ID: 1004138005

View in Genome Browser
Species Human (GRCh38)
Location 6:12987409-12987431
Sequence ATTTGTAATAGTTAGGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 204}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004138005 Original CRISPR ATTTGTAATAGTTAGGTAGA AGG Intronic
908423882 1:63986226-63986248 ATTTTTAAAAGGGAGGTAGAGGG - Intronic
909152393 1:72024800-72024822 ATTTGTAATCGTCAGGTTTAGGG - Intronic
909686973 1:78360473-78360495 ATTTGTATTAGGTAAGTAGTAGG + Intronic
911873027 1:103123416-103123438 ATCTATAATAGTTAGGTCCATGG + Intergenic
913011384 1:114687286-114687308 ATTTGTTTTAGATGGGTAGATGG - Intronic
914396784 1:147277244-147277266 ATTTGTAAAAGTTTGCAAGATGG + Intronic
916871652 1:168921231-168921253 ATTTGTAATATCTAGGTAAGTGG + Intergenic
918338333 1:183544840-183544862 TTTTTTAACAGGTAGGTAGAGGG - Intronic
921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG + Intronic
921957807 1:221002109-221002131 ATAGATAATAGATAGGTAGATGG - Intergenic
923601691 1:235409234-235409256 ATGTGTAATTGGTAGGCAGAAGG + Intronic
1064050026 10:12052065-12052087 CTTTGTAACATTTTGGTAGAAGG + Intergenic
1065156314 10:22873545-22873567 ATTTTTAATAGTTACTTAGTAGG - Intergenic
1065256396 10:23873520-23873542 ATGAGTTATAGTTAGGTAAACGG + Intronic
1066027480 10:31376570-31376592 AGTTGTAATAGTTAAGAAGTTGG + Intronic
1067152110 10:43745126-43745148 ATTTGCAAAAGTTAGCTACATGG - Intergenic
1067515370 10:46936269-46936291 ATTTCAAATAATTAGGAAGAGGG - Intronic
1067646882 10:48115541-48115563 ATTTCAAATAATTAGGAAGAGGG + Intergenic
1072896393 10:99370993-99371015 ATGTGTATTAGGTAGGCAGAGGG + Intronic
1073585857 10:104709192-104709214 GTTGGAAATAGTGAGGTAGAGGG + Intronic
1074647524 10:115476815-115476837 ATTTCTAGTAGTTAGGTATAAGG - Intronic
1074989321 10:118688816-118688838 AATTGTAATTGTTAGGTGCATGG - Intronic
1077981457 11:7305131-7305153 ATTTGTAGAAATTGGGTAGAAGG + Intronic
1078768363 11:14321965-14321987 ATTTATTATAGCTAGGTAGATGG - Intronic
1079549538 11:21676970-21676992 ATTTGTGATAGTTAGGGTGAGGG + Intergenic
1081150428 11:39622329-39622351 ATTTATTATAGTTAGATAAATGG - Intergenic
1082890636 11:58134944-58134966 ATTTGTAATTTTTTGGGAGAGGG + Intronic
1086296189 11:85370792-85370814 ATTTGACATGTTTAGGTAGATGG + Intronic
1087334014 11:96819889-96819911 ATTGGCAATAGTTACCTAGATGG - Intergenic
1087436774 11:98129682-98129704 ATTTGTAATAGCAATGTAAATGG + Intergenic
1088306162 11:108410460-108410482 ACTTGGAATGGTTAGGTAGAAGG - Intronic
1088629135 11:111757319-111757341 ATTTGTAATATTTTGGAAGTTGG - Intronic
1090474461 11:127007005-127007027 ATTTGGAATATTTGGGTAGGAGG - Intergenic
