ID: 1004144026

View in Genome Browser
Species Human (GRCh38)
Location 6:13047921-13047943
Sequence AACCTGGGATTACTCTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 83}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004144026_1004144033 -8 Left 1004144026 6:13047921-13047943 CCCACCAAGAGTAATCCCAGGTT 0: 1
1: 0
2: 1
3: 7
4: 83
Right 1004144033 6:13047936-13047958 CCCAGGTTGCCACCAGGGCTGGG No data
1004144026_1004144031 -9 Left 1004144026 6:13047921-13047943 CCCACCAAGAGTAATCCCAGGTT 0: 1
1: 0
2: 1
3: 7
4: 83
Right 1004144031 6:13047935-13047957 TCCCAGGTTGCCACCAGGGCTGG 0: 1
1: 0
2: 6
3: 23
4: 263
1004144026_1004144035 -7 Left 1004144026 6:13047921-13047943 CCCACCAAGAGTAATCCCAGGTT 0: 1
1: 0
2: 1
3: 7
4: 83
Right 1004144035 6:13047937-13047959 CCAGGTTGCCACCAGGGCTGGGG No data
1004144026_1004144039 16 Left 1004144026 6:13047921-13047943 CCCACCAAGAGTAATCCCAGGTT 0: 1
1: 0
2: 1
3: 7
4: 83
Right 1004144039 6:13047960-13047982 TTCAGAACACCATCTGGCCTAGG 0: 1
1: 0
2: 2
3: 14
4: 172
1004144026_1004144040 24 Left 1004144026 6:13047921-13047943 CCCACCAAGAGTAATCCCAGGTT 0: 1
1: 0
2: 1
3: 7
4: 83
Right 1004144040 6:13047968-13047990 ACCATCTGGCCTAGGTACTTTGG 0: 1
1: 0
2: 1
3: 10
4: 108
1004144026_1004144038 10 Left 1004144026 6:13047921-13047943 CCCACCAAGAGTAATCCCAGGTT 0: 1
1: 0
2: 1
3: 7
4: 83
Right 1004144038 6:13047954-13047976 CTGGGGTTCAGAACACCATCTGG 0: 1
1: 0
2: 0
3: 9
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004144026 Original CRISPR AACCTGGGATTACTCTTGGT GGG (reversed) Intronic
904121887 1:28204073-28204095 AACCTCAGATTGCTCTTGGCTGG - Intronic
906712091 1:47938287-47938309 ATCCTGAGTTTACTCTTGCTTGG - Intronic
912530141 1:110314601-110314623 GAACTGGGATGACTTTTGGTGGG + Intergenic
913233687 1:116762803-116762825 CACCTGGTAGTACTTTTGGTGGG - Intronic
914393842 1:147245599-147245621 AACCAGAAATTACCCTTGGTAGG - Intronic
917677004 1:177328935-177328957 AACTTGAGATTACTCTTGGTGGG + Intergenic
1069711608 10:70492970-70492992 ATCCTGGGATCTCCCTTGGTGGG + Intronic
1070376971 10:75842083-75842105 AAACTGGGTTTACTCTAAGTCGG + Intronic
1074439807 10:113467448-113467470 AAGCTGGGATTTTTCTTTGTGGG - Intergenic
1078903174 11:15660602-15660624 AACCTGTGAAAACTCTTGGTCGG + Intergenic
1080020352 11:27553502-27553524 ACTCTGTGATTACTCTTTGTAGG - Intergenic
1080195428 11:29602947-29602969 AACCTGGGATTGGGCTTGGTTGG + Intergenic
1084742383 11:71148031-71148053 AACCTGGCCTGACTCTTTGTGGG - Intronic
1089137970 11:116264504-116264526 AACCTAGGAATAGTCTTGGGAGG + Intergenic
1093513759 12:19960591-19960613 AACTTGGGTTTACTCTTGGAAGG + Intergenic
1097680967 12:62648430-62648452 AAGCTGGGATGCCTCTTGGCAGG - Exonic
