ID: 1004141641

View in Genome Browser
Species Human (GRCh38)
Location 6:13023513-13023535
Sequence TAACCTCAGCAGAGGCTCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004141638_1004141641 24 Left 1004141638 6:13023466-13023488 CCACAAAAGTAATTATAAAATCA 0: 1
1: 2
2: 6
3: 76
4: 843
Right 1004141641 6:13023513-13023535 TAACCTCAGCAGAGGCTCTTGGG No data
1004141637_1004141641 25 Left 1004141637 6:13023465-13023487 CCCACAAAAGTAATTATAAAATC 0: 1
1: 0
2: 4
3: 67
4: 735
Right 1004141641 6:13023513-13023535 TAACCTCAGCAGAGGCTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004141641 Original CRISPR TAACCTCAGCAGAGGCTCTT GGG Intronic
No off target data available for this crispr