ID: 1004132468

View in Genome Browser
Species Human (GRCh38)
Location 6:12933739-12933761
Sequence TGTATGTAGGGGCTGTCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 107}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004132468_1004132475 14 Left 1004132468 6:12933739-12933761 CCTGAAGACAGCCCCTACATACA 0: 1
1: 0
2: 0
3: 8
4: 107
Right 1004132475 6:12933776-12933798 ATCTGCTCAGGCCCCAGTACAGG 0: 1
1: 0
2: 2
3: 14
4: 155
1004132468_1004132472 2 Left 1004132468 6:12933739-12933761 CCTGAAGACAGCCCCTACATACA 0: 1
1: 0
2: 0
3: 8
4: 107
Right 1004132472 6:12933764-12933786 ACATCAGCCCACATCTGCTCAGG 0: 1
1: 0
2: 1
3: 23
4: 164
1004132468_1004132476 17 Left 1004132468 6:12933739-12933761 CCTGAAGACAGCCCCTACATACA 0: 1
1: 0
2: 0
3: 8
4: 107
Right 1004132476 6:12933779-12933801 TGCTCAGGCCCCAGTACAGGTGG 0: 1
1: 0
2: 2
3: 16
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004132468 Original CRISPR TGTATGTAGGGGCTGTCTTC AGG (reversed) Intronic
906384986 1:45360353-45360375 GATATGTCGGGCCTGTCTTCAGG + Intronic
906924566 1:50101259-50101281 TGTATGTAAGGGGTTTTTTCAGG + Intronic
909563829 1:77033502-77033524 TGCCTCTTGGGGCTGTCTTCAGG + Intronic
911259090 1:95665653-95665675 TGTAAGTAAGGGCAGTCTTGTGG - Intergenic
911445228 1:97984175-97984197 TGTCTTTAAGAGCTGTCTTCTGG + Intergenic
915387638 1:155510584-155510606 TGTATGTAGGGGATGCATACTGG + Intronic
917840592 1:178974288-178974310 AGAGTGGAGGGGCTGTCTTCAGG + Intergenic
918060290 1:181055353-181055375 TGTATGTTGTGGGTGTCGTCAGG - Exonic
922689328 1:227675287-227675309 TTTATTTCTGGGCTGTCTTCTGG - Intronic
1062831391 10:608262-608284 TGTGTGTAGGGGCTGTGTGTGGG - Intronic
1063114602 10:3065061-3065083 TGTATGTAAGGGCTGGGGTCAGG - Intergenic
1063701969 10:8393769-8393791 AATATGAAGGGTCTGTCTTCTGG - Intergenic
1065967792 10:30783342-30783364 TGTTTTTATGGGCTGTCTACTGG - Intergenic
1066610616 10:37244398-37244420 TGTCTGTATGGGGTTTCTTCAGG - Intronic
1069554617 10:69389640-69389662 TGTATGGAGGGGCTCTGGTCAGG + Intronic
1070418192 10:76209561-76209583 TGTATGTAGTGGTTGATTTCTGG + Intronic
1073769594 10:106720961-106720983 TGGTTGTTAGGGCTGTCTTCAGG + Intronic
1073894125 10:108134482-108134504 GTTATGTAGGGGATGTCTGCTGG - Intergenic
1074453122 10:113575501-113575523 TGGAAGTAGGGGAGGTCTTCAGG + Intronic
1074953592 10:118365209-118365231 AGTCTGTTGGGGCTGTTTTCAGG + Intergenic
1076417347 10:130301087-130301109 TGTCTGCAGGGGCTGCCTTCCGG + Intergenic
1076659980 10:132049228-132049250 TCTATGTAGGGACGGTCTTCCGG + Intergenic
1079737115 11:24011358-24011380 TGTACGTAGGGGCTATCTGCAGG - Intergenic
1079759053 11:24305260-24305282 TGTGTGTAGTGGCTATATTCTGG - Intergenic
1091062199 11:132474119-132474141 TGCATGTTGGGTCTGTCTGCTGG - Intronic
1093102806 12:15048224-15048246 TGTAGGTATGGGTTGTCTTGAGG + Intergenic
1095666998 12:44814223-44814245 TCTATGTAAGGGATGTCATCTGG + Intronic
1096179288 12:49541770-49541792 TGCATGTAGGTGCTGTGGTCGGG + Intronic
1097714596 12:62953611-62953633 TGTATGAGGGGGCAGTCTTGGGG - Intergenic
