATGCTGGGGAGTTGG + Intergenic
1009185360 6:60568418-60568440 AGAGAGGGATGGAGTGAAACAGG - Intergenic
1009398160 6:63226841-63226863 ACAAGGGGCAGGTGGGAAGCGGG + Intergenic
1009659130 6:66587058-66587080 AAAGAGGGAGGGAGGGAAGAAGG - Intergenic
1010263452 6:73842211-73842233 TCATGGGGATGGGGGGAAGTGGG - Intergenic
1010613192 6:77981281-77981303 ACAGGGGGAGGGAGAGCATCAGG + Intergenic
1011280292 6:85670787-85670809 AGAGAGGGAAGGAGGGAAGGAGG - Intergenic
1011299943 6:85863418-85863440 TCAGGGGGATGGAGCCAAGATGG - Intergenic
1011410740 6:87063331-87063353 AAAGGGAGATGGAGGGCAGAAGG + Intergenic
1011417438 6:87137311-87137333 AGAGGGGGAAGGAGGGGAGGAGG - Intergenic
1011719869 6:90144365-90144387 ACAGAGGGAAGGAGGGAGGGAGG + Intronic
1011970032 6:93211364-93211386 AGAGAGGGAGGGAGGGAAGAAGG + Intergenic
1012283417 6:97358443-97358465 GCAGGGGAATGGAGTGAACCTGG + Intergenic
1012979797 6:105817501-105817523 ACAGGGGGAAGAAGAGAGGCAGG - Intergenic
1013170080 6:107628961-107628983 AAAGGAGGATGGAGGGATGTGGG - Intronic
1014355086 6:120398535-120398557 ACAGGGGGATGGAGGGAGAGGGG + Intergenic
1014412726 6:121146965-121146987 ATAGGGTGATGGAGGGAGGAAGG - Intronic
1014877977 6:126684737-126684759 GAAGGGGGAGGGAGGGAAGAGGG + Intergenic
1014906935 6:127041703-127041725 ACAGGGGGAGGGAGAGCATCAGG + Intergenic
1014999189 6:128192927-128192949 AGAGGGGGAAGGAGGGAAGGAGG + Intronic
1015085568 6:129287072-129287094 AAAGAGGGAGGGAGGGAAGGAGG + Intronic
1015194126 6:130506656-130506678 AGACAGAGATGGAGGGAAGCAGG + Intergenic
1015205190 6:130629725-130629747 AGAGGGGGAGGGAGGGAAAAAGG + Intergenic
1015383936 6:132600870-132600892 AGAGAGGGAAGGAGGGAAGAAGG + Intergenic
1015383983 6:132601014-132601036 AAGGGGGGAAGGAGGGAAGGAGG + Intergenic
1015572664 6:134637448-134637470 GCAGGGGGAAGGAGAGAAGAGGG + Intergenic
1016233977 6:141839086-141839108 ACATGGGGCTGGAGGCAAGAGGG + Intergenic
1016317708 6:142808514-142808536 ACAGAGGGAAGGAGGGAGGGAGG + Intronic
1016429407 6:143966810-143966832 AGTGGGGGATGAAGGGAGGCGGG - Intronic
1016802649 6:148182365-148182387 AAAGAGGGAGGGAGGGAAGGAGG + Intergenic
1016835472 6:148472491-148472513 AGAGGGAGAGGGAGGGAAGGAGG + Intronic
1017023329 6:150159518-150159540 ACAGAAGGATGGACGGATGCTGG - Intronic
1017047445 6:150360383-150360405 GCAGGGACATGGATGGAAGCTGG - Intergenic
1017902308 6:158728957-158728979 GCAGGAGGATGGAGTGAACCTGG + Intronic
1018017410 6:159724905-159724927 AGAGAGGGAGGGAGGGAAGAAGG + Intronic
1018398557 6:163400291-163400313 ACAGGGGGAAGGAGGAAAGAAGG - Intergenic
1018622767 6:165747786-165747808 ACAGGCAGACGGAGGGAAGGAGG + Intronic
1018839415 6:167507821-167507843 ACAGGGGAAGGGAGGGAATGGGG - Intergenic
1018839639 6:167508372-167508394 ACAGGGGAAGGGAGGGAACAGGG - Intergenic
1018839888 6:167509127-167509149 ACAGGGGGATGGAGGTGACAGGG - Intergenic
