ID: 1004135596

View in Genome Browser
Species Human (GRCh38)
Location 6:12962973-12962995
Sequence GTGTGTGCATGCATGTGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 981
Summary {0: 1, 1: 1, 2: 29, 3: 164, 4: 786}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004135596_1004135597 20 Left 1004135596 6:12962973-12962995 CCTCAGCACATGCATGCACACAC 0: 1
1: 1
2: 29
3: 164
4: 786
Right 1004135597 6:12963016-12963038 ATATATTTTTGAAACAGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004135596 Original CRISPR GTGTGTGCATGCATGTGCTG AGG (reversed) Intronic
900137404 1:1123861-1123883 GTGTGTGCAGGTGTGTGCTCAGG - Intergenic
900137428 1:1124138-1124160 GTGTGTGCAGGTGTGTGCTCAGG - Intergenic
900406151 1:2493921-2493943 GTGTGTGCAGGGGCGTGCTGTGG + Intronic
900502861 1:3015145-3015167 CTCTGTGCACACATGTGCTGGGG - Intergenic
900544629 1:3221704-3221726 GTGTGTGCATGCGTGTACATGGG - Intronic
900581096 1:3409881-3409903 TTGTGTGCATGTGTGTGGTGTGG + Intronic
900581101 1:3409923-3409945 GTATGTGCATGTGTGTGGTGTGG + Intronic
900593554 1:3470280-3470302 GGGTGTGTATGCATGGGCAGGGG + Intronic
900646414 1:3710761-3710783 GTGTGTGCATGCATGTGGGAGGG - Intronic
901150500 1:7098143-7098165 GCGTGTGTGTGCATGTGCAGGGG + Intronic
901280412 1:8029723-8029745 GTGTGTACATGCATGCGTTTTGG - Intergenic
901762661 1:11480662-11480684 GTGTGTGCACGCGCGCGCTGGGG - Intronic
902066896 1:13695971-13695993 GTGCGTGCATGCATGCTCTGGGG + Intergenic
902391918 1:16111903-16111925 GTGTGTGTGTGCACGTGGTGGGG - Intergenic
903681864 1:25102775-25102797 GAGTGCCCATGCAAGTGCTGGGG - Intergenic
904245650 1:29185977-29185999 GTGTGTGTGTGCATGTGATGGGG - Intergenic
904499789 1:30907465-30907487 GCGTGTGCATGCAGGTGCATGGG - Intronic
904601705 1:31676475-31676497 CTGTGTACATGAATGTTCTGGGG - Intronic
904620675 1:31773204-31773226 GCGTGTGCATGCATCTGCTCAGG - Intergenic
904852304 1:33468244-33468266 CTATGTGCATGTATGTTCTGGGG - Intergenic
905110348 1:35590238-35590260 ATGTGTGCATGCATGTGCAATGG + Intronic
905296136 1:36955537-36955559 GTGTGTGCATGCGTGTTCTCCGG - Intronic
905480160 1:38256302-38256324 GTGTTTGCCTGCAGGAGCTGAGG - Intergenic
905676408 1:39828461-39828483 GTGTGTGTGTGTGTGTGCTGAGG - Intergenic
906733143 1:48100447-48100469 GTGTGTGCATGTGTGTAGTGGGG + Intergenic
906904105 1:49869473-49869495 GTTTCTGCATGGATTTGCTGAGG - Intronic
907251562 1:53142997-53143019 GTGGGTGGGTGCATGTGCTGCGG + Intergenic
907311067 1:53539397-53539419 GGGTGTGCATTCATGTGCTGTGG - Intronic
907387867 1:54137699-54137721 GTGTGTGCATGCGGGGGCAGGGG + Intronic
907460166 1:54601147-54601169 GTGTGTGCATGCATGTGTGTGGG + Intronic
908329089 1:63052650-63052672 GTGTGTGTGTGTATGTGGTGGGG + Intergenic
909694253 1:78448188-78448210 TTGTGTTCATGCATCTGGTGAGG + Intronic
910063445 1:83122096-83122118 GTGCGCGCATGCGTGTGCAGTGG + Intergenic
910425990 1:87120550-87120572 GTGTGTCCATGCATGCACAGAGG + Intronic
911102400 1:94104942-94104964 GTGTGTGTGTGCGTGTGTTGGGG - Intronic
911546776 1:99226673-99226695 GTGTGTGTGTCCATGTGTTGAGG - Intergenic
911579600 1:99619647-99619669 GTGTGGCCATGCTTGTGATGTGG - Intergenic
912491810 1:110066595-110066617 CTGTGTGTATGCATGTGGTGGGG - Intronic
912750861 1:112286224-112286246 GTGTTTGCATGCACGTGGAGTGG + Intergenic
913264056 1:117027190-117027212 GTGTGTATATGTATGTGCAGCGG - Intronic
915044922 1:153004248-153004270 GTGTGTGTATGTGTGTGGTGGGG - Intergenic
915609790 1:156982520-156982542 CTGTGTGCATGTGTGTGTTGGGG - Intronic
915662805 1:157417746-157417768 GTGTGTGCGTGCATGTTGGGAGG + Intergenic
916714580 1:167438525-167438547 GTGTGTTCCTGCATGTGTGGTGG - Intronic
916945493 1:169722147-169722169 GTGTGTGCGTGTGTGTGTTGGGG + Intronic
917000062 1:170347860-170347882 GTGTGTGTGTGCATGTGTTTTGG + Intergenic
917081564 1:171261306-171261328 GTGTGTGCCTGTGTGTGTTGGGG - Intronic
917287287 1:173434540-173434562 GAGAGTTCATGGATGTGCTGGGG + Intergenic
917801746 1:178577561-178577583 AGGTGTACATGCATATGCTGTGG + Intergenic
918105114 1:181410132-181410154 GTGTGCGCGTGCATGTGGTGAGG + Intergenic
919193531 1:194253920-194253942 GTGTGTGTATGTGTGTGGTGAGG - Intergenic
919981533 1:202645062-202645084 GTGTGTTCATGTGTGGGCTGGGG + Intronic
920190654 1:204191627-204191649 GGGTGTGAATAGATGTGCTGGGG + Intronic
920276532 1:204809343-204809365 GTGTGTACATGCATGTGAGATGG + Intergenic
920297705 1:204969152-204969174 GTGTGTGCATGCCCGTGCATGGG + Intronic
920440053 1:205974578-205974600 GTGTGTGTATGTATGAGGTGTGG - Intergenic
920668118 1:207981525-207981547 GTGTGTGCATGTGTGTGTAGAGG + Intergenic
921174981 1:212585802-212585824 GTGTGTGTATGCATGTAATGAGG + Intronic
921334011 1:214068068-214068090 GTGTGTGTGTGTGTGTGCTGGGG + Intergenic
921874703 1:220181393-220181415 GTGTATGCATGCATGTGTAGGGG + Intronic
921939264 1:220823271-220823293 GTGTGTGCATGCATGTGTGGGGG + Intergenic
922023165 1:221724721-221724743 GTGTGTGCATGCACATGGAGGGG + Intronic
922739720 1:228008254-228008276 GAGTGTGCATGCTTGTGGGGAGG - Intronic
922881886 1:228987228-228987250 GTGTGTGTATGCGTGTGGGGGGG - Intergenic
923301935 1:232649394-232649416 GTGTGTGTGTGTGTGTGCTGGGG - Intergenic
923316369 1:232784181-232784203 GTGGGGGCATGCATGTGTTTGGG - Intergenic
923350926 1:233105964-233105986 GTGTGTTTCTGCATGTGTTGGGG + Intronic
923377949 1:233384711-233384733 GTGTTTGCATGTGTGTGTTGGGG + Exonic
923550874 1:234962027-234962049 GTGTGTGCATGGATGCTATGTGG - Intergenic
923556240 1:235002873-235002895 CTGTGTGCTGCCATGTGCTGTGG - Intergenic
924027379 1:239848867-239848889 CTGTATTCATGTATGTGCTGTGG - Intronic
1062789994 10:297231-297253 GTGTGTGTGTGTATGTGGTGGGG - Intronic
1062794861 10:337095-337117 GTGTGTGCGTGTGTGTGTTGTGG + Intronic
1062838872 10:654076-654098 GCCTGTGCGTGCATCTGCTGTGG - Intronic
1062942718 10:1436152-1436174 GTGTGTGCATGCTTGTGTGTGGG + Intronic
1062968133 10:1626010-1626032 CTGTGTCCATGCAGGAGCTGAGG - Intronic
1063062495 10:2571077-2571099 GTGTGTGAGAGCATGCGCTGTGG + Intergenic
1063382103 10:5591895-5591917 GTGTGCGCGTGCACGTGCAGAGG - Intergenic
1063416240 10:5874702-5874724 GTTTCTGCATGGATGTTCTGAGG - Intronic
1064088617 10:12364641-12364663 CTCTGTGCATGCATGTGTTATGG + Intronic
1064342286 10:14498332-14498354 GTGTGTTCATGCAAGTGCACGGG + Intergenic
1065313850 10:24442684-24442706 GTGTATGCATGCATATTTTGGGG + Intronic
1065491372 10:26284992-26285014 GTGTGAGCTTGCATGGCCTGAGG + Intronic
1065962318 10:30743716-30743738 CTGTGTGCATGCATGTGTGCTGG - Intergenic
1066330958 10:34422072-34422094 GGGTGTCCCTGGATGTGCTGTGG - Intronic
1066628102 10:37430381-37430403 GTGTGTGCATGCGTGTGTGCAGG + Intergenic
1067061295 10:43079170-43079192 GAGTGTGCATGTGTGAGCTGTGG - Intronic
1067438173 10:46293464-46293486 GTGTGTGTATGCATGTGTGTGGG + Intronic
1067442556 10:46317706-46317728 GTGTGTGTGTGCATGTGTTTTGG - Intronic
1068493463 10:57754453-57754475 GTGTGTGCATGCATGTCATAGGG + Intergenic
1068759484 10:60691867-60691889 GTATATGCATGCATGTGCTTTGG - Intronic
1068788259 10:61001082-61001104 GTGTGTGTGTGTGTGTGCTGGGG + Intronic
1068919406 10:62466402-62466424 GTGTGTGAATGCATGAGCAGGGG - Intronic
1069304075 10:66946760-66946782 GTGTGTGCCTGGGTGTGGTGGGG - Intronic
1069832237 10:71288464-71288486 GTGTATGCATGCATGTGTGTTGG + Intronic
1070802688 10:79252723-79252745 GTGTGTGCAGGCATCTGCTGGGG + Intronic
1070918090 10:80167675-80167697 ATGTGTGCTCACATGTGCTGTGG - Intronic
1070975154 10:80600537-80600559 GTGTGTGTGTGTGTGTGCTGGGG + Intronic
1071085667 10:81866114-81866136 GTTTGTGCATGCTTGTGCTTGGG - Intergenic
1071771282 10:88731415-88731437 GTGTGTGTGTGTATGTTCTGGGG + Intronic
1071802705 10:89082124-89082146 ATGTGTACATGCATTTGTTGGGG - Intergenic
1072107625 10:92289910-92289932 GTGTGTGTATGTGTGTGGTGGGG + Intronic
1072798728 10:98376837-98376859 GTGTGTGTTTGTGTGTGCTGTGG + Intergenic
1073050671 10:100665117-100665139 GTGCATGCATGCATGCCCTGTGG + Intergenic
1073082670 10:100869728-100869750 GTGTGTGCATGCATGTGTGTAGG + Intergenic
1073337139 10:102718285-102718307 CTGTGTGTATGTGTGTGCTGAGG + Intronic
1073488413 10:103836639-103836661 GTGTGTGCACTCGTGTGTTGGGG - Intronic
1073586966 10:104719838-104719860 GTGTGTGAATGTATGTGTTGGGG + Intronic
1073964465 10:108972773-108972795 GTGTGTGTGTGCATGTGTTTTGG + Intergenic
1073973387 10:109071411-109071433 GTGTGTGCATGCATGTATAAAGG + Intergenic
1074369483 10:112888249-112888271 GTGTGTGTGTCCATGTGCTGTGG + Intergenic
1074465580 10:113679043-113679065 GTGTGTGTGTGCGTATGCTGTGG + Intergenic
1074509087 10:114096900-114096922 ATGTGTGTGTGCATGTGTTGGGG + Intergenic
1074542956 10:114380646-114380668 CTCTGTCCATTCATGTGCTGTGG - Intronic
1074560304 10:114529683-114529705 TCGTGTGCATGCATGTGCACAGG - Intronic
1074707501 10:116148112-116148134 GTGTGTGCATGTGTGTGGGGTGG + Intronic