1092990714 12:13896234-13896256 ATGAGTAATAGTGAGGAAGATGG + Intronic
1093237710 12:16631395-16631417 CTTTGTAATTTTTAGGTACAAGG - Intergenic
1093322289 12:17727135-17727157 ATTTGGAATAATTAAGCAGAAGG - Intergenic
1095543619 12:43340393-43340415 ATTTGTCATAGTAGGGAAGATGG - Intergenic
1095579637 12:43782498-43782520 ATTTTTAATAATTATGTATACGG - Intronic
1096056481 12:48656858-48656880 ATTTTTAATTCTTAGGAAGAAGG - Intronic
1100222352 12:92519076-92519098 TTTTGAAATTGTTAGGTATATGG - Intergenic
1100505301 12:95214672-95214694 GTTTGTAATAGTTAGTAAAATGG - Intronic
1101225985 12:102688667-102688689 ATTTTCCCTAGTTAGGTAGATGG + Intergenic
1101887807 12:108682691-108682713 ATTTTTAAATGTTAGGTACAAGG - Intronic
1102843827 12:116155915-116155937 ATTAGAAATAGTAAGGTGGAGGG + Intronic
1104178993 12:126359954-126359976 ATATGTAATAATTTGGTATATGG - Intergenic
1105994167 13:25654373-25654395 ATTTGTAATTTTTATGGAGATGG + Intronic
1109012771 13:56972187-56972209 ATTTGACATGGTTAGGTATACGG + Intergenic
1109177163 13:59170773-59170795 ATTTGTAATAATTTGGAAAATGG - Intergenic
1109385171 13:61620090-61620112 ATTTTCAATGTTTAGGTAGAAGG + Intergenic
1109788819 13:67220440-67220462 ATGTGAAATAGTAAAGTAGAGGG - Intronic
1110093894 13:71490700-71490722 ATTTATGATAGCTAGGTAAATGG - Intronic
1110601716 13:77382290-77382312 AGTTGTAATAATTAGGAATAAGG - Intergenic
1110790746 13:79584054-79584076 AAGTGTACTATTTAGGTAGAAGG + Intergenic
1110941044 13:81348834-81348856 ATTTGTAAAAGTCATGTGGAAGG - Intergenic
1111523948 13:89442399-89442421 ATTTATAAAAGTGAGGGAGATGG + Intergenic
1113177918 13:107587516-107587538 ATTTGTTATAGCTGGGCAGAGGG + Intronic
1114191940 14:20446162-20446184 AGTTGGAAAAGGTAGGTAGATGG + Intergenic
1114957643 14:27844613-27844635 ATTTGTAATACTTCGGTTCATGG + Intergenic
1115523973 14:34260842-34260864 ATTTGTAAGAATTAACTAGAGGG - Intronic
1116113896 14:40623613-40623635 ATTTATCATATTTAAGTAGAAGG + Intergenic
1117122176 14:52579859-52579881 TTTGGTATTTGTTAGGTAGAGGG - Intronic
1117510954 14:56450067-56450089 TTTTGGAAAAATTAGGTAGAGGG - Intergenic
1118511337 14:66477484-66477506 TTTTGTAACAATAAGGTAGAAGG - Intergenic
1119307401 14:73618668-73618690 TTTTGAAATATTTAGGTATAGGG + Intronic
1120112099 14:80569576-80569598 ATTTGAAATAATTTGGTAAATGG - Intronic
1120444293 14:84574661-84574683 AATTGAAATAATTAGGTAAAAGG + Intergenic
1120566092 14:86059206-86059228 GTTTGCAATAGTTAGTTATAAGG + Intergenic
1123809680 15:23910657-23910679 AATTCTAATAGCTAGGTAGAAGG + Intergenic
1127039416 15:54957444-54957466 TTTTGAAATAGTTATTTAGAAGG + Intergenic
1127718209 15:61672176-61672198 ATTTGTAAAAGTTAGTTGAAAGG - Intergenic
1128860836 15:71070562-71070584 ATTTGTATTTATTAGGTAAATGG + Intergenic