1018847783 6:167567174-167567196 ACAGGGGACAGGAGGGAAGATGG + Intergenic
1018886357 6:167941007-167941029 ACAGAGGGATGTAGGGATGAGGG + Intronic
1018886369 6:167941065-167941087 ACAGAGGGATGTAGGGATGAGGG + Intronic
1018886392 6:167941179-167941201 ACAGAGGGATGTAGGGATGAGGG + Intronic
1018886404 6:167941237-167941259 ACAGAGGGATGTAGGGATGAGGG + Intronic
1018886440 6:167941409-167941431 ACAGAGGGATGTAGGGATGAGGG + Intronic
1018886452 6:167941467-167941489 ACAGAGGGATGTAGGGATGAGGG + Intronic
1018912198 6:168108264-168108286 AGAGAGGGAGGGAGGGAAGGAGG + Intergenic
1018959939 6:168441101-168441123 AGAGGGGGAGGGAGAGAGGCGGG + Intergenic
1019281582 7:203024-203046 AGAGGGAGATGGAGGGAAGGTGG + Intronic
1019315068 7:380526-380548 ACAGAGGGAGGGAGGGGAGGGGG + Intergenic
1019315076 7:380548-380570 GCAGGGGGACAGAGGGAGGCAGG + Intergenic
1019315097 7:380586-380608 ACAGAGGGAGGGAGGGGAGGGGG + Intergenic
1019315112 7:380616-380638 ACAGAGGGAGGGAGGGGAGGGGG + Intergenic
1019315127 7:380646-380668 ACAGAGGGAGGGAGGGGAGGGGG + Intergenic
1019334873 7:478361-478383 AGAGAGGGAAGGAGGGAAGGAGG + Intergenic
1019549249 7:1594024-1594046 AGAGAGGGATGGAGGGAGGAGGG - Intergenic
1019560728 7:1655542-1655564 AAAGAGGGAGGGAGGGAAGGAGG - Intergenic
1019632604 7:2057939-2057961 AAAGGGGCATGGAGAGAAGCAGG + Intronic
1019732231 7:2634560-2634582 GCGGGGGGATGGAGGGGAGGTGG + Intronic
1019746260 7:2701899-2701921 GCAGGGAGGTGGAGGGAAGCGGG - Intronic
1020722255 7:11761897-11761919 AAGGGGGGAAGGAGGGAGGCAGG - Intronic
1021447506 7:20749201-20749223 AGAGGGGGAGGGAGGGAGGGAGG - Intronic
1022093867 7:27125879-27125901 ACAGGGGGACAGAGGAAAGATGG + Intronic
1022274611 7:28842934-28842956 ACAGGGACATGAATGGAAGCAGG - Intergenic
1022317883 7:29262785-29262807 GCAGGGGGAGGGAGGGCATCAGG + Intronic
1022574803 7:31487302-31487324 ACAGGAGGAAGGAGGAAGGCGGG - Intergenic
1022613244 7:31899009-31899031 ACAGAGGCAGGGAGGGGAGCAGG - Intronic
1022690699 7:32649671-32649693 AGAGAGGGAGGGAGGGAAGGAGG + Intergenic
1023473578 7:40552293-40552315 ACAGAGGTATGGAGGGCAGAGGG - Intronic
1023567519 7:41538359-41538381 ACATGAGGCTAGAGGGAAGCAGG + Intergenic
1023763835 7:43492336-43492358 ACAGAGGGGTGGATGGTAGCAGG - Intronic
1023903690 7:44505584-44505606 AGAGGGGGAGGGAGGGAGGGAGG + Intergenic
1024439772 7:49403738-49403760 ACGGAGGGAGGGAGGGAAGGAGG + Intergenic
1024459965 7:49649735-49649757 ACAGGGGGGTGGAGCCAAGATGG + Intergenic
1024650900 7:51402767-51402789 GCAGGAGAATGGCGGGAAGCTGG - Intergenic
1025147059 7:56514233-56514255 ACGGAGGGAAGGAGGGAAGGAGG - Intergenic
1025626904 7:63230829-63230851 ACAGAGGGAGGGAGGGAGGGAGG + Intergenic
1026102716 7:67396188-67396210 CCTGGGGGAAGGAGGGAAGCTGG - Intergenic
1026650090 7:72209309-72209331 AAAGAGGGAAGGAGGGAAGGAGG - Intronic