1075316520 10:121457852-121457874 GTGTGTGCAGGTATATGCTGAGG - Intergenic
1075427148 10:122350706-122350728 GTGTGGTCATGTCTGTGCTGGGG - Intergenic
1075476926 10:122743979-122744001 GTGTGCACATGCACGTGCTGCGG - Intergenic
1075481843 10:122788897-122788919 TTGTATGCATGCAGATGCTGGGG + Intergenic
1075654870 10:124154554-124154576 GTGTGGGCATGCGTGTGTGGGGG - Intergenic
1075654938 10:124155074-124155096 GAGTGTGCATGCATGTGTGGGGG - Intergenic
1075678783 10:124317691-124317713 GTGTGTGTATACATATGCTTGGG + Intergenic
1075953442 10:126502045-126502067 GTGTGTGCGTGTGTGTGGTGTGG - Intronic
1075997709 10:126891982-126892004 GTGTGTGCATGCTTTAGCTGGGG - Intergenic
1076281355 10:129249462-129249484 GTGTGTGCTTGCATGTGTGTGGG + Intergenic
1076778843 10:132712922-132712944 GTGTGTGCATGCATGGGTGTGGG + Intronic
1076867904 10:133177470-133177492 ATGTGTGCATGCATGTAGTATGG + Intronic
1076867913 10:133177699-133177721 GTGTGTCCATGCATGTGGTATGG + Intronic
1076884373 10:133255007-133255029 GTGTGTGTCTACATGTGGTGTGG - Intergenic
1077219405 11:1408825-1408847 GTGTGTGTGTGGCTGTGCTGGGG + Intronic
1077219421 11:1408980-1409002 GTGTGTGTATGTCTGTGCAGGGG + Intronic
1077320713 11:1939825-1939847 GTGTGTGTGTGTATGTGTTGTGG - Intergenic
1077383177 11:2256995-2257017 GTGTGTGCATGCATATGTGCAGG + Intergenic
1077531284 11:3096756-3096778 GTGGGTGCATTGCTGTGCTGTGG + Intronic
1078063174 11:8061349-8061371 GTGTGTGGGGGCGTGTGCTGTGG + Intronic
1078065928 11:8079652-8079674 GTGTGTGCATGCATGTGTGTAGG + Intronic
1078364026 11:10692180-10692202 GTGTGTGCATGCATATTTGGTGG - Intronic
1078606923 11:12785163-12785185 GTGTGGGCCTGCATGTGCTCTGG + Intronic
1078653108 11:13214234-13214256 GTGTGCACATGCTTGTGTTGGGG - Intergenic
1078918586 11:15804947-15804969 GTATGTGCATGTGTGTGTTGGGG - Intergenic
1078930306 11:15907290-15907312 GTGTGTGCATGCTTGTGTATAGG - Intergenic
1079733480 11:23965127-23965149 GTGCATGCATGCATGTGCGGTGG - Intergenic
1080018556 11:27533851-27533873 GTGTGTGCATGCATGTAATGAGG + Intergenic
1080884201 11:36350335-36350357 GTGTATGCATGTGTGTGCCGGGG + Intronic
1080999416 11:37650038-37650060 GTGTGTGTATGCATGTGTAGGGG - Intergenic
1081554639 11:44147129-44147151 GGGTGTACAAGTATGTGCTGGGG - Intronic
1081644459 11:44779974-44779996 GTGTGTGCAGGTATGTGCAAAGG - Intronic
1081677262 11:44977665-44977687 GTGTGTGCATGTGTGTGATCTGG - Intergenic
1081715273 11:45245800-45245822 GTGTGTGGGTACATGGGCTGAGG - Intronic
1082223693 11:49674942-49674964 GTGTGTGCATGAGTGTGTTTGGG - Intergenic
1082281571 11:50276339-50276361 GTGTGTGCATGTAAATGCTGGGG + Intergenic
1082725729 11:56733937-56733959 GTGTGTGCATATATGTGTTTAGG - Intergenic
1082789846 11:57339494-57339516 GTGTGTGCTTGCAGGCGGTGGGG - Intronic
1083178661 11:60970589-60970611 GTGGGTGTATGCATTTGATGCGG - Intergenic
1083736948 11:64686791-64686813 GTGTGTGCATGTATGTCCATAGG + Intronic
1084564051 11:69919702-69919724 CTGTGTGTATGCATGTGTGGTGG - Intergenic
1084647647 11:70468429-70468451 CTGTCTGCATGCAGCTGCTGTGG + Intronic
1084944684 11:72632265-72632287 GTGTGTGGAGGCTTGTGGTGTGG + Intronic
1085032732 11:73282463-73282485 GTTTGTGTTTGCAGGTGCTGAGG - Intronic
1085311015 11:75516653-75516675 GTTGGTGCATGCACTTGCTGGGG - Intronic
1085595093 11:77802056-77802078 GTGAATGCATTCATGTGCTGGGG + Intronic
1085738149 11:79057247-79057269 GTGTGTGCAGGCCAGTGCAGGGG - Intronic
1085761026 11:79241726-79241748 GTGTGTGCATGTGTATGGTGGGG + Intronic
1085784175 11:79437238-79437260 GTGTGTGTGTGCATGTGTTGGGG - Intronic
1085926178 11:81024662-81024684 TTGTGTGCATGCGTGTGGTGGGG + Intergenic
1086158987 11:83699926-83699948 GTGTGTGTGTGCATGTGTGGTGG - Intronic
1086625361 11:88944320-88944342 GTGTGTGCATGAGTGTGTTTGGG + Intronic
1086782356 11:90922994-90923016 GTGTGTGTGTGAATGTGGTGTGG + Intergenic
1087024167 11:93633453-93633475 GTGTGTGTGTGTATGTGTTGGGG - Intergenic
1087072355 11:94093674-94093696 ATGTGTGCATGCACATGCTTGGG - Intronic
1087161471 11:94951849-94951871 GTATGTGCATGTATGTGCAGGGG + Intergenic
1088021111 11:105120672-105120694 GTGTGTGTATGTGTGTGTTGGGG - Intergenic
1088214553 11:107493341-107493363 GTGTGTGTATGTGTGTGCAGAGG - Intergenic
1088987444 11:114922109-114922131 GTGAGTACCTGCATATGCTGAGG - Intergenic
1089153769 11:116385197-116385219 GTGTGTGCCTGCATGTGCATGGG - Intergenic
1089515466 11:119029135-119029157 TTGTGTACAGGCATGTGGTGTGG - Intronic
1089807939 11:121108274-121108296 GTGTGTGTATGTGTGTACTGGGG - Intronic
1090249665 11:125242474-125242496 GTGTGTGTCTGCATGTGCTGGGG + Intronic
1090553048 11:127843599-127843621 GTGTGTGCATGCCTGTGTGTGGG - Intergenic
1090975473 11:131676461-131676483 CTGTGTACATGCGTGTGCGGGGG + Intronic
1091061742 11:132469845-132469867 GTGTGTGTATGTATGTGTGGGGG + Intronic
1091107633 11:132937620-132937642 GTGTGTGTGTGTGTGTGCTGGGG + Intronic
1091186141 11:133649569-133649591 ACGTGTGCTTGCCTGTGCTGCGG - Intergenic
1091342910 11:134833060-134833082 GGGAGGCCATGCATGTGCTGAGG + Intergenic
1091394120 12:143180-143202 GTGGCTGCAAGCCTGTGCTGAGG + Intronic
1091713775 12:2761535-2761557 GTGTGTGCATGTGTGTGTTGGGG - Intergenic
1091993986 12:4978527-4978549 GTGTGAGCATGTTTGTGGTGGGG + Intergenic
1092240234 12:6831595-6831617 GTGTGTGTATGCATGAGTTTGGG - Intronic
1092937076 12:13374092-13374114 GTGTGTGCATGTGTGTGTTGGGG + Intronic
1095211813 12:39503069-39503091 GTGTGTGTATGTGTGTGGTGGGG - Intergenic
1095481552 12:42641398-42641420 GGCTGTGCATGTGTGTGCTGGGG - Intergenic
1096179286 12:49541765-49541787 GTAGGTGCATGTAGGTGCTGTGG + Intronic
1096516021 12:52155730-52155752 GTATGTGTGTGCCTGTGCTGGGG + Intergenic
1097636085 12:62123767-62123789 GTGTGTGTATGTGTGTGGTGGGG - Intronic
1098195820 12:68001072-68001094 GTGTGTGTATGTGTGTGCTCTGG - Intergenic
1098919180 12:76287244-76287266 GTGTGTGCGTGTGTGTGCAGAGG + Intergenic
1100175105 12:92021477-92021499 GTGTGTGTTTGCATGTGGGGGGG + Intronic
1100813257 12:98361312-98361334 GTGTGTTCACACATGTGGTGGGG + Intergenic
1100813270 12:98361471-98361493 GTGTGTTCATGCATGTGGTGGGG + Intergenic
1101576608 12:106002855-106002877 GTGTGTGTATGTGTGTGATGAGG - Intergenic
1101584692 12:106075054-106075076 GTGAGTGTGTGCATGTGCAGCGG - Intronic
1102044079 12:109818795-109818817 GTGTGTGCATGTGTGTTTTGGGG - Intronic
1102533044 12:113560950-113560972 GTGCGTGCATGCATGTAGAGTGG - Intergenic
1103237974 12:119389773-119389795 GTGTGTGCATGCCTGTGTGTTGG - Intronic
1103730383 12:123023311-123023333 GTGTGTGCATGCAGGAGCCAAGG + Intronic
1103961731 12:124613177-124613199 GGGTGTGGATACGTGTGCTGTGG - Intergenic
1104407629 12:128531604-128531626 GTATGTGCATGCATGTGAGCAGG - Intronic
1104916545 12:132268264-132268286 GTGTGTGCGTGCGTGTGTAGGGG - Intronic
1104919687 12:132284140-132284162 GCGTGTGCGTGCATGTGCGTGGG - Intronic
1105014766 12:132779752-132779774 GGGTGTCCATGCAAGGGCTGTGG - Intronic
1105638179 13:22236370-22236392 GTGTGTGTATGCATGTGTGCAGG + Intergenic
1105969910 13:25419083-25419105 GTGTGTGCACGCACGTGTTGAGG + Intronic
1106132300 13:26950658-26950680 GTGTGTGCGTGTGTGTGCTGTGG - Intergenic
1106585746 13:31054880-31054902 GTGTGTGTATGCATGTGCACAGG - Intergenic
1106594862 13:31127353-31127375 GTGTGTGCATGCATATGCATGGG + Intergenic
1106843045 13:33707391-33707413 GGGTGTGCTGGCATGTGTTGTGG - Intergenic
1107045047 13:35984882-35984904 GTGTGTGCATGCGCACGCTGGGG - Intronic
1107126214 13:36849727-36849749 GTATGTGGATGCAGGTCCTGTGG - Intronic
1107299071 13:38946655-38946677 GTGTGTCCATGCATGTGGAAGGG - Intergenic
1107301431 13:38970074-38970096 GTGCAAGCATGCATGTGGTGGGG + Intronic
1107333267 13:39324882-39324904 GTGTGGGCATGCATGTGTGTGGG - Intergenic
1107584249 13:41826931-41826953 ATGTGTGCCTGAATGTACTGAGG + Intronic
1107657083 13:42602598-42602620 GTGTGTCTATGCATGTCTTGTGG + Intronic
1108104687 13:46996484-46996506 GTGTGTGCACCCATGTGCAGAGG + Intergenic
1108885912 13:55181063-55181085 GTGTGTGTGTGTATGTGTTGTGG - Intergenic
1109192665 13:59344290-59344312 GTGTGTGCATGTGTATGCTTTGG - Intergenic
1110441218 13:75527996-75528018 GTGTGTGTGTGTGTGTGCTGAGG - Intronic
1110500793 13:76225340-76225362 GTGTGTGTGTGCATGTGTTTAGG - Intergenic
1110885381 13:80627369-80627391 GTGTGTGTATACATGTGTGGTGG + Intergenic
1110993985 13:82081663-82081685 GTGTGTGCGTGGATGTGTGGGGG + Intergenic
1112830134 13:103439476-103439498 GTGTGTGTGTGTATGTGGTGTGG + Intergenic
1113186144 13:107687491-107687513 GTGTGTGTGTGCATGTGCACTGG - Intronic
1113392021 13:109907158-109907180 TTTTAAGCATGCATGTGCTGTGG + Intergenic
1113459918 13:110474539-110474561 GTGTGTGCATGCATGCACTCTGG - Intronic
1113766589 13:112885024-112885046 TTGTGTGCATGCATGTGTGCAGG - Exonic
1113913830 13:113858218-113858240 GTGTCTGCATGCATGTGGCTGGG + Intronic
1113947937 13:114055237-114055259 ATGCGTGCATGCATGTGCCCTGG + Intronic
