ID: 1004132482

View in Genome Browser
Species Human (GRCh38)
Location 6:12933815-12933837
Sequence CAGGGTATGAGCCCTGTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 196}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004132474_1004132482 20 Left 1004132474 6:12933772-12933794 CCACATCTGCTCAGGCCCCAGTA 0: 1
1: 0
2: 0
3: 38
4: 273
Right 1004132482 6:12933815-12933837 CAGGGTATGAGCCCTGTTCAAGG 0: 1
1: 0
2: 1
3: 18
4: 196
1004132473_1004132482 21 Left 1004132473 6:12933771-12933793 CCCACATCTGCTCAGGCCCCAGT 0: 1
1: 0
2: 1
3: 26
4: 376
Right 1004132482 6:12933815-12933837 CAGGGTATGAGCCCTGTTCAAGG 0: 1
1: 0
2: 1
3: 18
4: 196
1004132479_1004132482 3 Left 1004132479 6:12933789-12933811 CCAGTACAGGTGGACAATTCTCT 0: 1
1: 0
2: 0
3: 14
4: 103
Right 1004132482 6:12933815-12933837 CAGGGTATGAGCCCTGTTCAAGG 0: 1
1: 0
2: 1
3: 18
4: 196
1004132477_1004132482 5 Left 1004132477 6:12933787-12933809 CCCCAGTACAGGTGGACAATTCT 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1004132482 6:12933815-12933837 CAGGGTATGAGCCCTGTTCAAGG 0: 1
1: 0
2: 1
3: 18
4: 196
1004132478_1004132482 4 Left 1004132478 6:12933788-12933810 CCCAGTACAGGTGGACAATTCTC 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1004132482 6:12933815-12933837 CAGGGTATGAGCCCTGTTCAAGG 0: 1
1: 0
2: 1
3: 18
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004132482 Original CRISPR CAGGGTATGAGCCCTGTTCA AGG Intronic
900165929 1:1244336-1244358 CAGGGTCTGAGCCCCGGACAGGG - Intronic
900392414 1:2439386-2439408 CGGGTTCTGGGCCCTGTTCATGG + Intronic
900936172 1:5767533-5767555 CAGGGTAAGAGCGATGTTCAGGG - Intergenic
901535438 1:9879783-9879805 AAGGGTCTGAGCCCTGTAGACGG - Intronic
902697654 1:18151016-18151038 CAGGGTATGTGACCTGAGCAAGG + Intronic
903036699 1:20497747-20497769 CAGGTTATGTGACTTGTTCAAGG - Intergenic
904471547 1:30739689-30739711 GAGGGTAGGAGCCCTCTTCCTGG - Intronic
904912697 1:33947267-33947289 CAGGGTGGGAGCCCTGCTCTGGG + Intronic
906151082 1:43588140-43588162 CAGGGTCTCAGCCATGCTCAGGG - Intronic
912407708 1:109454399-109454421 CAGGTTAGGAACCCTGTACAGGG + Intergenic
913112340 1:115667563-115667585 CAGGGTAAGGGACCTGCTCAAGG + Intronic
916336002 1:163671896-163671918 CAGGGTATGTACCCTAGTCAAGG - Intergenic
919146718 1:193644901-193644923 CAGCGTTTGAGCCCTGCTAAGGG - Intergenic
920673162 1:208020241-208020263 CAGGGTCTGTGCTCTGTTCTGGG + Intergenic
923081343 1:230658558-230658580 CAGTGTATGAGCTCTGGTAAGGG - Intronic
924515447 1:244761640-244761662 GCGGGTCTGAGCCCTGTTCCTGG - Intergenic
1067403581 10:46000026-46000048 CAGGGTACCAGCAATGTTCAGGG - Intronic
1067566327 10:47340282-47340304 CAGGGCATGTGCCGTGTTTATGG - Intergenic
1067577970 10:47419768-47419790 CAGGGTCCGAGCTCTGTGCAGGG + Intergenic
