ID: 1004143623

View in Genome Browser
Species Human (GRCh38)
Location 6:13044797-13044819
Sequence CAGCGGGTGTCAGTCAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004143623_1004143629 29 Left 1004143623 6:13044797-13044819 CCAGGCCTGACTGACACCCGCTG 0: 1
1: 0
2: 1
3: 17
4: 146
Right 1004143629 6:13044849-13044871 CTTAGCAGATAATGTCCTACCGG 0: 1
1: 0
2: 2
3: 8
4: 88
1004143623_1004143627 4 Left 1004143623 6:13044797-13044819 CCAGGCCTGACTGACACCCGCTG 0: 1
1: 0
2: 1
3: 17
4: 146
Right 1004143627 6:13044824-13044846 CGTAATTGTAGCTTGAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004143623 Original CRISPR CAGCGGGTGTCAGTCAGGCC TGG (reversed) Intronic
900414792 1:2530021-2530043 GAGGGGGTGTCAGGCTGGCCCGG + Intronic
901391617 1:8949713-8949735 CAGCAGGTGACAGGCAGGACAGG + Intronic
903685847 1:25131285-25131307 CAATGGGTGTCAGGCAGTCCTGG + Intergenic
904397855 1:30234710-30234732 CAGCTGGTGTCACTCAGGGCTGG - Intergenic
904433632 1:30480263-30480285 CAGCAGGGGTCAGACAGGACAGG + Intergenic
904497231 1:30893764-30893786 CAGCTGGGGTCAGAGAGGCCAGG - Intronic
905524244 1:38624420-38624442 CAGCGGGAGTCAGTGCGGGCTGG + Intergenic
906108226 1:43307243-43307265 CAGCGGGTGCCAGTGAAGCCAGG - Exonic
906558063 1:46730302-46730324 GAGCGCTTGTCAGGCAGGCCTGG - Intergenic
911038798 1:93576034-93576056 CAGCTGGTGTCCGTGAGGCAAGG + Exonic
911052883 1:93686632-93686654 CAGCAGGGGTCAGACAGACCTGG - Intronic
912687234 1:111777152-111777174 CAGCAGGTGGTAGTGAGGCCTGG + Exonic
914479597 1:148053507-148053529 CAGTGGCTTTCAGTCAGCCCAGG - Intergenic
915470645 1:156123845-156123867 CAGCAGCTGTGACTCAGGCCTGG + Intronic
917510198 1:175663273-175663295 ACGCTGGTGCCAGTCAGGCCGGG + Intronic
923451851 1:234125498-234125520 CACCTGCTGTCAGTGAGGCCGGG + Intronic
1064661814 10:17615248-17615270 CAGCAAGTGTCAGTCAGACATGG - Intronic
1064680710 10:17808738-17808760 GAGGGAATGTCAGTCAGGCCAGG - Intergenic
1065600059 10:27359096-27359118 CAGAAGCTGTCAGTCAGGACAGG + Intergenic
1066388111 10:34957721-34957743 CAGAGGCTGTCAGTCACGCCTGG - Intergenic
1069562332 10:69439537-69439559 CAGTGTGAGTCAGGCAGGCCTGG + Intergenic
1070544664 10:77442888-77442910 CAGCAGGTGTCAGACAGTCAGGG - Intronic
1071733198 10:88269512-88269534 CAGCAGGAGTCAGTTAGGCCAGG - Intergenic
1072017106 10:91359351-91359373 CAGCAGTTGTCAATCATGCCTGG + Intergenic
1073566873 10:104542709-104542731 CAGCAGGTGTCAATCAGACAAGG - Intergenic
1075735849 10:124664204-124664226 CTGCTGGTGTCAGGCAGCCCTGG - Intronic
1075736424 10:124667114-124667136 CAGCAGGTCTCAGTTTGGCCTGG - Intronic
1076406871 10:130218392-130218414 CAGCAGGTCTTTGTCAGGCCGGG + Intergenic
1077057515 11:602052-602074 CTGTGGGTTTCAGGCAGGCCTGG + Intronic
1077154596 11:1085685-1085707 CTGAGGGTCTCAGGCAGGCCCGG - Intergenic
1077202425 11:1317721-1317743 CAGCAGCTGTCAGACTGGCCAGG - Intergenic
1077219028 11:1407250-1407272 CAGCGGGAGCCAGTCAGAGCCGG - Intronic
1077402942 11:2367957-2367979 GTGCGGGTGCCAGCCAGGCCCGG - Intergenic
1077407862 11:2390733-2390755 CAGGGGGTGGCAGCTAGGCCTGG + Intronic