1115104950 14:29749410-29749432 ATGTGTGTGTGCCTGTGCTGGGG + Intronic
1116059614 14:39905569-39905591 GTGTGTACATAAATGTGTTGGGG + Intergenic
1116183839 14:41570300-41570322 GTGTTTGTGTGCATGTGCTTTGG - Intergenic
1116319235 14:43438905-43438927 GTGTGTGTATGTATTTTCTGAGG + Intergenic
1118181037 14:63493488-63493510 GTGTGTGCGTGTGTGTGGTGGGG + Intronic
1118328643 14:64799121-64799143 GTGTGTGCATGCATGTTCATGGG + Intronic
1118607039 14:67512159-67512181 GTGTGAGAATGCATGTGTTGGGG - Intronic
1118739199 14:68726471-68726493 GTGTGTGTGTGTATGTGTTGTGG - Intronic
1119849777 14:77858944-77858966 GTGTGTGCATGCATCTGCCCTGG + Intronic
1119853545 14:77883004-77883026 GTGTGTGCACACATGTGCGAAGG - Intronic
1120435306 14:84474325-84474347 GTGTGTGTGTGCATGTGTTGTGG + Intergenic
1120653819 14:87165780-87165802 GTGTGTGTATGTGTGTGTTGGGG - Intergenic
1120709559 14:87779341-87779363 GTGTGTCTCTGCATGTGATGTGG + Intergenic
1121627608 14:95397883-95397905 GTGTATGCCTGTATGTGGTGTGG + Intergenic
1122020958 14:98837546-98837568 ATCTGTGCATGCATGGGCTCAGG + Intergenic
1122088218 14:99321358-99321380 GAGTGTGAATGCATGTGCGTGGG - Intergenic
1122544375 14:102514127-102514149 GTGTGTGCATGCGTGTGCGTGGG + Intergenic
1122792385 14:104189648-104189670 GTGTGTGCATGTATGTGTACGGG - Intergenic
1122872466 14:104646232-104646254 GAGTGTGAATACCTGTGCTGTGG - Intergenic
1122896541 14:104760339-104760361 GTGGGTGGGAGCATGTGCTGGGG + Intronic
1122986771 14:105215463-105215485 GTGTGTGTGTGCATGTGTTCTGG - Intronic
1123127081 14:105954351-105954373 GGGTGCACATGCATCTGCTGGGG - Intergenic
1124000338 15:25754086-25754108 CACTGTGCATTCATGTGCTGCGG + Intronic
1124250881 15:28105956-28105978 GTGTGTGCATGTGTGGGGTGTGG + Intergenic
1124250916 15:28106230-28106252 GTGTGTGTGTGCATGTGTCGGGG + Intergenic
1124250926 15:28106309-28106331 GTGTGTGTATGCATGTGTGTGGG + Intergenic
1124497221 15:30193798-30193820 GTGTGTTCATGTGTGGGCTGGGG + Intergenic
1124622442 15:31281779-31281801 GTCTGTGTATGCATGCACTGAGG - Intergenic
1124746353 15:32344849-32344871 GTGTGTTCATGTGTGGGCTGGGG - Intergenic
1125486269 15:40113021-40113043 GTGTGTGCACGCGTGTGCGTGGG + Intergenic
1125967789 15:43888152-43888174 GTGAGTGGATACATGTGATGGGG - Intronic
1126087325 15:45022685-45022707 GTGTGTGCTTGCATGTGAGGCGG + Intergenic
1126419531 15:48456866-48456888 GTGTGTGCGTGCATGTGTTGGGG + Intronic
1127526399 15:59796438-59796460 GTGTGTGCATGTGTGTGTTGGGG - Intergenic
1127722277 15:61715014-61715036 GTGTGTGTGTGTATGTGTTGGGG - Intergenic
1128078474 15:64842442-64842464 GTGTGTGTATGTGTGTGTTGGGG + Intronic
1128078483 15:64842501-64842523 GTGTGTGTATGTGTGTGTTGGGG + Intronic
1128222650 15:65980046-65980068 GTGTGTGTGTGCAAGTGCAGGGG + Intronic
1128591814 15:68904681-68904703 TTGTGAGTATGTATGTGCTGAGG - Intronic
1128616935 15:69117570-69117592 GTGAGTGGACGCATCTGCTGTGG + Intergenic
1128727158 15:69996723-69996745 GTGTGAGCCAGCATGTGGTGTGG - Intergenic
1128767424 15:70259697-70259719 GTGTGTGCCCGCATGTGCACGGG + Intergenic
1128999545 15:72320472-72320494 GTGTGTGCCTGTGTGTGCGGTGG - Exonic
1129707784 15:77804621-77804643 GTGTGTGCAAGGATGTGCAGGGG + Intronic
1130138440 15:81201270-81201292 GTGTGTGCGTGCATGTGTGTGGG - Intronic
1130371062 15:83285242-83285264 GTGTGTGTGTGCGTGTGCGGTGG - Intergenic
1130702473 15:86198692-86198714 GTGTATGTGTGCATGTGTTGAGG + Intronic
1131346147 15:91650321-91650343 GTGTGTGCACACATGTGCATGGG - Intergenic
1132124657 15:99212286-99212308 GTGTGTGCATGCATGTGCAATGG + Intronic
1132353329 15:101154172-101154194 GTGTGTGCATGGTTGTGTTTGGG - Intergenic
1132373505 15:101313425-101313447 GTGTGTGCCAGCCTGTGGTGAGG - Exonic
1132505933 16:308726-308748 GTGTGTGCGTGCTTGTGCTGTGG - Intronic
1132548307 16:543732-543754 GCCTGTGCATGCACGTGGTGGGG - Intronic
1132565106 16:618597-618619 GTGTGTGCAGCCATGTGCACAGG + Intronic
1132565127 16:618720-618742 GTGTGTGCAGGCATGTGCACAGG + Intronic
1132565143 16:618841-618863 GTATGTGCAGGCATGTGCACAGG + Intronic
1132565162 16:618961-618983 GTGTGTGCAGGCATTTGCACAGG + Intronic
1132565178 16:619082-619104 GTGTGTGCAGGCATGTGCACAGG + Intronic
1132565198 16:619207-619229 GTGTGTGCAGGCATGTGCACAGG + Intronic
1132565217 16:619332-619354 GTGTGTGCAGCCATGTGCACAGG + Intronic
1132691010 16:1181965-1181987 CTGTGTGCATGCGTGTGCGAGGG - Intronic
1133235461 16:4385435-4385457 GTGTGTGAATGCCTGTGAGGGGG - Intronic
1133496789 16:6326030-6326052 GTGTGTACATGCATATGCATTGG + Intronic
1134004240 16:10807223-10807245 GTGTGTGCATGTCTGTGCGTGGG + Intronic
1134373060 16:13643726-13643748 GTGTGTGCATGCCTGTGGGGAGG + Intergenic
1134518819 16:14908494-14908516 GTGTGTGTGTGTGTGTGCTGAGG + Intronic
1134706490 16:16307149-16307171 GTGTGTGTGTGTGTGTGCTGAGG + Intergenic
1134961050 16:18404975-18404997 GTGTGTGTGTGTGTGTGCTGAGG - Intergenic
1134965352 16:18487578-18487600 GTGTGTGTGTGTGTGTGCTGAGG - Intronic
1135031935 16:19045468-19045490 GTGTGTGCATGTGTGTGGTGGGG - Intronic
1135128602 16:19833091-19833113 GTGTGTGTATGTGTGTGGTGAGG + Intronic
1135142248 16:19931826-19931848 GTGTGCGCATGCATGTGGGGAGG + Intergenic
1135830028 16:25764871-25764893 GTGTGTGCATGAACTTGCTGTGG + Intronic
1136021326 16:27442214-27442236 GTGTGGGCATGCATGTGTGTGGG + Intronic
1136605723 16:31332015-31332037 GTGTGTGCATGTGTGTGCTCAGG + Exonic
1136653485 16:31693741-31693763 GTGTGTGCATGTGTGTGCTGTGG - Intergenic
1136702452 16:32156629-32156651 GTGTGTGGATTCATTTCCTGTGG - Intergenic
1136765215 16:32770859-32770881 GTGTGTGGATTCATTTCCTGTGG + Intergenic
1136802884 16:33099525-33099547 GTGTGTGGATTCATTTCCTGTGG - Intergenic
1137365224 16:47854083-47854105 GTGTGTGCGTTTGTGTGCTGGGG - Intergenic
1137400190 16:48146966-48146988 GTGTGTGCATGTGTGTGCGTGGG - Intronic
1137561069 16:49502755-49502777 GTGTGTGCATGCATATAGAGTGG - Intronic
1138119412 16:54387116-54387138 GTGAGTGCATTCCTTTGCTGTGG - Intergenic
1139007111 16:62586454-62586476 CTGTGGGCATACATGTTCTGTGG - Intergenic
1140072700 16:71665619-71665641 CTGTGTGTCTGCTTGTGCTGTGG + Intronic
1141141348 16:81498614-81498636 GTGTGTGCAGCCATGTTCTGGGG - Intronic
1141206706 16:81938530-81938552 ATGTGTGCATTCATGAGCTCAGG + Intronic
1141247997 16:82328597-82328619 ATATATGCATGCATGAGCTGTGG + Intergenic
1141492504 16:84383743-84383765 GTGTGTGTATGTGTGTGTTGGGG + Intronic
1141520944 16:84579084-84579106 GTGTGTGCATGCCTGTGTGTGGG - Intronic
1141618063 16:85221336-85221358 GTGTGTGTGTGCATGTACTTGGG - Intergenic
1141759699 16:86019825-86019847 GTGTGTGTGTGCATGTGTTCAGG - Intergenic
1141983423 16:87563912-87563934 GTGTGTTCATGTGTGTGCTGGGG + Intergenic
1141983444 16:87564208-87564230 CTGTGTGCGTGCTTGTGTTGGGG + Intergenic
1142255109 16:89010087-89010109 GTGTGTGCAGGCTTGTGCATGGG - Intergenic
1142410585 16:89913953-89913975 GTGTGTGTGCGCATGTGGTGTGG + Intronic
1203067603 16_KI270728v1_random:1033092-1033114 GTGTGTGGATTCATTTCCTGTGG + Intergenic
1142682804 17:1560416-1560438 GTGTGTGCATCCCTGGGCGGGGG - Intronic
1143107890 17:4538495-4538517 GTGTGTGCATGGATGGGAGGTGG - Exonic
1143202082 17:5120239-5120261 CTCTCTGCATGCCTGTGCTGTGG + Intronic
1143269551 17:5665649-5665671 GGGGGGGCCTGCATGTGCTGAGG - Intergenic
1143390896 17:6558629-6558651 GTGTGTGCTTGTGTGTGCTTAGG + Intergenic
1143461555 17:7107601-7107623 GTGTGTGTATGCATGTGTGGTGG - Intronic
1144777528 17:17792361-17792383 TTGTGTGCACGCATGTGCGTGGG + Intronic
1144879096 17:18421793-18421815 CTTTTTGCATGCCTGTGCTGTGG + Intergenic
1144976428 17:19141555-19141577 GTGTGCGCTTGTGTGTGCTGGGG + Intronic
1145153138 17:20522594-20522616 CTTTTTGCATGCCTGTGCTGTGG - Intergenic
1145684044 17:26637413-26637435 GTGTGTGCATGGAGGGGGTGGGG + Intergenic
1145977978 17:28995332-28995354 GTGTGTGCATGTATGTGGGGGGG + Intronic
1146241759 17:31235789-31235811 TTGTGTGTATGTGTGTGCTGAGG + Intronic
1146472573 17:33136131-33136153 GTGTTTGCATACATGTACTGGGG + Intronic
1146544265 17:33724825-33724847 GTGTGTGTGTGTATGTGTTGGGG - Intronic
1146681712 17:34813155-34813177 GTGTGTTCGTGCATGTGCACAGG - Intergenic
1147177008 17:38662227-38662249 GTGTGTGTGTGCATGTGCATAGG + Intergenic
1147339558 17:39745553-39745575 GTGTGTGTGTGTTTGTGCTGGGG + Intronic
1147382032 17:40061970-40061992 GTGTGTGTATGTGTGTGCTGGGG + Intronic
1147581477 17:41629595-41629617 CTTTCTGCATGCCTGTGCTGTGG - Intergenic
1147585525 17:41652134-41652156 GTGTGTGCATGCGTGTGTGTTGG - Intergenic
1147585528 17:41652191-41652213 GTGTGTGCATGCATGTGTGTTGG - Intergenic
1147898543 17:43768607-43768629 GTGTGTGCATGGATGTGTGTGGG - Exonic
1148550256 17:48545987-48546009 GTGTGTGCATGAGTGTGGTGGGG + Intergenic
1148784453 17:50139212-50139234 GTGCGTGCATGTGTGTGTTGAGG - Intronic
1148859214 17:50595376-50595398 GTGTGTGCGTGCCTGTGCTGAGG + Intronic
1149001875 17:51765729-51765751 GTGTGTGCATGCATGTGTTTAGG + Intronic