1067577989 10:47419834-47419856 CAGGGTCCGAGCTCTGTGCAGGG + Intergenic
1070364710 10:75725407-75725429 CAAGGTATGAGACCTTTTAAAGG - Intronic
1070396071 10:76012048-76012070 CAGGGTCTGAGTGCAGTTCAGGG + Intronic
1071589040 10:86854234-86854256 CAGGGTAACAGCAATGTTCAGGG - Intronic
1073903424 10:108249529-108249551 CAGGTTAGGAACCCTGTACAGGG - Intergenic
1074649335 10:115501380-115501402 CAGGTTATGAACCCTGTTACAGG + Intronic
1077384931 11:2264314-2264336 CAAGGTTGGGGCCCTGTTCATGG - Intergenic
1079496837 11:21053521-21053543 CAGGGCAGGAGCCCTCCTCAGGG + Intronic
1083676275 11:64326999-64327021 CAGGTAAGGAGCCCTGCTCAGGG + Intergenic
1084875177 11:72126042-72126064 CAGGTTAGGAACCCTGTCCAGGG + Intronic
1085472266 11:76766070-76766092 CAGGTTAAGAGCTCTGCTCAAGG + Intergenic
1087016104 11:93555825-93555847 CAGGGAAGGAGCCCTGTGCAAGG - Intergenic
1088638778 11:111850825-111850847 CACTGTATCAGTCCTGTTCATGG + Intronic
1090571693 11:128054064-128054086 CAGGGTGAGAGCTGTGTTCAAGG - Intergenic
1091799427 12:3315574-3315596 CAGGGTGTGAGCCCTGGGCTGGG - Intergenic
1092702514 12:11247919-11247941 CAGGATATCAGCCCTGTAAAAGG - Intergenic
1095203311 12:39410879-39410901 CAGGGTATGAGAACTTTGCAGGG - Intronic
1095870152 12:47018060-47018082 CAGTGTTTGAGACCTGTTTAGGG - Intergenic
1097086385 12:56471474-56471496 CATGGTATGAGCACAGGTCATGG - Exonic
1097133539 12:56832179-56832201 CAGGTCAGGAGCCCTGTACAGGG + Intergenic
1100499075 12:95156164-95156186 CAGGGTAACAGCAATGTTCAGGG + Intronic
1102617711 12:114169033-114169055 CAGGGTATGTGCTCAGTTCCAGG - Intergenic
1104056471 12:125234582-125234604 CAGGTTCTGAGCCTTGCTCAGGG + Intronic
1104730002 12:131099812-131099834 CAGGCTATTAGCTCAGTTCAAGG + Intronic
1106623214 13:31391154-31391176 CAGGTTAGGAACCCTGTGCAGGG + Intergenic
1106954730 13:34924015-34924037 CAAGGCATGAGCCCTGACCAGGG + Intergenic
1108446833 13:50517962-50517984 CTGGGTATGAGCCCTGTCCCTGG + Intronic
1109081184 13:57903357-57903379 CAGGGTAAGAGCAATGTTCAGGG - Intergenic
1109388973 13:61668645-61668667 CAGGTCAGGAGCCCTGTACAGGG + Intergenic
1109865574 13:68259535-68259557 CAGGTTAGGAACCCTGTACAGGG - Intergenic
1111028747 13:82568904-82568926 CAGGTTAGGAACCCTGTACAGGG + Intergenic
1115093873 14:29611387-29611409 CAGTGTATGAGCCCAGATGATGG - Intronic
1115449248 14:33527212-33527234 GAGGGCATGAGCCCTTGTCAGGG + Intronic
1117939340 14:60944644-60944666 AAAGGTATGTGGCCTGTTCAGGG + Intronic
1117939480 14:60946720-60946742 AAAGGTATGTGGCCTGTTCAGGG - Intronic
1118317933 14:64737084-64737106 AAGGGCATGAGGCCTGTGCATGG - Intronic
1118999301 14:70866776-70866798 CAGGGTAGGAACCCTGTACAGGG + Intergenic
1119332087 14:73802520-73802542 TAGGGTATGAGCCCTGTTTCCGG + Intergenic
1121737369 14:96227984-96228006 CAGGGAACAAGCCCTGTGCAGGG - Intronic