1078452323 11:11449473-11449495 CAGCAGGAGGCAGTCTGGCCGGG - Intronic
1079151569 11:17904399-17904421 CAGCGGGGCTCAGTCTGGCATGG - Intronic
1083224735 11:61277627-61277649 CAGAGGGTGGCAGTGAGGGCTGG + Intronic
1083662013 11:64255831-64255853 CAGGGGTTGTGAGGCAGGCCGGG - Intronic
1084184326 11:67463856-67463878 CTGAGGGTGTCTGTCAGGCGCGG + Exonic
1084266628 11:68008484-68008506 GAGCGGGTGCCAGGCAGGGCTGG - Intergenic
1084453027 11:69251247-69251269 CAGCTGGTAACAGGCAGGCCTGG - Intergenic
1084607567 11:70181327-70181349 CAGGGGGTGACACTCAGCCCCGG + Intronic
1087675092 11:101152524-101152546 CAGCGGGTGGGAGTCAGGTGGGG - Intergenic
1091344824 11:134845585-134845607 CAGCGTGTGCCAGTAATGCCAGG - Intergenic
1099461158 12:82923096-82923118 CAGCTGGTGGCAGTGTGGCCCGG - Intronic
1102228692 12:111247606-111247628 CAGCAGGTGTCACTGGGGCCTGG + Intronic
1103901853 12:124307501-124307523 AAGCAGGTGTCAGCCAGGCAAGG - Intronic
1105034241 12:132907448-132907470 CGGCGGGTGGCAGCCAGGACGGG - Intronic
1107000889 13:35543858-35543880 CAGCAGGTATCAGTCAGACATGG + Intronic
1108414036 13:50179359-50179381 CAGTGGGTGGCAGTCATGCTAGG + Intronic
1113769626 13:112899711-112899733 CAGCAGGTGCCAGTCAGCTCCGG - Intronic
1114529877 14:23388999-23389021 CAGCAGGTCGCAGTCATGCCGGG + Exonic
1114535237 14:23418350-23418372 CAGCAGGTCGCAGTCATGCCGGG + Exonic
1115911960 14:38267116-38267138 CAGCTGTTGTAAGGCAGGCCTGG + Intergenic
1117206021 14:53444417-53444439 GAGCCTGTGTCAGTCAGGTCTGG - Intergenic
1117822059 14:59659708-59659730 GAGCTGTTGTCAGGCAGGCCTGG - Intronic
1118076324 14:62303153-62303175 AAGCTGGGGTAAGTCAGGCCAGG - Intergenic
1121744505 14:96277796-96277818 CTGCAGGTACCAGTCAGGCCAGG + Intergenic
1122314514 14:100817880-100817902 CAGCCCTTGTCAGCCAGGCCTGG + Intergenic
1122891729 14:104735158-104735180 AAGGGGGTGTCAGCCAGCCCAGG + Intronic
1124159419 15:27255102-27255124 CAGCCGCTGTCAGGCAGCCCTGG - Intronic
1125721807 15:41848757-41848779 CAGCGCCTGTCAGTCAGCTCTGG - Intronic
1126043007 15:44610834-44610856 CTGGGGGTGTCAGTCAGGTATGG - Exonic
1130655839 15:85791735-85791757 AAGTGGGTGTCAGTCATGCCGGG - Intronic
1132518745 16:377859-377881 AAGGAGGTGTCAGCCAGGCCGGG + Intronic
1132672317 16:1106874-1106896 CATCGGGAGGCTGTCAGGCCGGG - Intergenic
1132873228 16:2124733-2124755 CAGCGGGTGTGCGCCAGGCCCGG + Intronic
1135856884 16:26019926-26019948 AAGTGGGTGTCAGTCAGGCTGGG - Intronic
1136028441 16:27485233-27485255 CTCCGGGTCTCAGCCAGGCCAGG - Intronic
1137570391 16:49562437-49562459 CATCGGGTGTGTATCAGGCCAGG - Intronic
1139371394 16:66471522-66471544 CAGTGGGTGTCACTCAGACCTGG + Intronic
1139972190 16:70783167-70783189 CAGCGAGGGTCAGCCAGGGCTGG + Intronic
1140113193 16:72020989-72021011 CAGCCGGTGTCGGGCAGGTCAGG + Intronic
1140126134 16:72120350-72120372 CAGACGGGGACAGTCAGGCCTGG + Intronic
1141671112 16:85492102-85492124 CAGCGGGTGCCAGACAGGCTTGG + Intergenic
1142428976 16:90016302-90016324 GAGAGGGTGTCAGACAGGCCTGG - Intronic
1147048669 17:37774066-37774088 CAACTGGTGTCAGGCAGACCTGG + Intergenic