1149343892 17:55715234-55715256 GTATGTGCATGTTTCTGCTGAGG - Intergenic
1149506040 17:57194774-57194796 GGGTGTGCAAGGATGGGCTGTGG + Intergenic
1149548022 17:57518756-57518778 GTGCGTGCGTGCATGTGCTGGGG - Intronic
1149614583 17:57987823-57987845 GTGTGTGCGTGTGTGTGCTGGGG + Intronic
1149620340 17:58040071-58040093 GAGTGTGTATGTATGTGATGGGG + Intergenic
1149665732 17:58363705-58363727 GAGTGTGCAAAGATGTGCTGTGG - Intronic
1150292565 17:63990129-63990151 GAGTGTGTGTGCTTGTGCTGTGG - Intergenic
1150429861 17:65106430-65106452 GTGTGTGTGTGTGTGTGCTGGGG + Intergenic
1150504941 17:65689053-65689075 GTGTGTGCAGCCAGGTGCAGTGG - Intronic
1151123558 17:71820119-71820141 GTGTATGCATGCATGTCTTTGGG - Intergenic
1151429755 17:74054532-74054554 CTGTGTCCATGCATGTCCTTGGG - Intergenic
1151447617 17:74177358-74177380 GTGTGTGCATGGATGAGCACAGG + Intergenic
1151555262 17:74843292-74843314 GGGTGGGCAGGCATGGGCTGGGG + Exonic
1151713126 17:75817970-75817992 GTGTGTGCATGCATGTGAAGAGG + Intronic
1151951495 17:77356682-77356704 GAGTGTGCCTGCATGTGGGGGGG - Intronic
1151975671 17:77482481-77482503 GCGTGTGCATGCATGCGCCTGGG + Intronic
1152015665 17:77748783-77748805 GTGCGTGCAGGCATGTGGGGAGG + Intergenic
1152048121 17:77952153-77952175 GTGCATGCATGCATGTGTTGGGG - Intergenic
1152062669 17:78090130-78090152 GTGTGTGTGTGCATGTGCATAGG + Intronic
1152089428 17:78238616-78238638 GCATGTGCATGTGTGTGCTGGGG + Intronic
1152191879 17:78893071-78893093 GTGTGTGCACGCGTGTGCAGGGG + Intronic
1152191894 17:78893203-78893225 GTGTGTGCATGTGTGTGCAGGGG + Intronic
1152205211 17:78971016-78971038 GTGTGTGATTGCATGTGCACAGG - Intergenic
1152286955 17:79418313-79418335 GTGTGTGCACGCGTGTGCATGGG - Intronic
1152290904 17:79439691-79439713 GAGTGTGTGTGCATGTGCAGAGG - Intronic
1152449015 17:80364571-80364593 GTGGATCCGTGCATGTGCTGAGG - Intronic
1152470084 17:80486276-80486298 TTGTGTGTGTGCATGTGCAGGGG + Intergenic
1152850403 17:82630474-82630496 GTGTGTGTATGCAGATGATGTGG - Intronic
1153325525 18:3815400-3815422 GTGTGTGCACGGGTGTGCAGAGG - Intronic
1153327116 18:3832126-3832148 GAGTGTGCATGCATGGGTTCTGG - Intronic
1153660776 18:7324288-7324310 GTGTGTGTGTGTGTGTGCTGGGG - Intergenic
1153769054 18:8400876-8400898 ATGTGTGTGTGCATGTGTTGGGG + Intronic
1154080252 18:11249146-11249168 GTGTGTGCATGTGTGTGCAGTGG - Intergenic
1154333061 18:13445672-13445694 GTGTGTGCATGTATGTGTGTAGG + Intronic
1154351870 18:13590103-13590125 GTGTGTGACTGCATGTGCGTGGG + Intronic
1156089270 18:33445326-33445348 GTGTGTGCACACATGTGCATGGG + Intergenic
1156121639 18:33850120-33850142 CTTTGTGCTTGCATGTGCTATGG + Intergenic
1156499213 18:37546373-37546395 GTGTGCGCATACATGTGCGTGGG - Intronic
1156590574 18:38483196-38483218 AAATGTGCATGCATGTACTGTGG + Intergenic
1157262802 18:46190909-46190931 GTGTGTGTATGCATCATCTGTGG + Intronic
1157263890 18:46200086-46200108 GTGTGTGCGCGCGCGTGCTGGGG + Intronic
1157421669 18:47552991-47553013 GTGTGTGCATGTGTGTATTGAGG + Intergenic
1157735141 18:50040992-50041014 ATGTGTGCATACATGTACCGAGG - Intronic
1157791440 18:50535219-50535241 GTGTGTGTATGTGTGTGGTGTGG + Intergenic
1157791450 18:50535284-50535306 GTGTGTGTATGTGTGTGGTGTGG + Intergenic
1158379901 18:56917545-56917567 GTGTGTGCATGCATGTGTGTGGG + Intronic
1158501997 18:58010744-58010766 ATGTGTGCATGAAGGAGCTGAGG + Intergenic
1158545768 18:58395229-58395251 GTGTGTGTGTGTATGTGTTGGGG - Intronic
1158835697 18:61329592-61329614 GTGTGTGCATGGCAGGGCTGAGG + Intergenic
1159087234 18:63807643-63807665 GTATGTGCATGTATGTTGTGTGG + Intergenic
1159274002 18:66192157-66192179 ATGTGTGCATGCGTGTGGAGAGG - Intergenic
1160194529 18:76741578-76741600 GTGTGTGCCTGGAGGTGGTGAGG - Intergenic
1160429123 18:78799421-78799443 GCGTGTGCTTGCATGTGTAGTGG - Intergenic
1160765441 19:805594-805616 GTGTGGGCATGCAGTCGCTGGGG - Intronic
1160962404 19:1729084-1729106 GTGTGTGCATGCGTGTGAGAGGG + Intergenic
1161306036 19:3568795-3568817 ACGTGTGTAGGCATGTGCTGTGG + Intronic
1161566373 19:5005047-5005069 GTGTGTGCCGGCCTGTCCTGCGG + Intronic
1161725470 19:5925871-5925893 GTGTGCGCGTGCATGTGCTGGGG + Intronic
1163223478 19:15938216-15938238 GTGTGTGTGTGTGTGTGCTGAGG - Intergenic
1164034971 19:21445394-21445416 GTGTGTGAATTCATGTAGTGTGG + Intronic
1164840958 19:31391684-31391706 GTGTGTGTGTGTGTGTGCTGGGG - Intergenic
1165159237 19:33806104-33806126 GTGTGTGTATGCCTGTGTTGTGG + Intronic
1165697365 19:37910943-37910965 GTGTGTGTATGTATGTGATTGGG + Intronic
1165898679 19:39158247-39158269 GTGTGAGCATGCATGTGTTGCGG + Intronic
1165984614 19:39757197-39757219 GTGTGTGCCTGTGTGTGTTGGGG + Intergenic
1166302186 19:41917608-41917630 GTGTGTGCATGCGGGGGCGGCGG - Intronic
1166302195 19:41917637-41917659 GTGCGTGCGTGCGTGTGCTTTGG - Intronic
1167103465 19:47417920-47417942 GTGTGTGCATGTGTGTGTGGGGG - Intronic
1168189279 19:54726239-54726261 GTAGGTCCCTGCATGTGCTGGGG - Exonic
1168197516 19:54786649-54786671 GTAGGTCCCTGCATGTGCTGGGG - Intronic
1168206175 19:54852184-54852206 GTAGGTCCCTGCATGTGCTGGGG - Exonic
1168325155 19:55535091-55535113 AAGTGTGCATTCATCTGCTGGGG - Intronic
925319678 2:2952454-2952476 GTGTGTGCATGTGCGTGTTGGGG - Intergenic
925337741 2:3110317-3110339 ATGTGTGCATGCATGTCATGTGG + Intergenic
925406954 2:3612243-3612265 ATGTGTGCATGCGTGTGCGTGGG - Intronic
925541608 2:4973587-4973609 GTGTGTGCATGTATGCTGTGGGG + Intergenic
925724788 2:6862461-6862483 ATGTGTGGATGCTTGTGTTGAGG + Intronic
925914810 2:8597256-8597278 GTGTGTGTATACATGTGGTGTGG + Intergenic
926284872 2:11481378-11481400 CTGTGTGCTGGCAGGTGCTGGGG + Intergenic
926642593 2:15253381-15253403 ATGTGTGTATGCGTGTGCTTAGG + Intronic
927245483 2:20954218-20954240 GTGTGTGTGTGTATGTGGTGTGG + Intergenic
927516269 2:23673499-23673521 GTGTATGGAAGCATGTGGTGTGG - Intronic
927653367 2:24926245-24926267 AAGTGTGCATGCATGTGCCTGGG + Intergenic
927678421 2:25123783-25123805 GTGTGTGCACGTGTGTGCAGTGG - Intronic
927876890 2:26663020-26663042 GTGTGTGCATGCATGGGGTTGGG - Intergenic
927917106 2:26944387-26944409 GTGTGTGCATGCATGTGTATGGG - Intronic
927991150 2:27448033-27448055 GTGTGTGTGTGCAAGGGCTGGGG + Intronic
928054570 2:28039419-28039441 GTATATGTATGCATGTGCTAAGG + Intronic
929581802 2:43086054-43086076 GTGTGTGCACGTGTGTGGTGGGG - Intergenic
929678930 2:43968869-43968891 CTGTGTGCATGAGTGTGGTGAGG - Intronic
931461845 2:62456851-62456873 GTGTGAGCCTGGAGGTGCTGAGG + Intergenic
931473807 2:62567771-62567793 GTGTGCGCATGCATGTGGTGAGG + Intergenic
931716259 2:65031403-65031425 GTGTGGGCAAGCACCTGCTGCGG - Intergenic
931871487 2:66465455-66465477 GTGTGTGTATGTATGTGTTATGG + Intronic
931978847 2:67672556-67672578 GTGTGTGTATGTATGTGAGGTGG - Intergenic
932002153 2:67894893-67894915 GTGTGTGTATTCGTGTGCTTTGG - Intergenic
932099191 2:68881039-68881061 GTGTGTGCCTGTGTGTGTTGGGG - Intergenic
932102929 2:68917118-68917140 GTGTGTACATGTATGTGTTTGGG - Intergenic
932188497 2:69718644-69718666 GTGTATGCATGTGTGTGCTGTGG - Intronic
932588816 2:73050381-73050403 GTGTGTGTGTGCGTGCGCTGTGG - Intronic
932684853 2:73859979-73860001 GTGTGTGCGTGCATATGTTTGGG + Intronic
932764137 2:74459563-74459585 GTATGTGCATGCAGGAGGTGGGG + Intronic
933949445 2:87315488-87315510 GTGTGTGCATGTGTGTGCACGGG + Intergenic
934032525 2:88061161-88061183 GTGTGTGTATGTGTGTGTTGGGG + Intergenic
934032531 2:88061199-88061221 GTGTGTGTATGTGTGTGTTGGGG + Intergenic
934656942 2:96121317-96121339 GTGATTGCATGCATGGGGTGAGG - Intergenic
934702467 2:96453150-96453172 CTGTGTTGATGCATGGGCTGGGG + Intergenic
935091722 2:99901078-99901100 GTGTGTGCATGCATGCAATCTGG + Intronic
935375193 2:102388455-102388477 CTGTGTGATTGCCTGTGCTGTGG + Intronic
935578924 2:104738811-104738833 GTGTGTGTGTGTATGTGTTGGGG - Intergenic
935842978 2:107133628-107133650 GTGTGTACATGTGTGTGTTGGGG + Intergenic
935854690 2:107261087-107261109 GTGTACGTATGCATGTGCAGGGG + Intergenic
936073712 2:109388078-109388100 GTGTGTGCATGTGTGTGCACAGG - Intronic
936248177 2:110846528-110846550 TTGTTTGCATGCATATGCAGTGG + Intronic
936330747 2:111546109-111546131 GTGTGTGCATGTGTGTGCACGGG - Intergenic
936628993 2:114179933-114179955 TTGTGTGTGTGCATGTGTTGCGG - Intergenic
937244877 2:120486219-120486241 GTGTGAGCAGGCATGTGTTGGGG - Intergenic
937335663 2:121060798-121060820 GTGTGTGGATGGAGGTGGTGGGG + Intergenic
937536236 2:122891412-122891434 CTCAGTGCATGCATGTGGTGTGG - Intergenic
937804392 2:126121423-126121445 GTGTGTGCAAGCAAGTGTAGGGG - Intergenic
937888782 2:126919184-126919206 GTGAATGCATTGATGTGCTGGGG - Intergenic
937916509 2:127101802-127101824 GTATGTGCATGCATGTGTGTGGG - Intronic
938119648 2:128624585-128624607 ATATGTGCATGCGTGTGGTGTGG - Intergenic
938202027 2:129379996-129380018 GTGTGTGCATGCATCCACTTAGG - Intergenic
