ID: 1004138218

View in Genome Browser
Species Human (GRCh38)
Location 6:12989600-12989622
Sequence CCTGTAGGATATCCAAAGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004138215_1004138218 -8 Left 1004138215 6:12989585-12989607 CCAGTCTCAACACTGCCTGTAGG 0: 1
1: 0
2: 0
3: 12
4: 153
Right 1004138218 6:12989600-12989622 CCTGTAGGATATCCAAAGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004138218 Original CRISPR CCTGTAGGATATCCAAAGTC CGG Intronic
No off target data available for this crispr