ID: 1004144426

View in Genome Browser
Species Human (GRCh38)
Location 6:13051664-13051686
Sequence GCCCAAAGTGACCTCCCTCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004144420_1004144426 17 Left 1004144420 6:13051624-13051646 CCCTTGCCAGGAGAACAGCCCCT No data
Right 1004144426 6:13051664-13051686 GCCCAAAGTGACCTCCCTCGAGG No data
1004144423_1004144426 -1 Left 1004144423 6:13051642-13051664 CCCCTTCTCTTTCAAAACTTAAG 0: 1
1: 0
2: 2
3: 36
4: 470
Right 1004144426 6:13051664-13051686 GCCCAAAGTGACCTCCCTCGAGG No data
1004144422_1004144426 11 Left 1004144422 6:13051630-13051652 CCAGGAGAACAGCCCCTTCTCTT No data
Right 1004144426 6:13051664-13051686 GCCCAAAGTGACCTCCCTCGAGG No data
1004144421_1004144426 16 Left 1004144421 6:13051625-13051647 CCTTGCCAGGAGAACAGCCCCTT 0: 1
1: 0
2: 1
3: 9
4: 214
Right 1004144426 6:13051664-13051686 GCCCAAAGTGACCTCCCTCGAGG No data
1004144418_1004144426 24 Left 1004144418 6:13051617-13051639 CCTCTTCCCCTTGCCAGGAGAAC 0: 1
1: 0
2: 5
3: 23
4: 315
Right 1004144426 6:13051664-13051686 GCCCAAAGTGACCTCCCTCGAGG No data
1004144424_1004144426 -2 Left 1004144424 6:13051643-13051665 CCCTTCTCTTTCAAAACTTAAGC 0: 1
1: 0
2: 1
3: 17
4: 337
Right 1004144426 6:13051664-13051686 GCCCAAAGTGACCTCCCTCGAGG No data
1004144425_1004144426 -3 Left 1004144425 6:13051644-13051666 CCTTCTCTTTCAAAACTTAAGCC 0: 1
1: 0
2: 0
3: 15
4: 231
Right 1004144426 6:13051664-13051686 GCCCAAAGTGACCTCCCTCGAGG No data
1004144417_1004144426 25 Left 1004144417 6:13051616-13051638 CCCTCTTCCCCTTGCCAGGAGAA 0: 1
1: 1
2: 4
3: 33
4: 325
Right 1004144426 6:13051664-13051686 GCCCAAAGTGACCTCCCTCGAGG No data
1004144419_1004144426 18 Left 1004144419 6:13051623-13051645 CCCCTTGCCAGGAGAACAGCCCC 0: 1
1: 0
2: 0
3: 18
4: 216
Right 1004144426 6:13051664-13051686 GCCCAAAGTGACCTCCCTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004144426 Original CRISPR GCCCAAAGTGACCTCCCTCG AGG Intronic