939075702 2:137600092-137600114 GTGTGTGCATGCATGTGTGCAGG - Intronic
939162520 2:138607086-138607108 GTGTGTGCATGTATGGAGTGAGG - Intergenic
939570274 2:143832466-143832488 CTGGGTGTATGCATTTGCTGGGG + Intergenic
939758204 2:146139294-146139316 GTGTGTGCATGCATATGCACAGG + Intergenic
939823648 2:146987505-146987527 TTGTGTGCACACATGTGCTCAGG + Intergenic
939886204 2:147684773-147684795 GTGTGTGTATGCAGGGGCTGCGG - Intergenic
940176904 2:150888119-150888141 GTGTGTGCATGCATGTGAGTTGG - Intergenic
940261385 2:151783330-151783352 GTTTGTACTTGCATGTGCTAAGG + Intergenic
940405055 2:153291892-153291914 GTCTTTGCATGCACGTGCAGTGG + Intergenic
941547057 2:166864660-166864682 GTGTGTGCATGCACATTTTGGGG + Intergenic
941876237 2:170436354-170436376 GTGTGTGTGCGCATCTGCTGAGG + Intronic
942374065 2:175317941-175317963 GCATGTGCATGTGTGTGCTGAGG + Intergenic
942561672 2:177226535-177226557 GTGTGTGTGTGCATGTGTGGAGG - Intergenic
942803959 2:179908119-179908141 GTGTGTGTGTGCATGTGCGCGGG + Intergenic
942865439 2:180668011-180668033 GTGTGTGCATGTGTGTGTTATGG + Intergenic
944083603 2:195818695-195818717 GTGTGTGGATGAGTGTGCAGAGG - Intronic
944739925 2:202601889-202601911 GTCTGTGCGTGTGTGTGCTGGGG - Intergenic
944905525 2:204257952-204257974 GTGTGTGCATGCATGCAGTGAGG - Intergenic
945906798 2:215603315-215603337 GTGTGTGCCTGGATGTGTTGGGG - Intergenic
945969106 2:216219013-216219035 GTGCGTGTATGCATGTGCACTGG - Intergenic
947068477 2:226258224-226258246 TTGTGTACAAGCATGTACTGTGG + Intergenic
947110617 2:226715454-226715476 GTGTGTGTGTGCGTGTGGTGGGG + Intergenic
947110650 2:226715694-226715716 GTGTGTGTGTGCGTGTGGTGGGG + Intergenic
947470738 2:230399237-230399259 GTATTTGCATCCATGTGTTGTGG - Intronic
947693133 2:232158329-232158351 GTGTGTGCATGTGTGTGTTCGGG + Intronic
948264018 2:236624584-236624606 GTGTTTGCATGGATCTGCTGAGG - Intergenic
948304739 2:236938265-236938287 GTGTGTGCATGTGTGTGGTGTGG + Intergenic
948601462 2:239109688-239109710 GTGTGGGCATGGCTGTGCTTGGG + Intronic
1169580516 20:7018044-7018066 GTGTGTGTATGCATGTGTTTTGG + Intergenic
1169622720 20:7525921-7525943 TTGGGTGAATGCATATGCTGTGG - Intergenic
1170709847 20:18780784-18780806 GTGTGTATATGCGTGTGCAGAGG - Intergenic
1170784790 20:19458172-19458194 GTGTGTGTGTGCATGTGAGGGGG - Intronic
1170923935 20:20705344-20705366 GGGTATGGTTGCATGTGCTGTGG - Intronic
1170932840 20:20784309-20784331 GTGTGTATGTGCATGTGATGCGG + Intergenic
1171109985 20:22471910-22471932 ATGTGTGCACGGGTGTGCTGTGG - Intergenic
1171175012 20:23045205-23045227 GTGTGTGTGTGTGTGTGCTGGGG - Intergenic
1171266159 20:23773634-23773656 GTGTGTGCATGTAGGTGGGGTGG - Intergenic
1171957697 20:31472533-31472555 GTGTGTGCATGGAGGGGGTGGGG - Intronic
1172773535 20:37394918-37394940 GTGTGTGTGTGCATGTGGGGTGG + Intronic
1172780649 20:37435091-37435113 CTGTGTGCATGCATGTGCCTGGG + Intergenic
1172904143 20:38356332-38356354 GTGTGTGCATGTAGGGGGTGTGG - Intronic
1173069899 20:39753460-39753482 GTGTGTGTGTGAATGTGCTTAGG + Intergenic
1173103187 20:40106690-40106712 ATGTATGAATGCCTGTGCTGAGG + Intergenic
1173119388 20:40275014-40275036 GTGTGTGCATGTACATGCTTGGG + Intergenic
1173163217 20:40667764-40667786 GTGTGTGTGTGCATGTGGAGGGG + Intergenic
1173204884 20:40985055-40985077 GTGTGTGTGTGTATGTGTTGGGG + Intergenic
1173418991 20:42883919-42883941 GTGTGTGCATGCCTGTGTACTGG - Intronic
1173473245 20:43339514-43339536 GTGTGTGGAGGTAGGTGCTGAGG - Intergenic
1173499202 20:43540076-43540098 GTGTGGGTATGCATGGGCTTCGG + Intronic
1173503710 20:43571264-43571286 ATGTGTGCATGCATGTACATAGG + Intronic
1173921281 20:46747326-46747348 GTGCATGCATGCATTTGCAGGGG - Intergenic
1174407270 20:50310504-50310526 GTGTGTGCACGTATGGGGTGGGG + Intergenic
1174553459 20:51377900-51377922 GTGTGTGCATTCATTTCCTAGGG - Intergenic
1174887018 20:54347078-54347100 GTGTGTGCATGTGCGTGCTTTGG + Intergenic
1174946685 20:54994001-54994023 GTGATTGATTGCATGTGCTGTGG + Intergenic
1175073371 20:56353495-56353517 GTGTGTGCATGCATGTGTGCGGG - Intergenic
1175082153 20:56429601-56429623 GAGTGTGTATGTATGTGTTGGGG - Intronic
1175172876 20:57092430-57092452 GTGTGTGAGTGAATGTGCAGGGG - Intergenic
1175404694 20:58718488-58718510 GTGAGTGCATGCGTGTGCACTGG + Intronic
1175478563 20:59295007-59295029 GTGTGTGCGTGCATGCGGTCTGG + Intergenic
1175593320 20:60211153-60211175 GTGTGTGTGTGTGTGTGCTGGGG + Intergenic
1175699823 20:61128877-61128899 GTGACTGCCTGCAGGTGCTGTGG + Intergenic
1175720448 20:61282846-61282868 GCATTTGCACGCATGTGCTGTGG + Intronic
1175720462 20:61283379-61283401 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720463 20:61283418-61283440 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720464 20:61283457-61283479 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175824933 20:61931637-61931659 GTTTGTGCAGGCATTTACTGGGG + Intronic
1175876018 20:62230398-62230420 GTGTGTGTATGGGTGTGTTGAGG - Intergenic
1175929419 20:62486673-62486695 GTGTGCCCATGTCTGTGCTGTGG + Intergenic
1175952942 20:62593139-62593161 GTGTGTGCATGCATGTATGGGGG + Intergenic
1176112998 20:63418984-63419006 GTGTGTGCAGGCCTGCGCTGGGG - Intronic
1176366855 21:6038464-6038486 GTGTGTGCATGTATGTTGTGTGG + Intergenic
1177756345 21:25352834-25352856 GTGTGTGCATGCATGTGTGAAGG - Intergenic
1177783697 21:25646546-25646568 GTGTATGCATGCATCGGGTGTGG + Intronic
1178710045 21:34908953-34908975 GTGTGTGTATGTGTGTGCTAGGG + Intronic
1178750477 21:35297721-35297743 GTGTGTGCATGTGTGTGAGGGGG - Intronic
1179020998 21:37640981-37641003 GTGCGTGCATGCATGTAATGGGG + Intronic
1179153926 21:38833076-38833098 GTGTGTGCATGTGTGTTCTTGGG - Intergenic
1179394478 21:41025322-41025344 GAATGTGCATGCATGTGGTGAGG - Intergenic
1179756663 21:43500080-43500102 GTGTGTGCATGTATGTTGTGTGG - Intergenic
1179982663 21:44904518-44904540 GTGTATGCGTGCATGTGTGGTGG - Intronic
1180060029 21:45380059-45380081 GTGTGTGCATGGATGGACTCTGG - Intergenic
1181429869 22:22872744-22872766 GTGTGTGTGTGCATATGGTGTGG + Intronic
1181495349 22:23284458-23284480 GTGTGTGCACGCCTATGCCGAGG - Intronic
1181746312 22:24957179-24957201 GTGTGTGCCTGTGTGTGTTGGGG + Intronic
1181997119 22:26891828-26891850 CTGTGTGCATGGAGATGCTGGGG + Intergenic
1182013864 22:27022796-27022818 ATTTGTGCATACATATGCTGGGG - Intergenic
1182966899 22:34530562-34530584 GTGTGTGCATGTGTGTGTTTGGG + Intergenic
1183343673 22:37295363-37295385 GTGTGTGCATGTGTGTGGTGGGG - Intronic
1183388172 22:37526910-37526932 GGGTGTGAATGCAGGTGCTCCGG - Intergenic
1183426732 22:37743873-37743895 GTGTGTGTGTGTGTGTGCTGGGG + Intronic
1183614874 22:38937936-38937958 GTGTGTGTAGGCATGTATTGAGG + Intergenic
1184029418 22:41883069-41883091 ATCTCTGCATGCATGTGCAGTGG - Intronic
1184079922 22:42212196-42212218 ATGTGTGGATTCATGTGATGAGG + Exonic
1184128940 22:42505719-42505741 GTGTGCGCGTGCGTGTGGTGGGG - Intergenic
1184137735 22:42559034-42559056 GTGTGCGCGTGCGTGTGGTGGGG - Intronic
1184265676 22:43344493-43344515 GTGTGTGCGTGTGTGTGTTGGGG - Intergenic
1184730884 22:46370325-46370347 GTGTCTGCATGCATGTGTATAGG - Intronic
1184783010 22:46658479-46658501 GCCTGTGCCTGCATGAGCTGTGG + Intronic
1184924618 22:47628233-47628255 GTGTAAGCATGCATGTTGTGGGG + Intergenic
1184946872 22:47809938-47809960 GTGTATGTATGTGTGTGCTGTGG + Intergenic
1185013308 22:48328535-48328557 GTGTATGCATACATGCGCGGGGG - Intergenic
1185023687 22:48395507-48395529 GTGTGTGCATGTGTGTGCACAGG - Intergenic
1185119332 22:48956448-48956470 GTGTGTGTATGGTTGTGGTGTGG - Intergenic
1185248107 22:49784167-49784189 GTCTCTGTGTGCATGTGCTGGGG - Intronic
949255000 3:2035543-2035565 GTGTGTGCACACATGTGCTGAGG - Intergenic
950309694 3:11946241-11946263 GGGAGTGGAGGCATGTGCTGAGG + Intergenic
950378003 3:12587814-12587836 GTGTAAGCATGTTTGTGCTGTGG - Intronic
950724751 3:14909583-14909605 GTGGGTGGCTGCATGTACTGTGG - Intronic
950794463 3:15499276-15499298 GTGTGTCCATGCTTGTGCACTGG - Intronic
951218185 3:20043351-20043373 GTGTGTGTATGCATGTGTTGGGG + Intronic
951856945 3:27208023-27208045 TTGTGTGTATGCATGTATTGTGG + Intronic
952089056 3:29862609-29862631 GTGTGTGTGTGCATGTGTGGTGG + Intronic
952252041 3:31664796-31664818 GTGTGTGCATGCTTATAGTGCGG + Intronic
952392555 3:32892847-32892869 GGGTGGACATGCGTGTGCTGAGG + Exonic
952492008 3:33882097-33882119 GTGTGTGCTTTCATGTGGAGTGG + Intergenic
952576193 3:34776836-34776858 GTGTGTGCATGTATGTGAGCTGG - Intergenic
953215819 3:40917092-40917114 ATCTGTGCAGGCAGGTGCTGTGG + Intergenic
953284480 3:41593389-41593411 GTGTGTGCATGCATGTGTGTAGG - Intronic
953346043 3:42176547-42176569 GTGTGTATGAGCATGTGCTGAGG - Intronic
953384811 3:42500515-42500537 GTGTGTGTATGTATGTGTTGAGG + Intronic
953477593 3:43218849-43218871 CTGTGTTCAGCCATGTGCTGTGG - Intergenic
953847751 3:46441981-46442003 GTGTGTGTATGCATGTTGTTAGG + Intronic