1147200771 17:38799753-38799775 AGGCGGGTTTCTGTCAGGCCCGG - Exonic
1147927982 17:43956903-43956925 CAGCAAGTGTAATTCAGGCCAGG + Intronic
1149602670 17:57903346-57903368 CAGCCAGGGTGAGTCAGGCCAGG + Intronic
1150207162 17:63417772-63417794 GAGGGGGTGTCAGACAGACCTGG - Intronic
1151566643 17:74902267-74902289 CAGTGGGCATCAGCCAGGCCTGG - Intergenic
1152400643 17:80064562-80064584 CAGCGGGTGAGATTCAGCCCAGG + Intronic
1152845903 17:82599699-82599721 GAGCGGATGTGAGTCCGGCCAGG - Intronic
1158254768 18:55533403-55533425 CAGAGGAAGTCAGTCAGGGCAGG + Intronic
1159018431 18:63122265-63122287 AAGCGTGTGTCAGTGAGGTCAGG - Intergenic
1160070140 18:75621296-75621318 CTGCGGGTGACTGTCAGGGCAGG + Intergenic
1160753662 19:747164-747186 CAGAGGGTGGCAGGCTGGCCTGG - Exonic
1160937460 19:1603782-1603804 CAGCGTGGGTAACTCAGGCCTGG - Intronic
1161575788 19:5053568-5053590 CAGCGGGTCTCAGTGAGCCAGGG - Intronic
1163287044 19:16355442-16355464 GAGCGGGAGGCAGTCAGCCCCGG + Exonic
1165094362 19:33402402-33402424 CAGGTGGTGTGATTCAGGCCCGG - Intronic
1166347184 19:42173949-42173971 CAGGGGGTGACAGGCAGGCCAGG - Intronic
1168467107 19:56611861-56611883 CAGCAGGTGGGAGACAGGCCTGG - Intronic
943367582 2:186980789-186980811 AAGCCTGTGTCAGTAAGGCCAGG - Intergenic
1168937207 20:1675557-1675579 CAGGGGCTGTGAGTCAGGCTGGG + Intergenic
1170569443 20:17624724-17624746 AAGCTGGTGTCAGACAGGACAGG + Intronic
1171824626 20:29883728-29883750 CAGAGGGTGTGAGCCAAGCCAGG + Intergenic
1173182287 20:40814456-40814478 CTAAGGGTGTCAATCAGGCCTGG - Intergenic
1174163974 20:48571531-48571553 AAGCTGGAGTCAGTCAAGCCAGG - Intergenic
1175323682 20:58107686-58107708 CAGCAGGGGCCAGGCAGGCCAGG - Intergenic
1177355200 21:19998393-19998415 CAGCTGGTGACAATCAGCCCAGG + Intergenic
1179982951 21:44905927-44905949 CAGCTGGTGTCGGACAGGCTGGG - Intronic
1180956528 22:19743760-19743782 CAGGAGGTGGCAGTGAGGCCAGG + Intergenic
1181036606 22:20172639-20172661 CAGCGGGGGTGAGGCAGGCTGGG + Intergenic
1181437195 22:22917859-22917881 CAGCTGGTGTCAGGAATGCCAGG - Intergenic
1181888715 22:26042159-26042181 CACCAGGTGTCAGGCAGGCCTGG + Intergenic
1181918913 22:26304002-26304024 CAGAGCGTGGCAGTCAGTCCAGG - Intronic
1183697420 22:39431112-39431134 CAGGGGTTGTGAGTCAGGCTGGG + Exonic
1184759077 22:46534765-46534787 CAGTGAGTGTCAGTGAGGACAGG - Exonic
1185041785 22:48507914-48507936 CAGCTGGTGTGGGCCAGGCCAGG - Intronic
1185379970 22:50503783-50503805 AAGGGGGTGTCAGCCAGGCTGGG - Intronic
1185388167 22:50546058-50546080 CTGGGGGTGTCAGTAGGGCCTGG - Intergenic
950536286 3:13580887-13580909 CAGCAGGTGTCAGCCACGCCTGG - Intronic
952405172 3:32998773-32998795 CAGCAGGTGTCAGCCATGGCTGG - Intronic
953462728 3:43094585-43094607 CAGACAGTGTCAGTCAGACCAGG - Intronic
954369783 3:50164097-50164119 CAGCCTGGGTCAGCCAGGCCAGG + Intronic
955062692 3:55506914-55506936 CAGCAGCTGGCATTCAGGCCTGG - Intergenic
955430617 3:58840930-58840952 CAGCTGGAATCAGACAGGCCTGG - Intronic
961531964 3:127545368-127545390 CAGCGGGTGCCTCTCAGGCAGGG + Intergenic
966144548 3:176794924-176794946 CAGCCAGTGTCACTCAGGCTCGG - Intergenic