1103177372 12:118876421-118876443 TGACTGTGGGGGCTGTGTTCGGG + Intergenic
1111342290 13:86902533-86902555 TGTATGTTGGTCCTGTCTTCTGG - Intergenic
1113650837 13:112033071-112033093 TCAATGGAAGGGCTGTCTTCTGG + Intergenic
1117380438 14:55156678-55156700 TGTATTTAGAGGCTTTCCTCGGG - Intronic
1117733022 14:58743052-58743074 TATAAGCAGGGCCTGTCTTCGGG + Intergenic
1120044960 14:79795356-79795378 TCTAGGTAGGGAATGTCTTCAGG - Intronic
1120073188 14:80126016-80126038 TGTATGTAGAAACTGACTTCAGG + Intergenic
1123583396 15:21736705-21736727 TGTATGAAGTGGCTGTGTCCTGG + Intergenic
1123620046 15:22179302-22179324 TGTATGAAGTGGCTGTGTCCTGG + Intergenic
1125441448 15:39708026-39708048 TGTCTGTGGGGGCTGTCTTATGG + Intronic
1125754517 15:42053928-42053950 TGTTTCTAGGGGATGTCTCCAGG + Intergenic
1141250003 16:82347097-82347119 TTGATGTAGGACCTGTCTTCTGG + Intergenic
1141620722 16:85235465-85235487 TGTGTGTAGGGGGTGTGTTCTGG + Intergenic
1145864077 17:28228873-28228895 TGTATCTATGGGATGTCTCCTGG + Intergenic
1146627390 17:34444930-34444952 TGTAGGGTGGGGCTGTCTCCAGG + Intergenic
1147926816 17:43951694-43951716 TGTATCTGTGGGCTCTCTTCTGG - Intergenic
1149606728 17:57930366-57930388 TGTTTGTAAGGGCTACCTTCTGG - Intronic
1150004274 17:61460180-61460202 TCAAAGTAGGGGCTGTGTTCTGG - Intronic
1153554453 18:6296550-6296572 TGCCTGGAGGGGCTTTCTTCTGG - Intronic
1156313873 18:35949975-35949997 TGTCTGCAAGGGCTGTCGTCAGG - Intergenic
1156524157 18:37750612-37750634 TCTAGGTAGGGGGTGCCTTCTGG + Intergenic
1158889880 18:61862855-61862877 TGTGGGTAGGGGCAGTCTTGGGG + Intronic
1162276795 19:9662174-9662196 TGCAAGTCTGGGCTGTCTTCTGG - Intronic
1163069386 19:14825796-14825818 TCTACGTTGGGGGTGTCTTCTGG - Intronic
1164451831 19:28372693-28372715 TGGAGGCAGGGGCTGTCTTGTGG + Intergenic
1165110866 19:33501256-33501278 TGTCTGCAGGGGCTGGCTGCAGG - Intronic
1166378539 19:42342676-42342698 AAACTGTAGGGGCTGTCTTCAGG + Intronic
926005701 2:9372026-9372048 TTTGTGTAGGAGCTGCCTTCGGG + Intronic
927367404 2:22315701-22315723 TGTTTCTATGGGCTGTATTCTGG + Intergenic
929898435 2:45981573-45981595 TGTTTGCAGGGGCTCTCTTGTGG + Intronic
931139481 2:59441175-59441197 TGTATTTAGGGTTTCTCTTCAGG - Intergenic
931559698 2:63546533-63546555 TGTATGCAGTGGCTTGCTTCAGG - Intronic
931869456 2:66443365-66443387 TGATTGTAGGGGCTTTGTTCCGG + Intronic
932897607 2:75657247-75657269 TGTGGGAAGGGGCTGTCTTTAGG + Exonic
933639501 2:84744180-84744202 TGTCTGCAGGGGCTCTCCTCTGG - Intronic
935574225 2:104692342-104692364 TGAAGGTAGGGGCTGCCTTGGGG - Intergenic
943657019 2:190520750-190520772 TGTATGGAGGGGCTGCAGTCTGG - Intronic
947024369 2:225720243-225720265 TGTATGTTGGGGGTGTGTTTTGG - Intergenic
948530875 2:238603240-238603262 TGTATGTAGTGGCTATCCTCAGG + Intergenic
1170296084 20:14827357-14827379 TGTATGTAGGGGCTGGATAGAGG - Intronic
1178748736 21:35280140-35280162 TGGGTCTAGGGGCTGTCTCCTGG - Intronic
1182530866 22:30955706-30955728 TGTATTTAAAAGCTGTCTTCCGG + Intronic
1185362339 22:50415837-50415859 CGTATGTAAGCTCTGTCTTCAGG - Intronic