1130372055 15:83293472-83293494 ATTTGTCATTGTTTGGTTGATGG - Intergenic
1131601164 15:93850427-93850449 ATTTTCAAAAGTGAGGTAGAAGG - Intergenic
1131627299 15:94134931-94134953 CTTTGTAATACTTAGGGAGCAGG + Intergenic
1133963434 16:10514123-10514145 ATTTGGGATAGTTAAGTAGTAGG + Intergenic
1135919953 16:26640993-26641015 ATTTTTCATGGGTAGGTAGATGG - Intergenic
1138733010 16:59216789-59216811 ATTTGTAATACCTATGTAAAAGG - Intergenic
1138854226 16:60668354-60668376 ATTTGTAAAATGTAGTTAGAAGG - Intergenic
1138886374 16:61084286-61084308 ATTTGTTACAGTAAGCTAGATGG - Intergenic
1139819685 16:69711437-69711459 ATTGGTAACGGCTAGGTAGAGGG - Intronic
1143170873 17:4929555-4929577 ATAAGTAAAAGTTAGGCAGAAGG + Intergenic
1143671858 17:8402161-8402183 ATTTTTAATAATTGGATAGATGG + Intergenic
1145400616 17:22529114-22529136 TGTTGTAATTGTTAGGAAGAGGG - Intergenic
1146698037 17:34926500-34926522 ATTTGTTAAAGCTAGGTGGAGGG + Intergenic
1146960710 17:36974155-36974177 ATTTTTAATATTTTGGTACATGG + Intronic
1148252317 17:46094446-46094468 CTTTGCAATAGTTAAGAAGAGGG + Intronic
1148375133 17:47136895-47136917 ATCTGCAAAAGTTTGGTAGAAGG + Intronic
1149839810 17:59951422-59951444 AGTTGTATTATTTAGGTATACGG - Intronic
1150708762 17:67511824-67511846 ATTTTTAATACTTTGATAGATGG + Intronic
1152075988 17:78160199-78160221 ATTTGTAATTTTTAGGTTCAGGG + Intronic
1152765825 17:82138063-82138085 ATTTGAAATAATTAGGTACAAGG + Intronic
1155521106 18:26669951-26669973 ATTTGTAAGAGGTAAGGAGAGGG + Intergenic
1155945950 18:31851655-31851677 ATGTATAAGAGTTACGTAGAGGG - Intronic
1155981473 18:32184646-32184668 ATTTGTAAAAGTTAGGTTAGAGG - Intronic
1157904526 18:51557476-51557498 ATTAGTTATAGCTTGGTAGAAGG + Intergenic
1158210587 18:55045144-55045166 ATCTATAATAGGTAGGGAGATGG + Intergenic
1164106611 19:22112387-22112409 ATTTGACATGTTTAGGTAGATGG - Intergenic
1164737481 19:30552622-30552644 AGTTTTAAAAGTTAGGAAGAAGG - Intronic
1168596313 19:57680717-57680739 ATTTGCAATAGTAATGTATATGG + Intergenic
931386126 2:61799083-61799105 CTTTGTAAGAGATAGGCAGAGGG + Intergenic
931663605 2:64593601-64593623 TTTTTTAATAGTTAGGGAAATGG - Intergenic
932017092 2:68040483-68040505 ATTTCTAATTGCTAAGTAGAAGG + Intergenic
933016573 2:77135779-77135801 ATTTGTAGTAGTTAGTTTCAGGG - Intronic
934479639 2:94623290-94623312 ATTTGTAATACTTCGGTTCATGG - Intergenic
934683321 2:96302085-96302107 ATGTGTAATGGTTAGGAACATGG + Intronic
939091308 2:137782861-137782883 GTGTGTAATAGCTAGGTAGGAGG + Intergenic
940172837 2:150847350-150847372 ATTTTCAGTATTTAGGTAGATGG - Intergenic
940678171 2:156750639-156750661 ATTTGGAAATGTTAGGTATACGG + Intergenic
