ID: 1004144742

View in Genome Browser
Species Human (GRCh38)
Location 6:13054874-13054896
Sequence TTGAGGATGTAGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 653
Summary {0: 1, 1: 0, 2: 8, 3: 56, 4: 588}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004144742 Original CRISPR TTGAGGATGTAGAGGGAAGA AGG (reversed) Intronic
900086920 1:903105-903127 ATGAGGATTTAGGGAGAAGACGG - Intergenic
901056290 1:6450050-6450072 TGCAGGCTGTGGAGGGAAGAAGG - Intronic
901253163 1:7797162-7797184 TCGTGGATGTGGAGGGAAGCTGG + Intronic
902218097 1:14947324-14947346 GTGAGGATGTGGAGGGAAGCAGG + Intronic
902276482 1:15343507-15343529 GTGAGGATGGAGATGAAAGAGGG - Intronic
903224800 1:21888432-21888454 TAAAGGATGGAGAGGAAAGAAGG - Intronic
903510212 1:23869008-23869030 ATAAGGAGGTAGAGGGATGATGG + Intergenic
905090773 1:35429736-35429758 TTGAGGCTTTGGAGGGAACAAGG + Intergenic
905384858 1:37595608-37595630 TTGGGGATGAAAAGGGAAAAAGG - Intronic
905755999 1:40509372-40509394 TTGAGAATGGAGCTGGAAGAGGG + Exonic
907483436 1:54760469-54760491 CGGAGGCTGTAGAGAGAAGAGGG - Intronic
908331478 1:63074970-63074992 TTGAGGATGGGGAGGGAGGAGGG - Intergenic
909062830 1:70898826-70898848 TTGAGATTTTAGAGGGAAAAAGG - Intronic
909212239 1:72838634-72838656 TTCAGGATGTACAGGGAACATGG - Intergenic
909891281 1:81010259-81010281 GTGACGATGTAGCAGGAAGATGG + Intergenic
910040882 1:82850452-82850474 TTAAGGATGTTGAGGGGAGCTGG + Intergenic
911256953 1:95644251-95644273 TTAAGGATGTTGAGGTAGGACGG - Intergenic
911682692 1:100735698-100735720 TTGAGGAGGTACTGTGAAGATGG - Intronic
912227791 1:107755121-107755143 ATGAGTATGTAGGGGGATGAGGG + Intronic
912616326 1:111103333-111103355 TTGAAGAAGTGGAGTGAAGAAGG - Intergenic
912703454 1:111895207-111895229 GTGAGGACGGAGAGGGAGGAGGG + Intronic
912936941 1:114011939-114011961 TAGAGGATGAAAAGAGAAGAGGG - Intergenic
914339816 1:146750382-146750404 TAGAGGATGGAAAGGGGAGAAGG - Intergenic
915369486 1:155336603-155336625 TTCAGGAGGGTGAGGGAAGATGG + Exonic
915616393 1:157042854-157042876 AAGAGGATGAAAAGGGAAGAAGG + Intronic
916098114 1:161369280-161369302 ATGAGGATTTTGGGGGAAGAAGG - Exonic
916239252 1:162622806-162622828 ATCAGGATGTAGAGGGGATAGGG - Intergenic
916900572 1:169218233-169218255 TTTAGGATACAGAGGGAAGTAGG - Intronic
918326220 1:183413228-183413250 TGGAAGATGTAAAGGGAGGAGGG + Intronic
918703829 1:187637389-187637411 TTGGGGATGGAGAAGGAGGAGGG - Intergenic
918863868 1:189869110-189869132 TTGAAGATGTAGTTGGAACAAGG - Intergenic
919393462 1:197015962-197015984 TGGAAGATGTAGTGGGAATAGGG - Intergenic
919504362 1:198379556-198379578 CTGAGGATATAAAGTGAAGAAGG + Intergenic
919678425 1:200409732-200409754 AGGAGGAGGAAGAGGGAAGAGGG + Intronic
919840414 1:201605216-201605238 GAGAGGATGGAGAGGGAAGGTGG - Intergenic
920441643 1:205984867-205984889 GGGAGGAGGGAGAGGGAAGAAGG - Intronic
920820836 1:209379197-209379219 TTGGGGATGTGGAGGGGAGGAGG + Intergenic
920955546 1:210617383-210617405 TTGATGAAGTAGAGAGAGGAAGG + Intronic
921301359 1:213754236-213754258 GTGAGGACGTAGAGAGAAGACGG - Intergenic
921616291 1:217271702-217271724 CTGAGGATGTAGGGGAAAAAAGG - Intergenic
921628171 1:217401798-217401820 TTGGGGGGGTAGAGGGAAGGGGG - Intergenic
921932032 1:220762610-220762632 TTGAGGATGATGGGGGAAGGGGG + Intronic
921980808 1:221256818-221256840 TTGTGGAGCCAGAGGGAAGAGGG + Intergenic
922079336 1:222279628-222279650 TTGAGACTGTGGAGGGAACATGG + Intergenic
922792944 1:228320398-228320420 ATGAGTATGTAGATGGCAGATGG - Intronic
923475316 1:234326120-234326142 TGGAGGATGGAGGGGGAAGGGGG + Intergenic
924226480 1:241926393-241926415 GTGGGGATGTGGAGGGAAAAAGG - Intergenic
924467423 1:244311198-244311220 AGGAGGAGGAAGAGGGAAGAGGG - Intergenic