1122048529 14:99039921-99039943 CAGGGTATGAGCACTGGACGGGG - Intergenic
1123839210 15:24229557-24229579 CAGGGTAACAGCAATGTTCAGGG - Intergenic
1125520771 15:40346792-40346814 CAGGGTAGGTGCTCTGTTCATGG - Intergenic
1127555720 15:60085460-60085482 CAGGGGAAGAGCCCTTTACATGG - Intergenic
1129755708 15:78097848-78097870 CAGGGTCTGAGCTCTGTGCCTGG - Intronic
1131695960 15:94877734-94877756 CAGGTTAGGAACCCTGTACAAGG + Intergenic
1134079326 16:11314266-11314288 CAGGGTAAGAGGCCTGGTCGGGG + Intronic
1135036390 16:19081434-19081456 CAGGTTAGGAGCCCTGTACAAGG - Intergenic
1139204899 16:65018228-65018250 CAGGTTAGGAACCCTGTGCAGGG + Intronic
1142033080 16:87848017-87848039 CGGGGTCTGAGCCCTGCCCAGGG + Intronic
1142669430 17:1480898-1480920 CAGGGCATGAGGCCGGGTCACGG + Intronic
1143962077 17:10729560-10729582 CAGGGTGTGAGCCCTGGTATGGG + Intronic
1146301246 17:31691497-31691519 CAGAGTGTGAGCCCTGTGCTTGG - Intergenic
1147125026 17:38361342-38361364 CAGGTTAAGAGCCCTTTTCTTGG + Intronic
1148842075 17:50505487-50505509 CAGGGGGTGAGACCTGTCCAAGG + Intergenic
1149094639 17:52825790-52825812 CAGGTCAGGAGCCCTGTACAGGG + Intergenic
1150807724 17:68332334-68332356 CAGGGTAACAGCGATGTTCAGGG - Intronic
1153806754 18:8715203-8715225 CAGGCTATGAAAACTGTTCAAGG - Intronic
1153951637 18:10062594-10062616 CAGGGTGTAAGCCCTGTGCAGGG + Intergenic
1157113967 18:44845867-44845889 CAGGTTGCGAGCCCTGTTGATGG + Intronic
1157127852 18:44974201-44974223 CTGTGTATGGGCCCTGGTCATGG + Intronic
1158527558 18:58228732-58228754 CAGGGTGTGAGCCCCCTCCAAGG + Intronic
1159686165 18:71423640-71423662 CAGGGTAACAGCAATGTTCAGGG + Intergenic
1160249271 18:77186727-77186749 CAGGATAACAGCCATGTTCAGGG - Intergenic
1166412018 19:42561713-42561735 CAGGGGATGCGCCCTCTGCAGGG + Intergenic
1167947923 19:53004083-53004105 CTGGGTACGATCCCTGTTCCAGG - Intergenic
925257488 2:2502664-2502686 CTGGGTATGAGCCTTGTGTACGG - Intergenic
925427633 2:3763475-3763497 CTGGGTATGAGCCAGGGTCAAGG - Intronic
926927331 2:18000960-18000982 CAGGTTAGGAACCCTGTGCAGGG - Intronic
929466472 2:42149167-42149189 CAGGGAATGGGTCCTGTTCAGGG + Intergenic
932736625 2:74259112-74259134 GAGGGTTTCAGCCCAGTTCATGG + Intronic
932893411 2:75615360-75615382 CAGAGTATGAGCCCTTTTGAGGG + Intergenic
936146138 2:109981623-109981645 CATGCTATGGGCCCTGGTCATGG + Intergenic
936198552 2:110389856-110389878 CATGCTATGGGCCCTGGTCATGG - Intergenic
937066944 2:119024499-119024521 CAGAGTGTGAGCCCTCTTGAGGG - Intergenic
937469997 2:122166493-122166515 CAGGGGCTGAGCCCTGTTCTAGG - Intergenic
937579915 2:123472710-123472732 CAGGTCAGGAACCCTGTTCAGGG - Intergenic
938858522 2:135341547-135341569 CAGGGTAACAGCGATGTTCAGGG + Intronic
940052812 2:149481952-149481974 CAGGGTCTGAGCCCTGATCTGGG - Intergenic
940305638 2:152223163-152223185 CAGGATATGATCATTGTTCAAGG - Intergenic