967214496 3:187198994-187199016 CAGCTGGCCCCAGTCAGGCCTGG + Intronic
968064879 3:195753092-195753114 CAGCGGCTGTCAGTGAAGGCTGG + Exonic
968479896 4:828668-828690 CAGGGTGTGTGAGCCAGGCCAGG + Intergenic
968691512 4:1992613-1992635 GAGTGGGTGTCAGGAAGGCCTGG - Intronic
969390705 4:6889700-6889722 CAGCGTGTGCCAGGCAGGCCAGG - Intergenic
969530799 4:7729198-7729220 CAGCTGGAGTCAGTGGGGCCCGG + Intronic
969733755 4:8973250-8973272 CAACGGGTGGCGGTCAGCCCAGG - Intergenic
972333771 4:38087385-38087407 GAGCAGGTGTAACTCAGGCCAGG - Intronic
975674118 4:76809890-76809912 CAGCTGGGATCAGCCAGGCCTGG - Intergenic
981172221 4:141637386-141637408 CAGTGCTTGGCAGTCAGGCCTGG + Intronic
986220595 5:5765530-5765552 CAGCCAGTGCCAGTCAGTCCTGG - Intergenic
998214755 5:140228761-140228783 CAGCGGGTGTCAGGCAGTCCTGG + Intronic
1002793094 6:449634-449656 CACAGGGTCTCAGGCAGGCCAGG - Intergenic
1004143623 6:13044797-13044819 CAGCGGGTGTCAGTCAGGCCTGG - Intronic
1005821950 6:29605929-29605951 AAGCTGCTGTCAGTCAGGCAAGG + Intronic
1007380808 6:41488913-41488935 CTGTGGGTGACAGCCAGGCCAGG - Intergenic
1007430759 6:41775419-41775441 CCGCCGATGTCAGACAGGCCAGG - Exonic
1007729937 6:43939616-43939638 CAGAGGCTGCCAGTCTGGCCTGG - Intergenic
1012579612 6:100850527-100850549 AATCTGGTGTCAGTGAGGCCTGG - Intronic
1015924069 6:138292112-138292134 CATCTGGTTTCAGTCATGCCAGG + Intronic
1016112513 6:140242507-140242529 CAGTGTGTATCAGTCAGGGCTGG - Intergenic
1017365631 6:153633306-153633328 CAGCCAGTCTCAGTCAGTCCTGG + Intergenic
1019100739 6:169627040-169627062 CAGCGGCTGTAACTCAGGACTGG + Intronic
1020034485 7:4956751-4956773 CAGCAGGTGTGGGACAGGCCCGG + Intronic
1020440580 7:8212681-8212703 CAGCTGGTGTCAGCAAGGGCGGG + Intronic
1029709480 7:102291849-102291871 CAGCGGGTGGGAGTCACTCCAGG + Intronic
1034711814 7:153199168-153199190 CAGCGGGGGACAGGCAGCCCTGG + Intergenic
1035108270 7:156459865-156459887 CAGTGGGTGGCAGGCAGGCCAGG - Intergenic
1035357426 7:158284887-158284909 CGGCGTGTGCCAGCCAGGCCAGG - Intronic
1036749626 8:11435590-11435612 CAGAGGGTGGCGGTCAGCCCGGG - Intronic
1036906439 8:12711848-12711870 CAACTGGTGGCAGTCAGCCCAGG + Intergenic
1037662453 8:20939529-20939551 GAGCAGGTGCCAGGCAGGCCAGG + Intergenic
1045308658 8:100981448-100981470 CAGAGGGTGTCAGCCAGGCATGG + Intergenic
1048549619 8:135422213-135422235 CAGAGGGAGGCAGTCAGGCTTGG - Intergenic
1054337776 9:63822826-63822848 CAGAGGGTGTGAGCCAAGCCAGG + Intergenic
1057210566 9:93198930-93198952 CCTCGGGTGTGAGTCAGGCCTGG + Intronic
1061211449 9:129195757-129195779 CTGTGGGAGGCAGTCAGGCCTGG + Intergenic
1061264216 9:129496293-129496315 CAGAGGGTGTGACTGAGGCCGGG - Intergenic
1062488554 9:136792966-136792988 CTGCAGGTGTTTGTCAGGCCTGG - Exonic
1062580175 9:137225909-137225931 CAGCGTAGGTCAGTCCGGCCTGG - Exonic
1203445485 Un_GL000219v1:50680-50702 CAGAGGGTGTGAGCCAAGCCAGG + Intergenic
1186420229 X:9419804-9419826 CAGCAGGTGTCGGTCACACCAGG + Intergenic
1187563660 X:20426931-20426953 CAGCAGGTGTATGACAGGCCAGG + Intergenic
1193045407 X:77048056-77048078 GAGCTCTTGTCAGTCAGGCCTGG - Intergenic