953931520 3:47008187-47008209 GTGTGTGTATGCATGTGCCCTGG + Intronic
954122288 3:48506408-48506430 ATGTGTGCAGGCATTTTCTGTGG + Intergenic
954594227 3:51811636-51811658 GTGTGTGCATGTGTGAGGTGTGG - Intergenic
954679962 3:52339824-52339846 GTGTGTGTACACACGTGCTGGGG + Intronic
955026659 3:55174104-55174126 GTGTGTGAGTGTATGTGTTGGGG - Intergenic
955151472 3:56371555-56371577 GTGTGTGCATGCATGTGGTTGGG - Intronic
955534378 3:59907605-59907627 GTGTGTGCATGTGTGCACTGGGG + Intronic
956369196 3:68539704-68539726 GTGTGTGCATGTGTGTGGTGGGG + Intronic
956712029 3:72047554-72047576 GTGTGTGTGTGTATGTGCAGTGG - Intergenic
957375592 3:79353583-79353605 GTGTGGACATGGAGGTGCTGGGG + Intronic
957539126 3:81546189-81546211 GTGTGTGTGTGCATGTACAGTGG - Intronic
957938950 3:86979829-86979851 GCGTGTGCATACATTTGGTGGGG + Intronic
958166143 3:89880290-89880312 GTGTGTGTGTGCGTGTGCTGTGG + Intergenic
959034276 3:101342281-101342303 GTATGTGCATGCATGTGCACAGG + Intronic
959309088 3:104708573-104708595 GTGTGTGCGTGCATATGTGGAGG - Intergenic
959579772 3:107971415-107971437 AGGTGTGCATACATTTGCTGGGG + Intergenic
960052903 3:113254624-113254646 GGGTGTGCATGCGTGTGCACCGG - Intronic
960752510 3:120971620-120971642 GTGTATGTATGCATGTGCCATGG - Intronic
961219154 3:125186334-125186356 GTGTGTGCATGTGTGGGCGGTGG - Intronic
961386943 3:126528117-126528139 GGGTGTGAATGGATGTGCTGTGG + Intronic
961638841 3:128352106-128352128 GTGTGTGCATGCATGTGTGATGG - Intronic
961790133 3:129369823-129369845 GTGTGTGAATGCATGTTGTATGG + Intergenic
961793737 3:129394588-129394610 GTGTGTGTGTGTATGTGCAGGGG - Intergenic
961793766 3:129394831-129394853 GTGTGTGTATGTGTGTGCAGGGG - Intergenic
962351645 3:134660725-134660747 GAGTGTGCAAGCTTGTCCTGTGG + Intronic
962540237 3:136374229-136374251 GTGTGTGCCTGCATGTGAGATGG + Intronic
963209586 3:142674358-142674380 GTGTGTGTATGTATGTGTGGTGG + Intronic
963660508 3:148121520-148121542 ATGTGTGAATACATGTGTTGTGG + Intergenic
963922699 3:150921388-150921410 GTGTGTGCGTGCACATGCAGGGG - Intronic
964085019 3:152806715-152806737 GTGTTTGTATACATGTGCTGTGG + Intergenic
964527743 3:157632969-157632991 GTGTGTGTATGTGTGTGGTGGGG - Intronic
964733780 3:159894952-159894974 GTATGTGCGTGCATGTGCATAGG + Intronic
964824253 3:160808315-160808337 GTGTGTGCGTGCATGTGTGGTGG + Intronic
965132474 3:164719047-164719069 GTGTGTGCATGCATCTGTTGTGG + Intergenic
965543819 3:169895591-169895613 GTGTGTGTCTGTGTGTGCTGGGG + Intergenic
965765526 3:172126230-172126252 CTGTGTGCTTGTATGTGCTGAGG + Intronic
965778389 3:172257551-172257573 GTGTATGAATGCGTGTGATGTGG - Intronic
966161277 3:176971299-176971321 GTGTGTGCATGCACGTGCTTCGG + Intergenic
966278646 3:178205375-178205397 GTGTGTGTATGGATGTGGTGTGG + Intergenic
966857125 3:184202430-184202452 GTGTGTGCATGTGTGTGCAGTGG - Intronic
967449534 3:189608165-189608187 GTGTGTGCATGTATGTGTTGGGG + Intergenic
967737828 3:192972256-192972278 GTGTGTACACACATGTGCTATGG + Intergenic
967748724 3:193088932-193088954 GTGTGTGCATGTGTGTGTGGGGG - Intergenic
967778281 3:193407257-193407279 GTGTGTGCACGCATGTGTGTAGG - Intronic
967832995 3:193937995-193938017 GTGTGTGCGTGCATGCACGGTGG - Intergenic
968637754 4:1690803-1690825 GTGTGTGCATGTGTGTGGTGGGG - Intergenic
968977455 4:3829455-3829477 GTGTGTGTTTGTAAGTGCTGTGG - Intergenic
969061501 4:4438963-4438985 GTGTGGGTATACATGTGTTGGGG - Intronic
970015364 4:11506649-11506671 GAGTGTGTGTGCATGGGCTGCGG - Intergenic
970154226 4:13125361-13125383 GTGTGTGTGTCCATGTGCTCAGG - Intergenic
971562165 4:28093226-28093248 GTGTGTGATTGCATGTGATTTGG + Intergenic
971862317 4:32123684-32123706 TTGTGTGTATGCATGTGCTCAGG - Intergenic
972291797 4:37696591-37696613 GTGTGTGTATGCATGTGCCTCGG - Intergenic
972406810 4:38754127-38754149 GTGTGTGCATGTATGTGTATGGG - Intergenic
972768370 4:42172544-42172566 GTGTGAGCAAGCATGCCCTGAGG + Intergenic
973228656 4:47816821-47816843 GTGTGTGTGTGCTTGTGCTATGG - Intronic
973720091 4:53714703-53714725 GTGTGTGTGTGTATGTGTTGGGG + Intronic
974211059 4:58777043-58777065 GTGTGTGTGTGCATCTTCTGAGG + Intergenic
974233278 4:59145853-59145875 GTTTCTGCATTCATTTGCTGAGG + Intergenic
974413740 4:61577194-61577216 GTGTGTGCATGTGTGTGTTAGGG + Intronic
974867120 4:67594942-67594964 GTGTGTGCATGTGTGTGATTGGG + Intronic
975573950 4:75844593-75844615 GTTTGTGCGTGTATGTGCAGTGG + Intergenic
975601784 4:76107943-76107965 GTGTGTGCATGTGTGTGTTGGGG + Intronic
978500452 4:109403717-109403739 GGGTGTGGTGGCATGTGCTGTGG + Intergenic
979774679 4:124574890-124574912 GTGTGTGTGTGCATGTGGAGAGG - Intergenic
979831905 4:125315086-125315108 GTGTGTGCATGCCTGTGCGGCGG + Intergenic
980534132 4:134092702-134092724 GTGAGTGGATGCAGGAGCTGGGG - Intergenic
980739841 4:136935829-136935851 GTGTGTGTATGCGTGTGGAGGGG - Intergenic
980925441 4:139132434-139132456 GTGTGTGCATGCACATGTGGTGG - Intronic
981430784 4:144656995-144657017 GTGTGTACATGCATGCGGTGGGG - Intronic
981780129 4:148420039-148420061 GTGTATGCATGTAGGTGGTGGGG - Intronic
982493833 4:156065172-156065194 GTGTGTGTATGTGTGTGTTGGGG + Intergenic
983562846 4:169118206-169118228 GTGTGTGCATGCATGTACATGGG - Intronic
983987126 4:174073214-174073236 GTGAGTGGATGCAGGAGCTGGGG + Intergenic
984603853 4:181760955-181760977 GTGTGTGTATGTGTGTGGTGGGG - Intergenic
985074700 4:186202607-186202629 GTGTGTGCATGTGTGTGCATGGG - Intronic
985674926 5:1226045-1226067 GTGTGTCCAGACATGTGCTCAGG + Intronic
985702433 5:1381753-1381775 GTGTGGGCATGCATGTGTATGGG - Intergenic
985795728 5:1960717-1960739 GTGTGTGCATGTGTGTTTTGGGG - Intergenic
985795753 5:1961196-1961218 GTGTGTGCATGTGTGTGATCAGG - Intergenic
985843414 5:2326538-2326560 GTGTGTGTGTGTATGTGCAGTGG + Intergenic
985959448 5:3288957-3288979 GTGTGTGCGTGTATGTACTGAGG - Intergenic
986129476 5:4913828-4913850 GGGAGTGTGTGCATGTGCTGGGG - Intergenic
986452624 5:7881384-7881406 GGGGGTACAGGCATGTGCTGTGG + Intronic
986483042 5:8208588-8208610 GTGTGTGTGTGCATGTGGTGTGG + Intergenic
986719993 5:10554143-10554165 GTGTGTGCATGCAGGTGTGCTGG + Intergenic
986749861 5:10777249-10777271 CTGTGTGCATGCATGTGTGCAGG - Intergenic
986987159 5:13513068-13513090 GTGTGTGTGTGTATGTGGTGGGG - Intergenic
987175437 5:15303434-15303456 GTGCGCGCGTGCGTGTGCTGAGG + Intergenic
987794535 5:22609054-22609076 TTGTGTGCATGCATGTGTTGAGG + Intronic
987827206 5:23047536-23047558 TTGTGTGCATGCATGTGAAGAGG + Intergenic
987995036 5:25265267-25265289 ATGTGTGCGTGTATGTGTTGGGG - Intergenic
988126714 5:27049036-27049058 GTGAGTGCATGAAGGTGTTGGGG - Intronic
989074863 5:37553578-37553600 GTGTGCTTGTGCATGTGCTGAGG + Intronic
989129866 5:38096581-38096603 GTGCATGCATGTGTGTGCTGGGG + Intergenic
989131353 5:38110260-38110282 GTGTGTGCGTGTGTGTGTTGAGG - Intergenic
989558332 5:42822706-42822728 ATGTGTGCATGCATGTGCATTGG + Intronic
990978257 5:61578069-61578091 GTGTGTGCATACACATGTTGGGG - Intergenic
992099707 5:73395385-73395407 GAGTGTACATGTAAGTGCTGTGG + Intergenic
992188558 5:74267670-74267692 GTGTGTGTGTGTATGTGGTGTGG + Intergenic
992744658 5:79807286-79807308 GTGTGTGCATTCATGTGGGGAGG + Intergenic
992773683 5:80071641-80071663 GTGTGTGTATGTGTGTGTTGGGG - Intronic
993358649 5:86946093-86946115 GTGTGTGCATGCATATGAAGTGG - Intergenic
993514669 5:88815947-88815969 GTGTGTGCATGCATTCCCAGAGG + Intronic
994190013 5:96859046-96859068 GTGTGTGTATGCATGTGGCAGGG - Intronic
994311995 5:98283978-98284000 GTGTGTGTGTGTATGTGGTGGGG - Intergenic
994314807 5:98320480-98320502 GTGTGTGTGTGCGTGTGGTGTGG - Intergenic
995022822 5:107385070-107385092 GTGTGTGCATACGTGTGCTGGGG - Intronic
995243818 5:109915161-109915183 GTGTGTTCAGGTATGTTCTGTGG + Intergenic
995288559 5:110421595-110421617 TTGTGTATATGCATGAGCTGAGG - Intronic
995914783 5:117231694-117231716 GTGTGTGTGTGCATGTGTTGGGG + Intergenic
996145861 5:119975306-119975328 GTGTGTGTATGTGTGTGGTGTGG + Intergenic
996293483 5:121883115-121883137 GTGTGTGTGTGTATGTGTTGTGG - Intergenic
996300268 5:121973598-121973620 GTGTGTGCATGTGTGTGTGGGGG + Intronic
996852199 5:127965850-127965872 GTGTGTGAATGTATGTGTTTGGG - Intergenic
997434041 5:133861370-133861392 GTGTGCACATGCATGTGCAAGGG + Intergenic
998374805 5:141683147-141683169 GTGTGTGTGTGTATGTGTTGGGG + Intergenic
998941663 5:147290228-147290250 GTGTGGGTATGTATGTGTTGGGG + Intronic
998999892 5:147908937-147908959 GTGTGTGTATGTATGTGTTTTGG - Intergenic
999270984 5:150296281-150296303 GTGTGTGCATGTGTGTCCTGGGG - Intergenic
1000777355 5:165437297-165437319 GTGTGTGCATGATTATCCTGAGG + Intergenic
1000895230 5:166847275-166847297 GTGTGTGCACGTGTGTGTTGGGG + Intergenic
1001096820 5:168781797-168781819 GTCTCTGGATGGATGTGCTGTGG + Intronic
1001550152 5:172596675-172596697 GTGTGTGCATACATGTGGGGGGG - Intergenic