951188214 3:19739279-19739301 TGGATGTTGGTGCTGGCTTCTGG - Intergenic
951516559 3:23566427-23566449 TGTCTGGAGTGTCTGTCTTCAGG - Intronic
951885892 3:27524045-27524067 TGTGTGTGTGTGCTGTCTTCTGG - Intergenic
956406293 3:68932155-68932177 TGTATTTAGGTGCTGTCTCGTGG - Intronic
959038236 3:101389617-101389639 TGTAAGTAGGGCCTGTCTAGTGG - Intronic
969374668 4:6755365-6755387 TGGACCTAGGGGATGTCTTCTGG + Intergenic
970036542 4:11741870-11741892 TGTATGTAGGCACAGCCTTCAGG + Intergenic
970208347 4:13679637-13679659 TTTATGAAGAGTCTGTCTTCAGG + Intergenic
970831196 4:20341615-20341637 TGTATCTAGGGGAAGTATTCAGG + Intronic
976404394 4:84645894-84645916 TGTGTGTAGGGGCTGGCTGGTGG + Intronic
976943216 4:90732310-90732332 TGAATGTAGGGGTAGTCTTAGGG - Intronic
981317843 4:143358909-143358931 TGAATGAAGAGGCTGCCTTCAGG + Intronic
981581244 4:146250383-146250405 TGTATTTAGTCGCTGTCTTCAGG + Intergenic
982521449 4:156421738-156421760 TGGATTTAGGAGCTGTTTTCAGG + Intergenic
985564995 5:611319-611341 TGTGTGCAGGGGCTGTGTGCAGG - Intergenic
988852174 5:35190983-35191005 TGTCTGTAGGGGCTTTGTTTTGG - Intronic
996517219 5:124383899-124383921 TGTATGTATCCACTGTCTTCTGG - Intergenic
997173024 5:131743773-131743795 TTTTTGTGAGGGCTGTCTTCTGG - Intronic
1002409508 5:179062448-179062470 TGCTTGTGGAGGCTGTCTTCCGG - Intronic
1004132468 6:12933739-12933761 TGTATGTAGGGGCTGTCTTCAGG - Intronic
1006572043 6:35013624-35013646 TGTATGAAGTGTCTGTCCTCAGG - Intronic
1010676482 6:78751713-78751735 TGTTTGCAAGTGCTGTCTTCAGG + Intergenic
1014700854 6:124686225-124686247 TGTATGTAAGGCCTGCCTTGCGG - Intronic
1014930707 6:127332592-127332614 TGGATGTAGGGGAGTTCTTCCGG + Intronic
1015710146 6:136130371-136130393 TATATGTAGGGGGTGTGGTCAGG - Intronic
1017740159 6:157399439-157399461 TGTATATATGCCCTGTCTTCGGG + Intronic
1019833065 7:3352963-3352985 TGTAGTTAGGGTCTGTCTTGAGG + Intronic
1019933699 7:4240651-4240673 TGTGTGTAGGCGCTGTCCTGGGG + Intronic
1022668457 7:32432519-32432541 TCTCTGGAGGGGCTGTCTGCTGG - Intergenic
1023087402 7:36585122-36585144 AGTATGAAGGGGCTGTCTGGAGG + Intronic
1024756023 7:52532443-52532465 GGGATGTGGGGTCTGTCTTCTGG - Intergenic
1025785247 7:64638010-64638032 TGTTTTTAGGTTCTGTCTTCAGG - Intergenic
1027385562 7:77656250-77656272 CGGCTGTAGGGGCTGGCTTCCGG + Intergenic
1031078920 7:117239863-117239885 TGTCTGTGGGGGCTGTTTCCAGG - Intergenic
1033960987 7:146912982-146913004 TATATGTAGATGATGTCTTCAGG + Intronic
1037597580 8:20367341-20367363 TGGACTTTGGGGCTGTCTTCAGG + Intergenic
1043585282 8:81761280-81761302 AGTATTTAGGGGCTTTTTTCTGG - Intergenic
1045346215 8:101295898-101295920 TGTATGTGCTGGCTGTTTTCTGG + Intergenic
1045379451 8:101608857-101608879 GGCATGTAGGGTGTGTCTTCAGG + Intronic
1049955425 9:688675-688697 GGTATGTTGTGGCTGTCTTAAGG + Intronic
1052267897 9:26595385-26595407 AGTATGTAGTGGCTGGCTTTGGG + Intergenic
1056984697 9:91351820-91351842 TTTATGTAGGGGATGGTTTCAGG - Intronic
1186809074 X:13169240-13169262 TGGCTGAAGGGGCTGTCTACTGG - Intergenic
1193925410 X:87478075-87478097 TGTATGTAGGTGCTTTGATCTGG + Intergenic