941199877 2:162495291-162495313 CAGGTTAGGAACCCTGTACAGGG - Intronic
942171375 2:173292705-173292727 CAGGTTAGGAACCCTGTACAGGG + Intergenic
943258646 2:185629776-185629798 CAGGTCAGGAGCCCTGTACAGGG - Intergenic
945163726 2:206920250-206920272 CAAGGTATCAGGCCTGTTGAGGG + Intergenic
945869567 2:215212420-215212442 CAGGTCATGAACCCTGTGCAGGG - Intergenic
947544017 2:230998149-230998171 CAGGGAGTGTGGCCTGTTCAAGG - Intronic
1168772965 20:427881-427903 CAGGGTCAGAGCTCGGTTCAGGG - Intronic
1170923450 20:20701175-20701197 CAGGTTAAGAACCTTGTTCAAGG - Intronic
1170940422 20:20844134-20844156 CAGGGGAGCAGCCCAGTTCAAGG - Intergenic
1171071132 20:22069755-22069777 GATGGTATGTGGCCTGTTCATGG - Intergenic
1172427615 20:34865752-34865774 GAGGGTCTCAGCCCTGGTCAAGG - Intronic
1175523647 20:59618842-59618864 CAGGCTCTCAGCCCTGCTCAGGG - Intronic
1175632784 20:60556235-60556257 GAGGGTTTGAGCCATGGTCAGGG + Intergenic
1177413150 21:20757511-20757533 CAGGGCATTAACCTTGTTCAAGG - Intergenic
1180094355 21:45549075-45549097 CAGGGTACAACCCCTGTGCATGG - Intergenic
1181493986 22:23277709-23277731 CCAGGTATGAGCCCTCTGCAGGG + Intronic
1182872125 22:33657128-33657150 AAGGGTCTGAGCCCCCTTCATGG - Intronic
1182952429 22:34390320-34390342 CAGGGTTTGAGCTCTGCTGAGGG - Intergenic
1183361167 22:37384258-37384280 CAGGGAGTGGGCCCTGCTCACGG - Intronic
1184244234 22:43227808-43227830 CAGGGAATGAGCACTGCTCCAGG + Intronic
1184917800 22:47584507-47584529 CAGGTTAGGAACCCTGTACAGGG - Intergenic
950638284 3:14331412-14331434 CATGGTAAGGGCCCTGTACAGGG - Intergenic
950654521 3:14428276-14428298 CAGTGTTTGAGCCCTGGTCTTGG + Intronic
952502148 3:33973605-33973627 CAGGATTTGAGCCCTGGTTAGGG + Intergenic
956145054 3:66183795-66183817 CAGGGTAAGAGCCAAGTTCAGGG - Intronic
960784496 3:121357034-121357056 TTGGGTATGATCCCTGTTCCAGG - Intronic
963383685 3:144563421-144563443 CAGGGTCTGTGCTCTGTTCTGGG + Intergenic
968626974 4:1630117-1630139 GAGGGTATGAGTCCTGGACAAGG + Intronic
971154951 4:24071787-24071809 CAGGGTCTGGGACCTGTCCAAGG - Intergenic
971802105 4:31305736-31305758 CAGGGTGGGAACCCTGTGCACGG + Intergenic
971899823 4:32645648-32645670 CAGGATAACAGCCATGTTCAGGG + Intergenic
975051586 4:69871924-69871946 CAGGTCAGGAGCCCTGTACAGGG - Intergenic
975587476 4:75964990-75965012 CAGGGTAACAGCGATGTTCAGGG + Intronic
975746954 4:77484306-77484328 CATGGTAATTGCCCTGTTCAAGG + Intergenic
976598296 4:86914751-86914773 CTGGGTATGATCCCTGTTCCAGG + Intronic
976917737 4:90398809-90398831 CATGGTATGTGCACTATTCATGG + Intronic
978019679 4:103792198-103792220 CAGGTTAGGAACCCTGTGCAGGG - Intergenic
980642789 4:135601498-135601520 CAGGTTAGGAACCCTGTGCAGGG - Intergenic
983915163 4:173283678-173283700 CAGGTTAGGAACCCTGTACAGGG + Intronic
