ID: 1004133227

View in Genome Browser
Species Human (GRCh38)
Location 6:12941324-12941346
Sequence TGCTTGGCCCACTGCAGTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004133224_1004133227 7 Left 1004133224 6:12941294-12941316 CCTACATCACATATTCTGTGTCA 0: 1
1: 0
2: 0
3: 9
4: 188
Right 1004133227 6:12941324-12941346 TGCTTGGCCCACTGCAGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004133227 Original CRISPR TGCTTGGCCCACTGCAGTTG TGG Intronic
No off target data available for this crispr