1097710864 12:62915535-62915557 AACCTGGGATTTGTCATGGATGG - Intronic
1107101955 13:36602894-36602916 AACCCTTGAATACTCTTGGTAGG + Intergenic
1108730812 13:53233703-53233725 AACCTGGTATTCCCCTTGGTTGG - Intergenic
1109941420 13:69371332-69371354 AACCTGGGACTACTAATGGAGGG + Intergenic
1110665430 13:78111776-78111798 TCCCTGGGATTAATCTTGCTGGG + Intergenic
1111143267 13:84150088-84150110 AACTTGGGACTACTGTTGGGGGG - Intergenic
1116497824 14:45583621-45583643 ATTCTTGGTTTACTCTTGGTAGG + Intergenic
1116587719 14:46730560-46730582 AATTTGGGATAAATCTTGGTGGG + Intergenic
1119181792 14:72610375-72610397 ACGCTGGGATTCCTCTGGGTGGG - Intergenic
1121167518 14:91820280-91820302 ATCCTGGGATAAATCTTGCTTGG - Intronic
1123540257 15:21282604-21282626 AACTTGTGATTAGTCTTGGGAGG + Intergenic
1125262785 15:37846753-37846775 AATTTGGGATTTCTTTTGGTGGG - Intergenic
1131281884 15:91028227-91028249 TAGCTGGGATTACAGTTGGTGGG - Intergenic
1202948569 15_KI270727v1_random:9762-9784 AACTTGTGATTAGTCTTGGGAGG + Intergenic
1134321042 16:13163216-13163238 AACCTGGGCCTATTCTAGGTAGG - Intronic
1143060710 17:4198319-4198341 GACATGGGATTACTCTGAGTAGG - Intronic
1147405709 17:40210518-40210540 AACCAAGGATAATTCTTGGTTGG - Intergenic
1152857403 17:82673680-82673702 AACCTGGTTTTCCTCCTGGTGGG + Intronic
1153694570 18:7627201-7627223 ACCCTGTCATTACTCTGGGTGGG + Intronic
1157482224 18:48062707-48062729 AAACTGGGATAACTCATGGGTGG + Intronic
1157525099 18:48374666-48374688 AGCCTGGTATTACTCTTCCTTGG + Intronic
927071481 2:19535418-19535440 AACCTGGGATTTTTTTTTGTTGG - Intergenic
935052989 2:99539886-99539908 AATCTGAGAATACTCTTGGAAGG - Intergenic
936895665 2:117424714-117424736 GACATGGGATTACACTTGGAAGG + Intergenic
940928407 2:159394629-159394651 AACCTGGGATGCATCTTGCTAGG + Intronic
940970978 2:159896509-159896531 AACCTTGGATTTCACTTTGTTGG + Intronic
942610753 2:177739964-177739986 TACCTGGATTTACTCTTGGCTGG + Intronic
943822329 2:192341251-192341273 TACATGGGTTCACTCTTGGTAGG + Intergenic
944867395 2:203875892-203875914 AATTTGGGATTAGTCTTGATGGG - Intergenic
1172420429 20:34812414-34812436 AACCCTGGTTTGCTCTTGGTAGG + Intronic
1180929702 22:19580866-19580888 AACGTTGGTTTACTGTTGGTGGG + Intergenic
1182887955 22:33792132-33792154 AACCTAGGATTATACTTGTTAGG + Intronic
1184371434 22:44084543-44084565 GACCTGGGAGTACCCTTGGCAGG - Intronic
952135932 3:30419616-30419638 AACCTTTGAATACTGTTGGTGGG + Intergenic
955210536 3:56936312-56936334 AACCTAGGACTTCTCTTTGTGGG - Intronic
959610793 3:108292694-108292716 AACTGGGGCTTAGTCTTGGTGGG + Intergenic
959748594 3:109806885-109806907 TACGTGAGATTAATCTTGGTGGG + Intergenic
962380223 3:134892619-134892641 AAAATGGGATCTCTCTTGGTAGG + Intronic