1026650108 7:72209369-72209391 AAAGAGGGAAGGAGGGAAGGAGG - Intronic
1026675585 7:72425430-72425452 ACATGGGGATGGAGGGCCCCCGG - Intronic
1026777753 7:73241528-73241550 AGAGGGAGAAGGAGGGAAGGGGG + Intergenic
1026786626 7:73305613-73305635 ACAGGGGGGTGAGGGGATGCAGG + Intronic
1026833060 7:73621905-73621927 AGAGGGAGATGGAGGGAGGGAGG - Intronic
1026871074 7:73852214-73852236 AAGGCGGGAAGGAGGGAAGCAGG - Intergenic
1027018604 7:74794920-74794942 AGAGGGAGAAGGAGGGAAGGGGG + Intergenic
1027069425 7:75151017-75151039 AGAGGGAGAAGGAGGGAAGGGGG - Intergenic
1027416916 7:77983504-77983526 AGGGAGGGATGGAGGGAGGCAGG - Intergenic
1027610860 7:80358953-80358975 AGAGAGGGAGGGAAGGAAGCAGG - Intergenic
1028424702 7:90673414-90673436 ACAGAGGGAGGGAGGGAGGGAGG - Intronic
1028716419 7:93976274-93976296 TGAAGGGGTTGGAGGGAAGCAGG - Intronic
1029436500 7:100566865-100566887 AGAGCCGGAGGGAGGGAAGCTGG + Exonic
1029453312 7:100654950-100654972 AGAGGTGGATGGTGGGAAGGAGG + Intronic
1030072197 7:105707448-105707470 AGTGGGGGATGGAGGAAGGCTGG + Intronic
1030093299 7:105876589-105876611 AAAGGGGGAGGGAGGGAGGAAGG + Exonic
1030159464 7:106492619-106492641 ACAGAGGGAAGGAGGGAGGGAGG + Intergenic
1030345913 7:108432806-108432828 ACAGGAGGATGGCTGGAACCTGG + Intronic
1030365513 7:108641524-108641546 AGAGGGGGAGGGAGGGAGGGAGG - Intergenic
1030595285 7:111531043-111531065 ACAGGAGGATGGCGTGAACCCGG - Intronic
1030616561 7:111743707-111743729 TCAGGGGGAGGGACAGAAGCCGG + Intronic
1031042446 7:116852521-116852543 ACAGGAGAATGGAGTGAATCCGG - Intronic
1031370288 7:120957276-120957298 ACAGGAGAATGGCGGGAACCCGG + Intronic
1031506642 7:122592834-122592856 CCAGGGGGATGGGGGGAGGGGGG + Intronic
1031750712 7:125569544-125569566 ACAGAGGGAGGGAGGGAGGGAGG - Intergenic
1031982844 7:128139942-128139964 AAAGAGGGAGGGAGGGAGGCAGG - Intergenic
1031990197 7:128192635-128192657 AGAGGGGGATGGTGGGGAGGAGG - Intergenic
1032577265 7:133068592-133068614 ACAGGGGGAAAGAGTGAAGCAGG + Intronic
1033042384 7:137929985-137930007 ACAGGAGAATGGCGGGAACCTGG - Intronic
1033281350 7:140008782-140008804 CCAAGGGGATTGTGGGAAGCTGG + Intronic
1033292731 7:140101505-140101527 AAAGGGGGATGGGGTAAAGCTGG - Intronic
1033531626 7:142269721-142269743 ACATGGGGGTTGAGTGAAGCAGG + Intergenic
1033923597 7:146427878-146427900 ACAGGGGGATGGAGAGCATCAGG - Intronic
1034070443 7:148179590-148179612 AGAGAGGGAGGGAGGGAAGGAGG + Intronic
1034272709 7:149811170-149811192 ACAGGGGGAGGGAGGGGCGCAGG - Intergenic
1034352460 7:150426044-150426066 AGAGGGGGAGGGAGGGAGGGAGG - Intergenic
1034357946 7:150468133-150468155 GGAGTGGGATGGAGAGAAGCAGG - Intronic
1034509907 7:151525559-151525581 GCAGGAGAATGGAGGGAACCCGG + Intergenic
1034550088 7:151814931-151814953 GCAGCAGGATGGAGGGAGGCAGG + Intronic