985167268 4:187110011-187110033 CAGGGAATGTGCACTCTTCACGG - Intergenic
985489825 5:172610-172632 CAGGGGAGGAGCCCTGCTCAGGG - Intronic
986684596 5:10265357-10265379 CTGTGTATGAGCTGTGTTCAGGG - Exonic
987780272 5:22424628-22424650 CATGGTATGTTCCCTCTTCACGG + Intronic
989159755 5:38379025-38379047 CAGGCTCTGAGCTCTGTTCTGGG + Intronic
989281934 5:39654665-39654687 CAGGTTAGGAACCCTGTGCAGGG - Intergenic
994160370 5:96550067-96550089 CAGCGTATGAGCTCTGATAATGG + Intronic
995118645 5:108511560-108511582 CAGAGTATGACCACTCTTCATGG - Intergenic
995320572 5:110829357-110829379 CAGGTTAGGAACCCTGTACAGGG - Intergenic
996038651 5:118786489-118786511 CAGGGTATGAGCCCAGTCAGGGG + Intergenic
996324022 5:122252286-122252308 CAGCGTATGAGCTCTGCTAAGGG - Intergenic
998441264 5:142164346-142164368 AGGGGTATGAGCCCACTTCATGG - Intergenic
1001199837 5:169706024-169706046 CAGGGACTGAGCCCAGTTCTAGG - Intronic
1001287237 5:170432723-170432745 TAGGGAAAGAGCCCGGTTCAAGG - Intronic
1004132482 6:12933815-12933837 CAGGGTATGAGCCCTGTTCAAGG + Intronic
1004243288 6:13947692-13947714 CAGGTCAGGAGCCCTGTACAAGG + Intronic
1005543547 6:26838558-26838580 CATGGTATGAGACCAGGTCAGGG + Intergenic
1005900656 6:30214027-30214049 AAGGGTCTGGGCCCAGTTCAGGG + Intergenic
1006797406 6:36740597-36740619 CAGGGTCTGTGCTTTGTTCATGG + Intergenic
1010975876 6:82313122-82313144 CAAGGTCTGAGCCCTGTGCATGG + Intergenic
1011696903 6:89921264-89921286 CAGGCGAAGGGCCCTGTTCAGGG + Intergenic
1012594810 6:101027130-101027152 CAGGTTAGGAACCCTGTACAAGG - Intergenic
1014119930 6:117712932-117712954 CAGGATAACAGCCATGTTCAGGG - Intergenic
1014330961 6:120062542-120062564 CAGAGTATGGGCCTTGTTCATGG + Intergenic
1014844351 6:126257800-126257822 CAGGGGAAGAGACCTGCTCATGG + Intergenic
1015983574 6:138863570-138863592 CAGGGTATGAACGCTGTTGCTGG + Intronic
1017545924 6:155450641-155450663 CAGGATATGAGTCCTGGGCATGG + Intronic
1020350346 7:7212248-7212270 CAGGTTAGGAGCCCTGTGCGGGG + Intronic
1020738519 7:11983786-11983808 CAGGATAGCAGCCATGTTCAGGG - Intergenic
1021000693 7:15327143-15327165 CAGGTTATGATGCCTGTTCTGGG - Intronic
1022493691 7:30839855-30839877 CTGGGTATAAGCCATGTTCTAGG - Intronic
1023782281 7:43668173-43668195 CAGGTTAAGATCTCTGTTCATGG - Intronic
1024296507 7:47847361-47847383 CAGGGGGTGTGGCCTGTTCAGGG - Intronic
1024398174 7:48893024-48893046 CAGGTTAGGAACCCTGTACAGGG - Intergenic
1024509295 7:50190555-50190577 CAGTGTGTGAGCCCTCTTGATGG + Intergenic
1024642315 7:51340255-51340277 TAGGGTATCAGCCCTGTACCAGG - Intergenic
1025741352 7:64199141-64199163 CAGGTTAGGAACCCTGTACAGGG + Intronic
1026872100 7:73859128-73859150 CAGGGCCTCAGCCCTGGTCAAGG + Intergenic
1027420111 7:78010596-78010618 CAGGTTAAGAACCCTGTACAGGG - Intergenic
1028146391 7:87324316-87324338 CAGGTTAGGAACCCTGTTCGGGG + Intergenic