1001859477 5:175040921-175040943 GTGTTTTCTTGCAAGTGCTGTGG + Intergenic
1002254995 5:177952049-177952071 GTCTGTGCGTGTGTGTGCTGGGG + Intergenic
1002819077 6:706955-706977 GTGTGTGTATGCAGGGGGTGGGG - Intergenic
1002956565 6:1871053-1871075 GTGTGTGTGTGTGTGTGCTGGGG - Intronic
1003009512 6:2413629-2413651 GTGTTTGCATGCACGTGCTCAGG - Intergenic
1003038342 6:2664455-2664477 CAGTGTGCATGCGTGTGCTGGGG - Exonic
1003917928 6:10805052-10805074 GTGTGTGCATGTGTGTGTCGGGG + Intronic
1004135596 6:12962973-12962995 GTGTGTGCATGCATGTGCTGAGG - Intronic
1004265737 6:14147026-14147048 GTGTGTGTGTGTATGTGTTGGGG + Intergenic
1004465704 6:15882967-15882989 CTGTGTGGATGCATGTGTGGGGG + Intergenic
1004770806 6:18779093-18779115 GTGTGTGCATGCACGTGTATTGG + Intergenic
1005199254 6:23324705-23324727 GTGTGTGTATGTGTGTGTTGGGG - Intergenic
1005672740 6:28123646-28123668 GTGTGTGTGTGTGTGTGCTGGGG - Intergenic
1005737327 6:28760226-28760248 GTGTGTGCATGTAAATGCTAGGG + Intergenic
1005742398 6:28804448-28804470 GTGTGTGCATGTAAATGCTTGGG + Intergenic
1006520267 6:34567254-34567276 GTGTGTGTATGTGTGTTCTGAGG - Intergenic
1006557037 6:34876051-34876073 CTGTTTACATGCATGTGCTGGGG + Exonic
1006923088 6:37638943-37638965 GTGTGTGCATGTGTGTGTTTGGG - Intronic
1007410036 6:41656181-41656203 GTGTGTGTGTGTGTGTGCTGGGG - Intergenic
1007540806 6:42642303-42642325 ATGTGTGCATGTGTGTGATGTGG - Intronic
1007574600 6:42916748-42916770 ATGTGTGCATGTACGTGGTGGGG + Intronic
1008367556 6:50699936-50699958 GTGTGTGTGTGCATATGGTGGGG + Intergenic
1009814861 6:68719859-68719881 GTGTGAGTATGTATATGCTGAGG + Intronic
1010088858 6:71954841-71954863 GTGTGTGTGTGTGTGTGCTGAGG - Intronic
1010318808 6:74482941-74482963 GGGAGTGCATGCGTGTGTTGCGG - Intergenic
1010350330 6:74866485-74866507 GTGTGTGTTGACATGTGCTGTGG - Intergenic
1010373742 6:75141745-75141767 GTGTGTGCATGTATGTGTAGTGG - Intronic
1010714720 6:79215177-79215199 GTGTGTGCATGCATGCACGTAGG - Intronic
1011629814 6:89312387-89312409 CTGTGTGCATGCCTTGGCTGGGG + Intronic
1012254132 6:97013531-97013553 GTCTGTGTATGTATGTGGTGGGG - Intronic
1012606904 6:101168615-101168637 GTGTGTGCACGCATGCTGTGTGG + Intergenic
1012999959 6:106012102-106012124 GTGTGTGTATGAATGTGGAGGGG - Intergenic
1013212563 6:108000028-108000050 GTATGTGGATGCATGTGCTCTGG + Intergenic
1013297030 6:108766834-108766856 CTGTGTGCAGGCATATGCAGAGG - Intergenic
1013732655 6:113186499-113186521 GTGTGCGCGCGCATTTGCTGTGG - Intergenic
1014130229 6:117822719-117822741 GTGTGTGCATGTATGAGGTAGGG + Intergenic
1014189915 6:118483420-118483442 GTGTGTGCATGCATGTGTATGGG + Intronic
1014432960 6:121390767-121390789 CTGTGTGCAGGCCTGTGTTGGGG - Intergenic
1014936958 6:127396542-127396564 GTGTGTGCGTTTATGTGATGAGG - Intergenic
1015395358 6:132727914-132727936 TTGTGTGCATGTGTGTGCTCTGG + Intronic
1015576514 6:134677422-134677444 GTGTGTGCATGTGTGTGCATAGG - Intergenic
1015594904 6:134857190-134857212 ATTTGTGCATGCATGTGTTGAGG - Intergenic
1016776293 6:147908348-147908370 GTGTGTGGATGCAGGGCCTGTGG + Intergenic
1016942317 6:149492983-149493005 GCCTGTGCCTGCCTGTGCTGGGG + Intergenic
1017406956 6:154129847-154129869 GTGTGTGTGTGTGTGTGCTGGGG - Intronic
1017499956 6:155015047-155015069 GGGTGTGCATGCTGGAGCTGGGG + Intronic
1017543505 6:155427013-155427035 GTGTGTGTGTGTGTGTGCTGGGG + Intronic
1017792935 6:157817528-157817550 GTGTGTGCTGGCATGTTATGTGG + Intronic
1017973983 6:159338224-159338246 GTGTGTGCAGGCACCTGCTGTGG - Intergenic
1018187096 6:161274695-161274717 GTGTGTGCACGCCTGTGCAGTGG - Intergenic
1018244104 6:161805437-161805459 GTGTGTGCATGTGTGTACTCAGG - Intronic
1018576344 6:165264049-165264071 CTGTGTGCAGGCCAGTGCTGGGG - Intergenic
1018619421 6:165715593-165715615 ATGTGTACATGCATGTGCATGGG - Intronic
1018852556 6:167651609-167651631 GTGTGTGAGTGTATGTGGTGTGG + Intergenic
1018993525 6:168692832-168692854 GTGGGTGCAGACAGGTGCTGCGG - Intergenic
1019151618 6:170010183-170010205 TGGTGTGCATGCATGTGCCATGG - Intergenic
1019487227 7:1294918-1294940 GTGTGTGTGTGCCTGTGGTGTGG + Intergenic
1019490862 7:1312540-1312562 ATGTGTGCAAACATGTGCTCAGG - Intergenic
1019581672 7:1766998-1767020 GTGTGTGTGTGTGTGTGCTGGGG + Intergenic
1019601766 7:1887345-1887367 GTGTGAGCATGCATGTGTGTGGG + Intronic
1019610778 7:1935658-1935680 CTGTGAGCATGCAGGTGCAGAGG - Intronic
1019790938 7:3013503-3013525 GTGTGTCCATGGATGTGCAGAGG - Intronic
1019959372 7:4445916-4445938 GTGTGTATATGTATGTGCAGAGG - Intergenic
1020033019 7:4946194-4946216 GTGTGTGCATGCGTGTGTGTGGG - Intronic
1020146013 7:5643654-5643676 GTGTATGCATTCTTTTGCTGTGG + Intronic
1021446696 7:20741775-20741797 GTGTGTGCATGTGTGTGTGGTGG - Intronic
1022293120 7:29022696-29022718 GTGTGTGCATACAAAGGCTGTGG - Intronic
1022335087 7:29414668-29414690 ACGTGTGCATGCGTGTGTTGGGG - Intronic
1022809909 7:33858643-33858665 TTGTGTGCATTCATCTCCTGTGG - Intergenic
1022860463 7:34361720-34361742 GTGTCTACATGCATGTGTTTGGG + Intergenic
1023189213 7:37561475-37561497 GTGTGTGTGTGTATGTGTTGGGG + Intergenic
1023572581 7:41587802-41587824 GTGAGTGTGTGCATGTGCGGGGG - Intergenic
1024336067 7:48206434-48206456 GTTTGTGTAAGCATGTTCTGTGG + Intronic
1024550945 7:50561996-50562018 GTGTGTGTATGCATGCACTTAGG - Intronic
1024883767 7:54118105-54118127 GTGTGTGCGTGCATGTGTGCAGG - Intergenic
1024970781 7:55068112-55068134 GTGTGTGTGTGCATGTGTGGTGG + Intronic
1028471318 7:91209663-91209685 GTGTGTGCAGTGATGTGCTAAGG - Exonic
1028762725 7:94512434-94512456 GTGTGAGTATGAGTGTGCTGAGG + Intronic
1028889198 7:95967902-95967924 GTATGTGCATGCTTGTGCGGGGG + Intronic
1029043614 7:97603659-97603681 GTGTGTGCATGTGTGTATTGTGG + Intergenic
1029297818 7:99555463-99555485 GAGTGTGCATTCGTGTGCTAGGG - Intronic
1029447251 7:100620683-100620705 GTGTGTGGATATCTGTGCTGGGG + Exonic
1029842500 7:103380998-103381020 GTGTGTGTATGCATGTGTGTGGG - Intronic
1029869850 7:103679160-103679182 TTGTGTGCTTGTATGTGTTGGGG - Intronic
1032023366 7:128422163-128422185 GTGTGTGTATGTGTGTGGTGTGG + Intergenic
1032202831 7:129835096-129835118 GAGTGGGCAGGCATGTGCTTTGG + Intronic
1032389039 7:131543923-131543945 GTGTGTGGCTGCATATGCAGAGG - Intronic
1032532585 7:132634457-132634479 GTGTGTGTGTGTGTGTGCTGGGG - Intronic
1033477374 7:141703564-141703586 GTGTATGTATGTATGTGATGTGG + Intergenic
1033600845 7:142887622-142887644 GTGTGTGTATGTATGTCATGGGG + Intergenic
1033768948 7:144526842-144526864 GTGTGTGTCTTCATGTGCTTAGG - Intronic
1034526850 7:151669819-151669841 GTGTGTGCCTGCAGGTGCACAGG - Intronic
1034550871 7:151819829-151819851 GAGTGTGCATGCAGCTCCTGCGG + Intronic
1034869547 7:154671849-154671871 GTGTGTGCATGTGTGTGTTGGGG - Intronic
1035019698 7:155793655-155793677 GTGTGTGAATGCATGTGTGTGGG - Intergenic
1035226125 7:157433297-157433319 GTGTGTGCAGGCATGTGTGAGGG - Intergenic
1035351387 7:158248599-158248621 GTATGTGCATGTATGTGATGTGG - Intronic
1035351394 7:158248719-158248741 GTAGGGGCATGCATGTGATGTGG - Intronic
1035351400 7:158248833-158248855 GTATGTGCATGTATGTGACGTGG - Intronic
1035351405 7:158248946-158248968 GTATGTGCATGTATGTGATGTGG - Intronic
1035368733 7:158364966-158364988 GTGTGTGAATGTGTGTGTTGTGG - Intronic
1035615508 8:997893-997915 TTGTATGCATGCATGTGCATGGG - Intergenic
1035643673 8:1202302-1202324 GTGTGTGTGTGTATGTACTGGGG + Intergenic
1035769392 8:2134774-2134796 GTGTGTGCCTGCATCTTCTTAGG + Intronic
1035979062 8:4348591-4348613 GTGTGTGCGTGGGTGTGTTGGGG + Intronic
1036018440 8:4814242-4814264 GTGTGTGTATGTGTGTGGTGGGG + Intronic
1036044942 8:5129345-5129367 GTGTGTGCATGCATGTGTTATGG + Intergenic
1036208894 8:6826337-6826359 GTGTGTGCACGCATGTAGTGTGG + Intronic
1036664042 8:10727329-10727351 GTGTGTGCATGCATGTGTCTGGG - Intronic
1036989111 8:13571591-13571613 GTGTATTCATTCATCTGCTGAGG + Intergenic
1037338920 8:17821141-17821163 GTATCTACATGCATGTGATGAGG + Intergenic
1037403235 8:18515068-18515090 GTGAGTGCATGCATGTGTAAGGG + Intergenic
1037408286 8:18566914-18566936 GTGTGTGCTTGCCTGTTCTGGGG + Intronic
1037817925 8:22121456-22121478 GTGTTTGGAGGCATGTCCTGAGG + Intronic
1037838937 8:22230605-22230627 GTGTGTACATGCCTGTCTTGGGG - Intronic
1038537947 8:28368036-28368058 GGGCGTGCATGTATGTGGTGGGG + Intronic
1038835612 8:31118236-31118258 GTATATGCATGTATGTGTTGCGG + Intronic
1039131827 8:34273594-34273616 CTGTGTACATACATGTACTGTGG + Intergenic
1039371189 8:36985638-36985660 GTGTGTGCATGCTTCTTCTTGGG - Intergenic
1039466466 8:37788513-37788535 ATGCGTGCATGCACGTGTTGGGG - Intronic
1039466477 8:37788589-37788611 GTGCGTGCATGCACATGTTGGGG - Intronic
1039583257 8:38683869-38683891 GTCTGTGTGTGCATGTGTTGAGG - Intergenic
1039763190 8:40600143-40600165 GTGTGTGTATACATGTATTGGGG + Intronic
1040486933 8:47882391-47882413 GCTTGTGCATGCATGTACAGTGG - Intronic
1040486939 8:47882484-47882506 GCTTGTGCATGCATGTACAGTGG - Intronic