940844048 2:158620611-158620633 ATTTTTAATTGTTTGGAAGATGG + Intronic
942161802 2:173196711-173196733 ATTTCTAATAGGAACGTAGATGG - Intronic
943166237 2:184329681-184329703 ATTTGTAATTTTTAAATAGATGG + Intergenic
943419849 2:187656512-187656534 ATTTGACATATTTAGGTACATGG + Intergenic
943496149 2:188623140-188623162 ATTTGTAAGATTTAGATAAATGG - Intergenic
945043126 2:205759107-205759129 ATTTATAATAGCTTGGAAGAAGG + Intronic
945743502 2:213691889-213691911 ATTTGTAAAAGTAATGAAGAAGG + Intronic
946775324 2:223133159-223133181 ATTAGTAATATTTAGAAAGATGG + Intronic
947818706 2:233055812-233055834 ATAGGTAATAGTTAGACAGATGG + Intergenic
1168885426 20:1249363-1249385 ATTTGTAATAGTTATGATGCAGG + Intronic
1169818598 20:9684781-9684803 AATTCTAATAAATAGGTAGAAGG + Intronic
1177033274 21:16010361-16010383 ATTTATAATATTTAGATACATGG - Intergenic
1177261942 21:18740753-18740775 ATTAATAAAATTTAGGTAGAGGG + Intergenic
1177356807 21:20019015-20019037 CTGTTTAATAGATAGGTAGATGG - Intergenic
1177822031 21:26041531-26041553 ATTTGTAAGAGTTATTTGGAGGG - Intronic
1178006834 21:28231108-28231130 ATTTGCAAAAGACAGGTAGATGG - Intergenic
1178846568 21:36178757-36178779 ATTTTTAAAAGATAGGTAAATGG - Intronic
1180938158 22:19639546-19639568 GGTTGTAAGAGTTAGATAGAGGG - Intergenic
949259633 3:2090503-2090525 ATTTATAATAGTTACTTTGAAGG + Intergenic
949328721 3:2896909-2896931 CTTTGTAATAGTAATTTAGAGGG + Intronic
950611435 3:14129536-14129558 ATTGGTGAAAATTAGGTAGAAGG - Exonic
950956286 3:17056901-17056923 ATTTGTATAAGTTAAGCAGAAGG + Intronic
951894361 3:27596862-27596884 ATTGCTTATAGTTAGTTAGAAGG + Intergenic
951971817 3:28454201-28454223 ATGTGTAAAAATAAGGTAGAAGG - Intronic
953176628 3:40559381-40559403 GTGTGTAATAGGTAGGTAGAAGG - Intronic
957423264 3:80000948-80000970 ATTGATAATATTTAAGTAGATGG - Intergenic
959024618 3:101226525-101226547 ATTTGTTATTGTTGGGTAGAAGG - Exonic
959220506 3:103513074-103513096 ATGGGTAATAGCTAGGTTGATGG - Intergenic
964820987 3:160769208-160769230 AATTGTATTAGCTAGGAAGAAGG + Intronic
965342734 3:167510610-167510632 ATTTGTGAGAAGTAGGTAGATGG - Intronic
965513004 3:169589809-169589831 ATTTGTTAAAAGTAGGTAGATGG - Intronic
965690497 3:171351690-171351712 GTCTGTAATACTTAGGTGGAGGG - Intronic
967123409 3:186403999-186404021 GTTTGTAATTGTTAAGTATACGG - Intergenic
972969714 4:44558495-44558517 GTTTGTAAAAGATAGGGAGAGGG + Intergenic
974587559 4:63898886-63898908 ATTTGTAAAAGCTAGTTAAATGG + Intergenic
975502514 4:75102164-75102186 ATATGTAAGAGTTTGTTAGAGGG + Intergenic
976795430 4:88926855-88926877 ATTTTTAATAGCATGGTAGAGGG - Intronic
977821547 4:101477817-101477839 CTTTGTTTTAGCTAGGTAGATGG - Intronic