1034724667 7:153324495-153324517 AGAGGGGGAGGGAGGCAGGCAGG - Intergenic
1034917476 7:155052680-155052702 GCAGGAGGATGGCGGGAACCCGG + Intergenic
1035251047 7:157597176-157597198 GCCGGGGGCTGGGGGGAAGCAGG + Intronic
1035271521 7:157722684-157722706 ACAGGGGTGAGGAGGGAAGGAGG + Intronic
1035437739 7:158871657-158871679 GAAAGGGGAAGGAGGGAAGCGGG - Intronic
1035535454 8:387508-387530 ACAGGGGTGTGGAGGAGAGCCGG + Intergenic
1035754750 8:2022904-2022926 ACAGAGGGAGGCAGGGAGGCTGG - Intergenic
1035819079 8:2572068-2572090 AGACTGGGCTGGAGGGAAGCGGG + Intergenic
1035874683 8:3175532-3175554 AGAGAGGGAGGGAGGGAAGAAGG - Intronic
1035885121 8:3283298-3283320 ACTGGGGCATGTAGGGAACCTGG + Intronic
1036457212 8:8920241-8920263 AGAGAGGGATGGAGGGAGGGAGG + Intergenic
1036495754 8:9268565-9268587 AAGGGGGGAAGGAGGGAAGGGGG + Intergenic
1036507497 8:9368687-9368709 GCAGGAGGATGGAGTGAACCCGG + Intergenic
1036524371 8:9521155-9521177 GCAGGGGAATGGAGTGAACCCGG + Intergenic
1036633043 8:10528957-10528979 TGAGAGGGGTGGAGGGAAGCAGG - Intronic
1036749174 8:11432910-11432932 GCAGGGACATGGATGGAAGCTGG + Intronic
1036990005 8:13581636-13581658 ACAGGGTGATGAACAGAAGCAGG - Intergenic
1037075386 8:14710274-14710296 GCAGGGGAATGGAGTGAACCCGG + Intronic
1037316596 8:17605146-17605168 ACAGGGAGAGGGAAGGAAGGAGG + Intronic
1037724514 8:21472347-21472369 ACAGAGGGAGGGAGGGAGGAAGG + Intergenic
1037897968 8:22670800-22670822 ACATGGGGAAGGGAGGAAGCAGG - Intergenic
1038006302 8:23433218-23433240 ACAGGGGGACGGCGGGACCCAGG + Intronic
1038072280 8:24030342-24030364 ATAGGGGGATGGAGAGTAGGGGG + Intergenic
1038156974 8:25000402-25000424 AGAGGGGGAGGGAGGGAGGGAGG + Intergenic
1038397035 8:27254472-27254494 AGAGGCGGGTGGAGGGAGGCAGG - Intronic
1038419922 8:27427316-27427338 AAAGGGGGCTGGAGGGATTCAGG - Intronic
1038562874 8:28595978-28596000 AGAGAGGGATGGGTGGAAGCAGG - Intergenic
1038850669 8:31272240-31272262 ACGGGGAGATGCAGGGAAGAGGG - Intergenic
1038937556 8:32269049-32269071 AGAGAGGGAAGGAGGGAAGGAGG - Intronic
1039437597 8:37570709-37570731 CCAAGGGGATGGTGGTAAGCAGG + Intergenic
1039644189 8:39262616-39262638 AGGGAGGGATGGAGGGAAGGAGG - Intronic
1039846669 8:41330357-41330379 ACAGAAGGATGGATGGAAGAAGG + Intergenic
1041203451 8:55473882-55473904 AGAGAGGGAGGGAGGGAAGGAGG - Intronic
1041368904 8:57139382-57139404 AGAGGGGGATGAAGAGAAGTTGG - Intergenic
1041482649 8:58340462-58340484 AGAGAGGGATGGAGGGAGGGAGG - Intergenic
1042171932 8:66000080-66000102 ACAGAGGGAGGGAGGGAGGGAGG - Intergenic
1042370248 8:67983388-67983410 ACAGGAGGATGGAGAGATGAAGG - Intronic
1043037685 8:75218797-75218819 AGAGAGGGAAGGAGGGAAGGAGG + Intergenic
1043037747 8:75218984-75219006 GAAGGGGGAAGGAGGGAAGGAGG + Intergenic
1043192043 8:77237684-77237706 AGAGAGGGAGGGAGGGAAGAAGG - Intergenic