963211074 3:142690974-142690996 AAGCAGGGATTCTTCTTGGTGGG + Intronic
963458914 3:145580699-145580721 AAACAGGGATTACTCATGTTAGG - Intergenic
966947781 3:184789503-184789525 AGCCTGGGCTCACTCTTGCTTGG + Intergenic
978516724 4:109576759-109576781 AACCTTGGACTACTATTGATGGG + Intronic
979203360 4:118005685-118005707 AAGCTGGGCTGACTCTTGCTAGG + Intergenic
980197852 4:129614395-129614417 AACCTGAGATTCCTCTGGGCTGG - Intergenic
983435041 4:167702641-167702663 AACCTGGGATTTGTCATGGTTGG - Intergenic
987164007 5:15174549-15174571 AGCCTGGCAGTACTCCTGGTAGG + Intergenic
988054088 5:26070292-26070314 AAATTGGGATTACTATTGGAGGG - Intergenic
990392712 5:55343085-55343107 ACCCTGGAATTGCTCTTTGTAGG + Intronic
990647770 5:57863853-57863875 ATCCTGGGATTCCTTTTGCTTGG + Intergenic
991297211 5:65093843-65093865 TACCTGGCATTACTCTCAGTGGG + Intergenic
992420165 5:76595888-76595910 TATCTCGGATTACTCTAGGTAGG - Intronic
992807817 5:80354753-80354775 AAGCTGGGTTTGCTCTTGATTGG + Intergenic
1001346072 5:170900223-170900245 AACTTGGGTTTAGTCTTGGGAGG + Intronic
1004144026 6:13047921-13047943 AACCTGGGATTACTCTTGGTGGG - Intronic
1005382251 6:25248040-25248062 CAGCTGGGATTACTCTTATTTGG - Intergenic
1008509810 6:52265750-52265772 AACCTCAGATTCTTCTTGGTGGG - Intronic
1027720430 7:81734846-81734868 AATCTGGGTTTTCTTTTGGTGGG - Intronic
1028298847 7:89171001-89171023 ATCCTGGGCTTATTCTTGGTAGG + Intronic
1034288826 7:149911101-149911123 ATCCTGGGTTGGCTCTTGGTTGG - Intergenic
1034662249 7:152781766-152781788 ACCCTGGGTTGGCTCTTGGTTGG + Intronic
1035701057 8:1639469-1639491 AACCTGGGCTTACCCTGGGTCGG - Intronic
1039462563 8:37757813-37757835 AACGTGGCATAATTCTTGGTAGG + Exonic
1041203259 8:55472022-55472044 AATCTAGGATAACTCCTGGTGGG + Intronic
1050722392 9:8605531-8605553 AACATGGGTTTACTCTAGATGGG + Intronic
1051306761 9:15718189-15718211 AGCCTGGAAGTACTCCTGGTGGG + Intronic
1052805275 9:33007854-33007876 AGCCTGGGCTCAGTCTTGGTGGG - Intronic
1058805911 9:108591643-108591665 AATTTGAGATTCCTCTTGGTGGG - Intergenic
1060265635 9:122110171-122110193 AACCTGGGATTCCTCTCAGCTGG + Intergenic
1190290346 X:48988319-48988341 AACCTGAGATTGCTGTTGGCTGG - Intronic
1193359309 X:80561603-80561625 TACCTGGAGGTACTCTTGGTGGG - Intergenic
1194802617 X:98291265-98291287 AACCTGGCATTTCTAGTGGTGGG + Intergenic
1197172579 X:123450949-123450971 GACATGGGAATACACTTGGTAGG + Intronic
1198339322 X:135698847-135698869 AACCTGGAATAACTCATAGTGGG + Intergenic
1199784780 X:151095462-151095484 AGTCTAGGATTAGTCTTGGTGGG - Intergenic
1199939764 X:152613541-152613563 TTCCTGGGATTAATCTTGGGAGG - Intergenic
1201673156 Y:16548717-16548739 AAACTGACATGACTCTTGGTTGG + Intergenic