978842850 4:113235046-113235068 TTTGGTAATATTTAGGAAGAAGG - Intronic
979018283 4:115462856-115462878 ATTTTTAATACTTAGCTATATGG + Intergenic
979862720 4:125714633-125714655 TGTTGTAATAATAAGGTAGAAGG + Intergenic
980729396 4:136807054-136807076 ATTTCTAATGGTTAGGTACACGG + Intergenic
980832789 4:138152053-138152075 CTTTGTAAAAGGAAGGTAGAAGG + Intergenic
981854103 4:149266848-149266870 ATTTTAAATAGTTAGGAAGAGGG - Intergenic
982975797 4:162058240-162058262 ATTTCTAAGAGTTAGGGACAAGG + Intronic
987777963 5:22394157-22394179 ATTTGTAATCCTTTGGCAGAAGG - Intronic
987890196 5:23866256-23866278 ATTTGACATATTTAGGTACATGG + Intergenic
989235389 5:39142234-39142256 ATTTTTAATAGGTATGGAGAAGG - Intronic
989717586 5:44482508-44482530 ATTGGTAATAGTTAGCTAACAGG - Intergenic
990920442 5:60959925-60959947 ATTTGTATAAGTAAGGGAGAAGG - Intronic
991438537 5:66621678-66621700 ATTAGTATTTGTTGGGTAGACGG - Intronic
992551339 5:77863147-77863169 ATTTGTATTAATTTGGAAGATGG - Intronic
992988854 5:82262691-82262713 ATTTGTAAAAATTAGAAAGAGGG - Intronic
993502539 5:88679417-88679439 ATCTGTAAAATTTAGGTAAAAGG - Intergenic
993804418 5:92386887-92386909 ATTTGAACTAGTTATGTATAAGG - Intergenic
994252762 5:97556175-97556197 ATTTGCAATAGATAGATAAATGG + Intergenic
994505575 5:100639430-100639452 ATTTGTCATGTTTAGGTACATGG + Intergenic
995048471 5:107674135-107674157 ATTTTTAATAATTAGGCAGATGG - Intergenic
995078643 5:108018327-108018349 ATTTGTAATAATAGGGTAGGGGG + Intronic
995708049 5:115005410-115005432 ATTTTTAATAGCTATGGAGATGG - Intergenic
996718094 5:126603501-126603523 ATTTTTAAAAATTAGGTAGGTGG + Intronic
996740653 5:126795795-126795817 TTTTGTATTTGTTAGTTAGACGG + Intronic
999567094 5:152876450-152876472 CTTTGAAAGAGTTAGATAGATGG + Intergenic
1000456589 5:161456988-161457010 ATTTGCAATAGATAGGTAAAAGG - Intronic
1001005559 5:168046859-168046881 GTTTGAAATAGTTAGGGAGGTGG + Intronic
1004138005 6:12987409-12987431 ATTTGTAATAGTTAGGTAGAAGG + Intronic
1009469953 6:64020108-64020130 AGTAATAACAGTTAGGTAGAAGG + Intronic
1011203332 6:84862617-84862639 GTGTGTAATAGTTAGATTGATGG - Intergenic
1011384975 6:86786093-86786115 ATTTGTTTTAGTTTGGAAGAAGG + Intergenic
1012106197 6:95162256-95162278 TTTTGTATTAATTAGGTAAATGG + Intergenic
1012496540 6:99839388-99839410 ATGTCTAATAGTTGGCTAGAAGG - Intergenic
1012594759 6:101026293-101026315 ATTTGACATATTTAGGTACATGG + Intergenic
1013122518 6:107153510-107153532 ATTTGTAATACTTTGGTTTAAGG - Exonic
1014338360 6:120169235-120169257 CTTGGTAATATTTAGCTAGATGG + Intergenic
1014532984 6:122581859-122581881 ATTTGTAATGGATAGAAAGATGG - Intronic
1014595161 6:123327741-123327763 ATTTGGAATATTTATGAAGATGG + Intronic