1044231959 8:89788805-89788827 AGAGAGGGAGGGAGGGAGGCAGG + Intronic
1044858074 8:96495282-96495304 CCAGGGCGGGGGAGGGAAGCTGG - Intronic
1044903315 8:96972231-96972253 CCAGGGAGGTGGAGGAAAGCTGG - Intronic
1047204293 8:122791041-122791063 ACAGGTGCATGGAGGGCAGGAGG - Intronic
1047306842 8:123659393-123659415 ATAGATGGATGGAGGGAAGATGG - Intergenic
1047541779 8:125774631-125774653 GCAGGAGGATGGAGGGAATCAGG - Intergenic
1048332483 8:133480104-133480126 GGATGGGGAAGGAGGGAAGCTGG + Intronic
1048363160 8:133715352-133715374 AGAGAGGGAGGGAGGGAAGGAGG - Intergenic
1048522622 8:135170980-135171002 GCATGGGGATGTAGGGATGCTGG - Intergenic
1048709667 8:137195215-137195237 AGAGCGGGAAGGAGGGAGGCAGG + Intergenic
1048852453 8:138657981-138658003 TTACGAGGATGGAGGGAAGCAGG - Intronic
1049143924 8:140983691-140983713 AAAGGAGGAAGGAGGGAAGGAGG + Intronic
1049193482 8:141302388-141302410 TCGGGGGGAGGGAGGGCAGCGGG - Intronic
1049237889 8:141521700-141521722 TCTGTGTGATGGAGGGAAGCAGG - Intergenic
1049348814 8:142153192-142153214 ACAGCAGCATGGAGAGAAGCTGG + Intergenic
1049366893 8:142243568-142243590 AGAGGGGGATGGTGGTTAGCAGG + Intronic
1049517332 8:143067687-143067709 ACAGGGTGATGGTGGGGAGAAGG + Intergenic
1049775289 8:144401153-144401175 GCAGGGGGAGGGAGGGTGGCTGG + Intronic
1050368098 9:4891199-4891221 AGAGAGGGAGGGAGGGAAGGAGG - Intergenic
1050972328 9:11893368-11893390 ACAGAGGGCTGCATGGAAGCAGG - Intergenic
1051260093 9:15255392-15255414 AAAGGGGGAAAGAGGGAAGAAGG + Intronic
1051434547 9:17016953-17016975 AAAGAGGGAGGGAGGGAGGCAGG - Intergenic
1051706564 9:19887056-19887078 ACAGGGGAAGGGAGAGAATCAGG + Intergenic
1052346228 9:27412549-27412571 AAAGGGAGAGGGAGGGAAGGAGG - Intronic
1052475672 9:28956571-28956593 AAAGGGGGAGGGAGGGATGGAGG - Intergenic
1052475689 9:28956615-28956637 AAAGGGGGAGGGAGGGAGGGTGG - Intergenic
1052829351 9:33202466-33202488 ACAAGGGGATAGTGGGAACCTGG + Intergenic
1052835729 9:33248656-33248678 CCAGAGGGACGGAGAGAAGCTGG - Intronic
1052894198 9:33731932-33731954 ACAATGGGATGGTGGGCAGCAGG + Intergenic
1052982258 9:34458134-34458156 TGAGGGGGAGGGAGGGAATCAGG - Intronic
1053135895 9:35650139-35650161 AAAGGGGGAGGGAAGGAAGTGGG - Intronic
1053186196 9:36018433-36018455 ACAGGGTGCTGGAAGAAAGCTGG + Intergenic
1055186050 9:73455427-73455449 AGAGGGGGAGGGAGGGAGGAAGG - Intergenic
1055313978 9:75014536-75014558 AAAGAGGGAGGGAGGGAAGACGG + Intronic
1055578987 9:77688372-77688394 ACAGGGGGGTGGAGCCAAGATGG - Intergenic
1055595085 9:77857641-77857663 AAGGGGGGAAGGAGGGAAGGAGG + Intronic
1055618063 9:78093834-78093856 AGAGAGGGAGGGAGGGAAGAAGG + Intergenic
1055969752 9:81900295-81900317 AGGGAGGGAGGGAGGGAAGCAGG - Intergenic
1055996490 9:82165990-82166012 AAAAGGGGAGGGAGGGAAGTAGG + Intergenic
1056322024 9:85444276-85444298 AAAGAGGTATGGAGGGAAGAAGG - Intergenic