1040537594 8:48323376-48323398 GTGGGTGGATGCATTTCCTGTGG + Intergenic
1040996276 8:53406010-53406032 GTGTTTCCATGCATGTACTTAGG + Intergenic
1041035945 8:53790654-53790676 GAGTGTGCTGGCATGTGCAGTGG - Intronic
1041928692 8:63264955-63264977 GTGGGGGCATGTCTGTGCTGGGG - Intergenic
1042112968 8:65401050-65401072 GTCTATCCATGCATATGCTGTGG + Intergenic
1042164543 8:65933098-65933120 GTGTGTGCATGCATGGGGGAGGG + Intergenic
1042206670 8:66336404-66336426 GTGTGTGCATGCACGTGCCTTGG - Intergenic
1042637105 8:70889683-70889705 GTTTCTGCATGCATTTGCTTAGG + Intergenic
1043370074 8:79581091-79581113 GAGTGCGCATGCTTCTGCTGTGG + Intergenic
1044823184 8:96172307-96172329 GTGTGTGTGTGTATGTGTTGTGG + Intergenic
1045480210 8:102585999-102586021 GTGGGTGGATGCCTGTTCTGTGG - Intergenic
1045710320 8:104975561-104975583 GTGTGCGCATGCACGTGCAGGGG - Intronic
1045844864 8:106622448-106622470 GTGTGTGTGTGTGTGTGCTGGGG - Intronic
1046373972 8:113351042-113351064 GTGTGTGCATGCCAGTGCTATGG - Intronic
1046455758 8:114458726-114458748 GTGTGTACATACATGTGTTACGG - Intergenic
1046530768 8:115442585-115442607 GTGTGTGCATGTGTGTGTTTGGG + Intronic
1047591742 8:126334428-126334450 GTGTGTGTGTGTGTGTGCTGTGG - Intergenic
1047684923 8:127295238-127295260 GTGTTTGCAAGCATGGGCTGCGG + Intergenic
1047761458 8:127957792-127957814 GTGTGTGTGTGCATGTTCAGGGG - Intergenic
1047866889 8:129034688-129034710 CTCTGTGCAAGCATGTGTTGGGG - Intergenic
1048254127 8:132892655-132892677 GTGTGTGTATGTGTGTGCTGTGG + Intronic
1048254142 8:132892825-132892847 GTGTGTGTATGTGTGTGGTGTGG + Intronic
1048257659 8:132917402-132917424 GTGTGTGTATACCTGTGCTGAGG + Intronic
1048287452 8:133152929-133152951 ATGTGTGCTTACATGTGCTAGGG + Intergenic
1048454819 8:134568046-134568068 GTGTGTGCACTCATGTGCTGGGG - Intronic
1048865369 8:138757032-138757054 GTGTGTGCACGTGTGTGCAGGGG - Intronic
1048994215 8:139781720-139781742 GTGTGTGCCTGTGTGTGCGGTGG + Intronic
1049197453 8:141323572-141323594 GTGTGTGTGTGCCTGTGCAGTGG - Intergenic
1049342872 8:142123053-142123075 GTGTGTGCGCACATGGGCTGTGG - Intergenic
1049452367 8:142669194-142669216 GTGTGTGCGTGTGTGTGTTGGGG + Intronic
1049494954 8:142925608-142925630 GGGTGTGGGTGCCTGTGCTGGGG + Intergenic
1049525549 8:143124716-143124738 GTGTGTGCATACATGTGTGAGGG - Intergenic
1049531866 8:143159145-143159167 GTGTGTGCACGCACGTGCATGGG - Intronic
1049623093 8:143607403-143607425 GTGAGTGCGTGCATGTGCATGGG - Intronic
1050042078 9:1506611-1506633 GTGTGTGCACGTGTGTGGTGTGG + Intergenic
1050367116 9:4882842-4882864 GTGTGTGCATGTGTGTGCATAGG - Intronic
1050402292 9:5269114-5269136 GTGTGTGTTTGCCTTTGCTGTGG - Intergenic
1050485880 9:6134247-6134269 GTGTGTGCATGCACGTGTGACGG + Intergenic
1051576175 9:18618246-18618268 ATGTGTGCATGCATGTGTGTAGG - Intronic
1051868623 9:21711005-21711027 GTGTGTGCTTGCGTGTGTGGGGG + Intergenic
1052261886 9:26526232-26526254 CTGTGTGCATGTATGTGCATTGG + Intergenic
1052335207 9:27312261-27312283 GTGTTTGTGTGCATGTGTTGGGG + Intergenic
1052440185 9:28486555-28486577 GTGTGTGCATGCATGTATGTGGG + Intronic
1052861698 9:33441724-33441746 GTGTGTGCATGTGTGTGCAGGGG - Exonic
1053286893 9:36855546-36855568 TTGTGTGCATGCGTGAGGTGGGG + Intronic
1055494933 9:76844600-76844622 GTGTGTGTATGTATGTGGAGGGG - Intronic
1055839039 9:80480511-80480533 GTGTGTACATGTGTGTGGTGAGG + Intergenic
1055979779 9:81990610-81990632 GTATGTGAATGAATGTGTTGGGG + Intronic
1056450844 9:86715522-86715544 GTGTCTGCATGCATGGGGAGGGG + Intergenic
1056693579 9:88827957-88827979 GCATGCGGATGCATGTGCTGAGG + Intergenic
1056700781 9:88905562-88905584 GTGTGGGCATGTATGTGATTTGG + Intergenic
1056705406 9:88948381-88948403 ATGTGTGCACGCATGTGCATGGG + Intergenic
1057221181 9:93258857-93258879 GTCCTTGCATGCAAGTGCTGTGG + Intronic
1057461145 9:95263231-95263253 GTGTGTGCAGCCCTGTTCTGAGG - Intronic
1057523709 9:95781488-95781510 GTGTGTGTGTGCATGTATTGGGG - Intergenic
1058454568 9:105127172-105127194 GTGTGTGTGTGCATGTGCAGGGG - Intergenic
1058562158 9:106241677-106241699 GTGTGAGTGTGCATGTGGTGTGG + Intergenic
1058983970 9:110195070-110195092 GTGTGTGCATGTGTGTGTGGAGG - Intronic
1059537454 9:115094865-115094887 GTGTGTGCGTTTATGTGCTGGGG + Intronic
1059794043 9:117671587-117671609 GTGTATGCATGTATGTGTTTAGG - Intergenic
1060378445 9:123140825-123140847 GTGTGTGCATGATTGTGCACAGG + Intronic
1060402432 9:123356456-123356478 GTGGGTGCAGGCCTGAGCTGTGG + Intronic
1060442157 9:123651375-123651397 GTGTGTACGTGCATGTGCTCAGG - Intronic
1060473928 9:123971083-123971105 GTGTGTGCATGCATCCGGTGGGG - Intergenic
1060521710 9:124297794-124297816 GTGCCTGCACGCATGTGCTAAGG + Intronic
1060768256 9:126311120-126311142 GTGTTTCCCTGCATCTGCTGAGG - Intergenic
1060816310 9:126637314-126637336 GTGTGTCCCTGTGTGTGCTGTGG + Intronic
1060826854 9:126692637-126692659 GTGTGTGCGTGCATACGCTGTGG + Intronic
1060826870 9:126692814-126692836 GTGTGTGCATGCCTGTGCTGTGG + Intronic
1060887978 9:127168919-127168941 GCGTGTGCTTGTGTGTGCTGGGG - Intronic
1061005187 9:127924901-127924923 GTGTGTGCGTGCATGTGTGTGGG - Intronic
1061006095 9:127929196-127929218 GTGTGTGCATGTGTGCGCAGTGG - Intronic
1061696439 9:132378722-132378744 GTGAGTGCTTGCATGTGGTGTGG + Intronic
1061917765 9:133764162-133764184 GTGTGTGCATGTCTATGTTGGGG + Intronic
1062195313 9:135269911-135269933 ATGTGGGCATGTGTGTGCTGTGG - Intergenic
1062288507 9:135784396-135784418 GTGTGTGTATGCATGAGGGGTGG + Intronic
1062325558 9:136010915-136010937 GTGTGTGCAGGGGTGTGGTGAGG - Exonic
1062325560 9:136010925-136010947 GTGTGTGCGTGTGTGTGCAGGGG - Exonic
1062598201 9:137308473-137308495 GTGTGTGCCGTCATGTCCTGGGG + Intronic
1062709099 9:137963268-137963290 GTGTGTCTTTGCATGTGATGTGG + Intronic
1185776515 X:2807211-2807233 ATGTGTGCATGCTTGTGCTTGGG + Intronic
1185826873 X:3259769-3259791 GTTTGTGTATGCATGAGCTTTGG + Intergenic
1186006974 X:5083151-5083173 GTGTGTGCATACATGTTCATGGG - Intergenic
1186377438 X:9019817-9019839 GTGTGTGTGTCCATGGGCTGGGG - Intergenic
1186408815 X:9327674-9327696 GTGCATGCATGCATGTGCTGTGG - Intergenic
1186898407 X:14028705-14028727 GTGTGTTCATTGCTGTGCTGGGG - Intronic
1187308922 X:18122241-18122263 GTGTGTGTATGTGTGTGTTGAGG - Intergenic
1187452749 X:19413159-19413181 GTGTGTGTGGGCATGTGGTGAGG - Intronic
1187880389 X:23841710-23841732 TTGTGTGCATGCATGTGAGGAGG - Intronic
1188231791 X:27673042-27673064 GTGTGTGTATGTGTGTGGTGGGG - Intronic
1188536114 X:31198885-31198907 GTGTGTGCATGTATGTGTTTTGG + Intronic
1188668045 X:32848995-32849017 GTGTGTATGTGCATGTGCTGGGG + Intronic
1188747022 X:33857958-33857980 GTGTGTACATGCATGAGCACTGG - Intergenic
1189241709 X:39529675-39529697 GTGTGTGCGTGTGTGTGGTGGGG - Intergenic
1189463016 X:41257688-41257710 GTGTGTGCATGCATGCATGGGGG - Intergenic
1189761351 X:44324553-44324575 GTGTGTGTATGCAGGGGTTGGGG - Intronic
1189842622 X:45097087-45097109 GTTTCTGCATTCATTTGCTGAGG - Intronic
1190711634 X:53075914-53075936 GTGCGTGCATGTATGTGTAGCGG + Intronic
1190908299 X:54749792-54749814 GTGTGTGCTTCCATGTCCTTGGG + Exonic
1191957949 X:66666791-66666813 GTGTGTGTGTGCATGTGTAGGGG + Intergenic
1192038453 X:67591078-67591100 ATGTGTATATGCATGGGCTGTGG + Intronic
1192634673 X:72806052-72806074 GTCTGTGCATACATGTGCATGGG - Intronic
1192647040 X:72914749-72914771 GTCTGTGCATACATGTGCATGGG + Intronic
1193191501 X:78576290-78576312 GTGTGTGCGTGCATGTGTGAAGG - Intergenic
1193684892 X:84565779-84565801 GGGTGTGAATGGATGTGCAGAGG + Intergenic
1193976898 X:88132024-88132046 GTGTGTGTCTGCAGCTGCTGAGG + Intergenic
1194047456 X:89025919-89025941 GTGTGTGTCTGTATGTACTGTGG - Intergenic
1194428723 X:93773854-93773876 CTTTGAGCATGCATATGCTGTGG + Intergenic
1194598695 X:95892557-95892579 GTGTGTGTATGTGTGTGTTGGGG + Intergenic
1194712102 X:97248212-97248234 GTGTGTGCATACATTTTCTGAGG + Intronic
1195922580 X:109998333-109998355 GTGTGTGCGTGCACGTGCTTGGG + Intergenic
1197288318 X:124623342-124623364 GTGTGTGCATGAGTGTGTTTGGG + Intronic
1197631913 X:128870763-128870785 GTATGTGCATATATGTGTTGGGG - Intergenic
1197827582 X:130606476-130606498 GTGTGTGTATGTATGTGCATGGG - Intergenic
1198116780 X:133551851-133551873 GAGGGTGCAGGCAGGTGCTGGGG - Intronic
1198135733 X:133748571-133748593 GTGTGTGAATACATGTGTTGGGG - Intronic
1198671802 X:139089146-139089168 GTGTGTGCACGCATGTGTGTTGG + Intronic
1198999871 X:142622636-142622658 GTGTGTGTGTGCATGGGGTGAGG + Intergenic
1199528605 X:148821847-148821869 TTGTGTGCATGTATGTGGGGGGG - Intronic
1199942448 X:152638817-152638839 GCGCGTGCATGCATGTGTTGAGG + Intronic
1200052135 X:153439540-153439562 GTGTGTGCATGTATAGGTTGTGG + Intergenic
1200485150 Y:3760348-3760370 GTGTGTGTCTGTATGTGGTGAGG + Intergenic
1201293463 Y:12444263-12444285 ATGTGTGCATGTTTGTGCTTGGG - Intergenic