1015472574 6:133622443-133622465 ATTTTAAACAGCTAGGTAGAAGG + Intergenic
1015645160 6:135379595-135379617 TTTTTAAATAGGTAGGTAGATGG - Intronic
1015946653 6:138508928-138508950 ATTTGTATTACTTGGGTAGATGG - Intronic
1017057192 6:150448183-150448205 ATTTTTAATAGTGAGAAAGATGG - Intergenic
1017873891 6:158508000-158508022 AATTGTAATACCTAGGTAGTTGG + Exonic
1020422276 7:8022050-8022072 ATTTCAAATATTTAGCTAGAGGG - Intronic
1021206236 7:17784866-17784888 ATTTCAAATAGTTAAGGAGATGG - Intergenic
1025199597 7:56953928-56953950 ATTTGGAATTGGCAGGTAGATGG + Intergenic
1025672349 7:63623005-63623027 ATTTGGAATTGGCAGGTAGATGG - Intergenic
1027659547 7:80972492-80972514 ATTTGAATTTGTTAGTTAGAAGG + Intergenic
1027707538 7:81553232-81553254 ATTTGTCATGTTTAGGTACATGG + Intergenic
1028006963 7:85585214-85585236 ATTTGTAATAGATACGTACATGG - Intergenic
1028894566 7:96026825-96026847 ATTTGTTTTAGTTAGGGAGGGGG - Intronic
1028969380 7:96840476-96840498 ATATTTATTAGTTTGGTAGATGG + Intergenic
1029910293 7:104138414-104138436 CTTTTTAAGAGTTAGGTAGCTGG + Intronic
1036927921 8:12925462-12925484 ATTTGAAATAGACAGATAGATGG - Intergenic
1039221422 8:35335206-35335228 ATTTGTAATAGTCAGAAAGGTGG - Intronic
1039669053 8:39575450-39575472 ATTTGTGATAGTTAATTAGTAGG - Intergenic
1044118495 8:88364819-88364841 ATTTGATTTAGGTAGGTAGAAGG - Intergenic
1045923933 8:107565772-107565794 GTTTGTAATATTCAGGGAGAAGG + Intergenic
1046401507 8:113711041-113711063 TTTTTTAATAAATAGGTAGATGG - Intergenic
1048144653 8:131829400-131829422 CTATGTAATATTTAGGTATATGG - Intergenic
1050367780 9:4888442-4888464 ATGTGGAATACTTAGGTAGAGGG + Intergenic
1051067967 9:13127834-13127856 AATTTCTATAGTTAGGTAGAAGG - Intronic
1052243314 9:26302029-26302051 TTTTATAATGGTTAGGTAGTGGG - Intergenic
1053350088 9:37408326-37408348 ATTTGTAAGAGTGGGGAAGAAGG + Intergenic
1053678188 9:40460294-40460316 ATTTGTAATACTTCGGTTCATGG + Intergenic
1054285536 9:63164649-63164671 ATTTGTAATACTTCGGTTCATGG - Intergenic
1054291266 9:63295831-63295853 ATTTGTAATACTTCGGTTCATGG + Intergenic
1054389286 9:64600371-64600393 ATTTGTAATACTTCGGTTCATGG + Intergenic
1054506431 9:65916002-65916024 ATTTGTAATACTTCGGTTCATGG - Intergenic
1060465524 9:123901381-123901403 ATTTTTAATAGGAGGGTAGAGGG - Intronic
1185670083 X:1801982-1802004 ATATATAATAGATAGGTAGTAGG - Intergenic
1186745822 X:12567584-12567606 AATTGAAATAGTTGGGTAGATGG + Intronic
1192752871 X:74012518-74012540 ATTATTAATAGTTTTGTAGATGG - Intergenic
1196759246 X:119186572-119186594 GTTTGTAATAGTTGTGTGGACGG - Intergenic
1198645583 X:138802422-138802444 ATTGGGACTGGTTAGGTAGAGGG - Intronic
1198772794 X:140148615-140148637 ATTTTTAAAAAATAGGTAGAGGG - Intergenic