1056523951 9:87425402-87425424 AAAGGGGGAAGGAGGGAGACAGG + Intergenic
1056606674 9:88091298-88091320 ACAGGAGAATGGAGTGAACCCGG + Intergenic
1056775442 9:89508880-89508902 ACAGGGGGATGAAGGAAAAAGGG - Intergenic
1057631216 9:96720240-96720262 TCAGGGCGAGGGAAGGAAGCCGG + Intergenic
1057691695 9:97291748-97291770 ACAGTATGATGGAAGGAAGCAGG + Intergenic
1057693600 9:97308151-97308173 GAAGGGGGATGGAGAAAAGCGGG - Intronic
1057719067 9:97517873-97517895 ACAGGGGGCTCGTGGGAAACAGG + Intronic
1057752691 9:97804835-97804857 AAAAGGGGAAGGAGGAAAGCAGG - Intergenic
1057852280 9:98574942-98574964 TCAGAGGGATGGAGGGAGGTGGG - Intronic
1057931916 9:99201087-99201109 GCAGGGTGAGGGTGGGAAGCTGG - Intergenic
1057961038 9:99457676-99457698 AGAGAGGGAGGGAGGGAAGGAGG + Intergenic
1058402100 9:104631449-104631471 AAAGGGGGATGGAGGCAACATGG - Intergenic
1058569579 9:106326244-106326266 AGAGAGGGAGGGAGGGAAGGAGG + Intergenic
1058643337 9:107107936-107107958 AAAGGGAGAGGGAGGGAGGCAGG + Intergenic
1059008939 9:110435467-110435489 AGATGGGGGTGGAGGGAAGCAGG + Intronic
1059075834 9:111193094-111193116 ACAGGGGAAAGGAGGAGAGCAGG - Intergenic
1059130899 9:111748641-111748663 AGAGAGGGAGGGAGGGAAGAAGG - Intronic
1059383881 9:113949374-113949396 ACAGGGGTCTGGAGGGATGGTGG - Intronic
1059678192 9:116560549-116560571 ACTTGAGGCTGGAGGGAAGCTGG - Intronic
1059701084 9:116775767-116775789 AAAGGGGGAAGGAGGGAAGGAGG + Intronic
1059750724 9:117244761-117244783 AGAGAGGGAAGGAGGGAAGGAGG + Intronic
1059929863 9:119249959-119249981 AGAGAGGGAGGGAGGGAAGAAGG + Intronic
1059929888 9:119250047-119250069 AGAGAGGGAGGGAGGGAAGAAGG + Intronic
1059942771 9:119374004-119374026 AGAGAGGGAGGGAGGAAAGCGGG - Intergenic
1060218799 9:121753803-121753825 TCAGGTGAAAGGAGGGAAGCAGG - Intronic
1060396299 9:123319180-123319202 AGAGGGAGATGGCAGGAAGCAGG + Intergenic
1060667868 9:125443708-125443730 ACAGGGGGATGGGGGGCTGGGGG - Intronic
1060670775 9:125467564-125467586 CCTGTGAGATGGAGGGAAGCTGG - Intronic
1060726357 9:126008541-126008563 AGAGAGGGAGGGAGGAAAGCAGG + Intergenic
1060818409 9:126647922-126647944 ACAGGAGGATGGAGGGTTGGAGG - Intronic
1060913104 9:127366464-127366486 ACCTGGGGATGCAGGGCAGCAGG - Intronic
1060937517 9:127524241-127524263 ACAGGGGGAGGGAGGCATGTGGG + Intronic
1061009531 9:127946749-127946771 AAAAGGGAGTGGAGGGAAGCTGG + Intronic
1061036832 9:128118843-128118865 ACAGAGGGATGCAGGGATGGAGG + Intergenic
1061120652 9:128640363-128640385 ACATGGGGAGGCAGGGCAGCCGG + Intronic
1061231457 9:129318270-129318292 ACACGAGGAAGGAGGAAAGCAGG - Intergenic
1061255638 9:129453311-129453333 AATGGGGGATGGAGGGATGGAGG + Intergenic
1061257316 9:129460343-129460365 AGAGGAGGAGGGAGGGAGGCTGG - Intergenic
1061465425 9:130774871-130774893 AGTGGGGGAGGGAGGGAAGGAGG + Intronic