1032251277 7:130259996-130260018 CAGGTTAGGAACCCTGTACAGGG - Intergenic
1032285736 7:130537271-130537293 CAGGCTATGAGTCCTTTCCAGGG - Intronic
1032286499 7:130541697-130541719 CAGGCTATGAGTCCTTTCCAGGG - Intronic
1033904992 7:146191806-146191828 CAGGGTAACAGCAATGTTCAGGG - Intronic
1034231650 7:149534161-149534183 CAGGTTAGGAACCCTGTACAGGG - Intergenic
1036014830 8:4771354-4771376 CAGGCTTTGGGCCCTCTTCAGGG + Intronic
1037004405 8:13759498-13759520 CAGGCTCTGAGCCCTGCTTAGGG + Intergenic
1038786604 8:30622866-30622888 CAGGGTAACAGCAATGTTCAGGG - Intronic
1039426797 8:37493067-37493089 CGGGGAAAGAGCCCTGGTCAGGG - Intergenic
1039776090 8:40738315-40738337 CAGGGTCTGAACTTTGTTCAAGG - Intronic
1041911999 8:63098878-63098900 CAGGTTAGGAACCCTGTACAGGG - Intergenic
1042474440 8:69231192-69231214 CAGGGTCTAGGCCCTTTTCATGG - Intergenic
1042709287 8:71697276-71697298 CAGGGTAACAGCAATGTTCAGGG - Intergenic
1046984669 8:120374140-120374162 CAAGGTAGGTGCCGTGTTCAGGG + Intergenic
1048686822 8:136913261-136913283 CAGGTTAGGAACCCTGTACAAGG + Intergenic
1049573676 8:143380994-143381016 CAGGGTAGGAGGCCAGTGCAGGG - Intronic
1051145558 9:14023613-14023635 TAGGGTATTTGACCTGTTCAGGG - Intergenic
1051742544 9:20265691-20265713 CAGGGTAACAGCAATGTTCAGGG + Intergenic
1053384958 9:37679792-37679814 CAGGGAAAGAGCACTGTGCAGGG - Intronic
1055282565 9:74691252-74691274 AATTGAATGAGCCCTGTTCAGGG + Exonic
1057732344 9:97621407-97621429 CATGGTAACAGCCATGTTCAGGG + Intronic
1059539772 9:115118592-115118614 CAGGGACTGAGCCCAGTTCCTGG + Intergenic
1059705719 9:116821505-116821527 CTGGCTAGGAGCCCTTTTCATGG - Intronic
1061381438 9:130260979-130261001 CAGGGCATGAGCCCTGTCCAGGG + Intergenic
1062495402 9:136829164-136829186 CTGGGTAGGAGGCTTGTTCAGGG + Intronic
1062530365 9:136996944-136996966 CAGGGTCTGAGCTGGGTTCACGG - Intergenic
1185458632 X:323260-323282 TAGGGTATGTGCCCCCTTCAGGG - Intergenic
1187355579 X:18567486-18567508 CTTGGTCTGAGCCATGTTCAAGG + Intronic
1190152836 X:47962446-47962468 CAGGGTAACAGCGATGTTCAGGG - Intronic
1190382534 X:49853747-49853769 GAGGGTAGGAGCCGTGGTCACGG - Intergenic
1190723036 X:53166868-53166890 CAGGTTAGGAACCCTGTGCAGGG - Intergenic
1191069670 X:56386597-56386619 CAGGTTAGGAACCCTGTACAGGG + Intergenic
1191858878 X:65649743-65649765 CAAAGTATGAGCCCAGCTCAAGG - Intronic
1194200325 X:90947011-90947033 CAGGTAAGGAGCCCTGTACAGGG - Intergenic
1195137943 X:101929924-101929946 GAGGGCATGGGGCCTGTTCAGGG + Intronic
1196758075 X:119175595-119175617 CAGGGAATTAGGCCTGTTAATGG - Intergenic
1198629477 X:138618653-138618675 CAGGGTTTGGGCCGTGTGCAGGG - Intergenic
1201343051 Y:12954454-12954476 CAGGGTAACAGCGATGTTCAGGG - Intergenic
1201923846 Y:19263487-19263509 CAGGTTAGGATCCCTGTACAAGG + Intergenic