1061962597 9:133995659-133995681 ACAGGTGGAAGGGTGGAAGCGGG - Intergenic
1062144029 9:134979001-134979023 AGAGAGGGAGGGAGGGAGGCAGG + Intergenic
1062185745 9:135217610-135217632 AGAGAGGGAGGGAGGGAGGCTGG - Intergenic
1062203862 9:135324652-135324674 ACAGGAGGGAGGTGGGAAGCAGG + Intergenic
1062334386 9:136058579-136058601 ACAGGATGAGGGAGGGAAGAGGG + Intronic
1062357339 9:136171057-136171079 ACAGGGGGATGGGTGGGAGCTGG - Intergenic
1062404683 9:136389809-136389831 AAAGGGGGCTGGAGGGTGGCTGG + Intronic
1203365150 Un_KI270442v1:249576-249598 ACAGAGGGAGGGAGGGAGACAGG + Intergenic
1185508199 X:644225-644247 CCAGGGGGAAGGAGGAAAGGCGG + Intronic
1185642794 X:1597809-1597831 ACAGAGGGATTGGGGGAAGCGGG + Intronic
1185982887 X:4798978-4799000 TCAGTGGGATGGATGGGAGCTGG + Intergenic
1186014690 X:5177884-5177906 GCAGGAGGATGGAGTGAACCCGG + Intergenic
1186291869 X:8109092-8109114 AAAGGAGGAAGGAGGGAGGCAGG - Intergenic
1186420308 X:9420322-9420344 AGAGGGGGATGAAGGGAAGGAGG - Intergenic
1186449804 X:9662547-9662569 GCTGGGGGATGGGGAGAAGCAGG + Intronic
1187041857 X:15604717-15604739 AAAGGGGTAAGGATGGAAGCAGG + Intergenic
1187126799 X:16461919-16461941 AAAGGGGGAGGGAGGGATGGAGG + Intergenic
1187557080 X:20362359-20362381 CCTGGGGGAAGCAGGGAAGCGGG - Intergenic
1187783538 X:22857340-22857362 AGAGGGGGAGGGAGGGAGGGAGG - Intergenic
1188177323 X:27007062-27007084 AGAGGGGGATGAAGAGAAGTTGG + Intergenic
1188520178 X:31030076-31030098 AGAAGGGGAAGGAGGAAAGCAGG + Intergenic
1188599274 X:31941497-31941519 ACAGGAGGATGGAGAGAAGTGGG - Intronic
1188658218 X:32725696-32725718 ACTAGGGGGTGGAGGTAAGCTGG + Intronic
1188697722 X:33216445-33216467 GAGGGGGAATGGAGGGAAGCGGG + Intronic
1189984650 X:46543572-46543594 AGAGGTGGATGCAGGGAAGCAGG - Intronic
1190053448 X:47168951-47168973 ACATAGGGATGGAGAGAGGCAGG + Intronic
1190531621 X:51384641-51384663 AGAGGGGGATGAAGAGAAGTGGG - Intergenic
1190713744 X:53087565-53087587 AGAGGGAGATGGAGGGAGGCAGG - Intronic
1191273407 X:58510359-58510381 ACAGGGGGTTGGAGCCAAGATGG + Intergenic
1191567182 X:62555433-62555455 ACAGGGGGTTGGAGCCAAGATGG + Intergenic
1191915565 X:66198147-66198169 AGAGAGGGAGGGAGGGAAGGAGG - Intronic
1192202956 X:69078512-69078534 AGAGGAGGGTGGAGGGCAGCTGG - Intergenic
1192307313 X:69975460-69975482 ACATGTGGAGGGAGGGAAGGAGG + Intronic
1193331944 X:80244765-80244787 AGAGAAGGATGGAGGGAGGCAGG - Intergenic
1193453455 X:81700021-81700043 ACAGTGGGAGGGAGTGAAGTTGG + Intergenic
1193787160 X:85773016-85773038 ACAGGGGGGTGGAGGCAAGATGG - Intergenic
1194562299 X:95437664-95437686 ACAGGGTAATGGATAGAAGCAGG - Intergenic
1195117805 X:101717158-101717180 ACAGGGGAATGGAGAGAAACAGG - Intergenic
1195723642 X:107891245-107891267 ACAGGAGGATGGAGCCAAGATGG - Intronic
1195740545 X:108060888-108060910 CCAGGGGTATGGAGGGAACAGGG - Intronic
1195797177 X:108663592-108663614 TCAGGGGGATGGAGAGCATCAGG + Intronic
1195804074 X:108743095-108743117 AGAGTGGGAGGGAGGGAAGTGGG + Intergenic
1195824758 X:108987348-108987370 AGGGAGGGAGGGAGGGAAGCAGG - Intergenic
1196028147 X:111064440-111064462 AGAGGGGGAGGGAGGGAGGGAGG - Intronic
1196058820 X:111385754-111385776 AGAGAGGGAGGGAGGGAAGGAGG + Intronic
1196119075 X:112029122-112029144 ACGGGGGGTTGGAGGGAGGGTGG - Intronic
1196371473 X:114984211-114984233 AAAGGGGAATGGAGGCAAGATGG + Intergenic
1196409137 X:115397363-115397385 AAAGGGGGAGGGAGGGAGGAAGG + Intergenic
1196941303 X:120778698-120778720 ACAGGGGGAGGGAGGGCATCAGG + Intergenic
1196985961 X:121271136-121271158 ACAGGGGGAGGGAGAGCATCAGG + Intergenic
1197187246 X:123601466-123601488 AAAGGAGGAGGGAGGGAAGAAGG + Intronic
1197383125 X:125769886-125769908 TCATGGGGAGGGAGGGAAGCAGG - Intergenic
1197583934 X:128320495-128320517 AGAGAGGGAGGGAGGGAGGCAGG + Intergenic
1198019484 X:132644213-132644235 AAGGGGGGAGGGAGGGAAGGAGG + Intronic
1198216232 X:134557098-134557120 AGAGAGGGAGGGAGGGAAGGGGG - Intergenic
1198578992 X:138042555-138042577 ATAGAGGGAGGGAGGGAAGAAGG + Intergenic
1198631356 X:138642209-138642231 AGAGGGTGAGGGAGGGAAGCAGG + Intronic
1198655960 X:138913611-138913633 AGAGAGGGAGGGAGGGAAGGAGG + Intronic
1198686015 X:139228880-139228902 ATAGGGGGATGGAATGAAGATGG + Intergenic
1199296484 X:146164649-146164671 ACAGAGGGAGGGAGGGAGGGAGG + Intergenic
1199679512 X:150215383-150215405 AGAGGGGGAAGGAGGGAAGGAGG + Intergenic
1199695719 X:150341666-150341688 AGAGGGGGAAGGAGGGAAGGAGG - Intergenic
1199942654 X:152640224-152640246 CCATGGGGAGGGAGGGGAGCAGG + Intronic
1200083415 X:153590877-153590899 ACAAGGGGATGGAGGGCACTCGG + Intronic
1200091344 X:153637536-153637558 ACCCGGGGATGGGGGGCAGCAGG + Intergenic
1200153926 X:153965262-153965284 GCAGGGGCAGGGAGGGATGCTGG - Intronic
1200355412 X:155544744-155544766 ACAGGGAGATGGAGTGGGGCTGG + Intronic
1200767493 Y:7092643-7092665 ACAGAGGGAAGGAGGGAAGGGGG - Intergenic
1201073588 Y:10170850-10170872 ACAGAGGGAGGGAGGGAGACAGG - Intergenic
1201256410 Y:12112289-12112311 AGAGGGAGATGGAGGGAAGGAGG - Intergenic
1201256467 Y:12112694-12112716 GAAGGGGGAGGGAGGGAAGGAGG - Intergenic
1201538901 Y:15084735-15084757 AAAGAGGGAGGGAGGGAAGGAGG + Intergenic
1201550066 Y:15210232-15210254 ACAGAGGGAGGGAGGGATGGAGG + Intergenic
1201650538 Y:16280004-16280026 AAATGGGAATGGAGGGAAGGAGG - Intergenic
1201888952 Y:18920441-18920463 AAAGAGGGAGGGAGGGAAGAAGG + Intergenic
1201918252 Y:19205701-19205723 ATCGGGGGAGGGAGAGAAGCAGG - Intergenic
1202231789 Y:22666282-22666304 ACAGAGGGATGGAGGAAGGAAGG - Intergenic
1202311369 Y:23529883-23529905 ACAGAGGGATGGAGGAAGGAAGG + Intergenic
1202559433 Y:26140711-26140733 ACAGAGGGATGGAGGAAGGAAGG - Intergenic