1063503820 10:6579280-6579302 TGGAGAAGGTGGAGGGAAGAGGG - Intronic
1063696568 10:8341285-8341307 TGCAGGATGTAGAGGAAGGATGG + Intergenic
1064273116 10:13882656-13882678 GTGAGGATGAAGAGGGCACATGG - Intronic
1064331848 10:14401592-14401614 CTGAGCATGGAGAGGGAGGAGGG - Intronic
1064534958 10:16349313-16349335 TTCAAGATGAGGAGGGAAGAGGG - Intergenic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1067056606 10:43056275-43056297 TTGCGGATGTGAAGGGAAGCTGG - Intergenic
1067322004 10:45230018-45230040 TTGAGGCTGTGCAGGGAAGCAGG - Intergenic
1069089575 10:64183269-64183291 TTGTGAAGGTACAGGGAAGAAGG + Intergenic
1069781610 10:70959701-70959723 ATGAGAAGGTAGAGGGAACAGGG - Intergenic
1070039112 10:72757407-72757429 TTGGGGAAGTAGGAGGAAGAAGG - Intronic
1071761569 10:88613498-88613520 TGGAGAGTGTATAGGGAAGAGGG + Intergenic
1071814333 10:89217067-89217089 TTGAGAGTGTAGAGGAAATATGG - Intronic
1071967021 10:90861982-90862004 ATGAGTACCTAGAGGGAAGAAGG - Intergenic
1073470706 10:103720494-103720516 TGGAAGATGGAAAGGGAAGACGG + Intronic
1073790789 10:106938182-106938204 TCCAGGAAGTAGAGAGAAGAGGG + Intronic
1076987053 11:245486-245508 TTTAGGAGGCAGAAGGAAGATGG - Intronic
1078532886 11:12150638-12150660 TGGAGGATATAGAGGGATGCTGG - Intronic
1078548986 11:12267563-12267585 TTGAGGAGGTTGAGGGGTGAAGG - Intergenic
1078683207 11:13500229-13500251 TTGTGGATGGAGAGGGAAAATGG + Intergenic
1079766977 11:24406266-24406288 AGGGGGATGAAGAGGGAAGACGG - Intergenic
1080887298 11:36377983-36378005 TTGAGGATGGTGGGGGATGAAGG - Intronic
1081968314 11:47182759-47182781 TTGGGGCTGTGGAGGGCAGAGGG + Exonic
1083139415 11:60709745-60709767 CTGATGATGTAGAGGAGAGACGG - Intronic
1085056299 11:73406078-73406100 GTGGGGAAGGAGAGGGAAGAAGG - Exonic
1085818402 11:79766223-79766245 ATGAGGATCTACAGTGAAGAAGG + Intergenic
1086875243 11:92087928-92087950 GTGAGGAGGGAGAGGAAAGATGG - Intergenic
1086974295 11:93114825-93114847 TTACAGATGTAGAGGGCAGAGGG - Intergenic
1087199142 11:95328173-95328195 TTGAGCAAGTAGTGAGAAGAGGG - Intergenic
1087349142 11:97008906-97008928 TGGAGGGTGAAGAAGGAAGATGG - Intergenic
1087624373 11:100580243-100580265 TTAAGGGTGTGTAGGGAAGAAGG - Intergenic
1087669576 11:101089679-101089701 TTGAGGGAGAAGAGGGAGGAAGG + Intronic
1087988226 11:104711430-104711452 ACGAGGATGTAGAGTAAAGAGGG - Intergenic
1088140490 11:106609910-106609932 GTGTGGAAGTAGTGGGAAGAAGG - Intergenic
1088356152 11:108945692-108945714 TTCAGGTTGCAGCGGGAAGATGG + Intergenic
1088801314 11:113309912-113309934 TTGAGGATCTAGAAGGAGGTCGG - Intergenic
1089843358 11:121438443-121438465 GTGAGAATGTAGAGGGAGGGTGG - Intergenic
1090406813 11:126480942-126480964 TGCAGGATGTAGAGACAAGAGGG + Intronic
1090617381 11:128527601-128527623 TTGAGGAGGTAGAGGGATAATGG + Intronic
1090735086 11:129605877-129605899 TTGAGGCTAAATAGGGAAGAAGG - Intergenic
1090888207 11:130898041-130898063 TTGATGATGTGGAGAGAAGTGGG - Intronic
1091047855 11:132341019-132341041 CTGAGGATGTAAGAGGAAGAGGG + Intergenic
1091215591 11:133899494-133899516 TTGGGGAGGGAAAGGGAAGATGG - Intergenic
1091275011 11:134344188-134344210 TTGTTGATGCAGAGGGAAGAGGG + Intronic
1091328324 11:134709558-134709580 TTGAACAGGTAGAGGGGAGAGGG + Intergenic
1091555351 12:1569341-1569363 GTGGGGTTGAAGAGGGAAGAAGG - Intronic
1092495961 12:8995463-8995485 GTGGGGAGGGAGAGGGAAGAAGG - Intronic
1092747763 12:11689669-11689691 TTGAGGATGTTTGGGGAAGCGGG + Intronic
1093803306 12:23400376-23400398 TTGAGAAGATAGAGGGAAGGTGG - Intergenic
1094499316 12:31008383-31008405 ATGAGGAAGGACAGGGAAGAGGG - Intergenic
1094671004 12:32569244-32569266 TTGAGAATGTAGAGGAAAACAGG - Intronic
1095251944 12:39989312-39989334 TTGAGGATATTGAGGCAAGAGGG - Intronic
1095336605 12:41035823-41035845 ATGAGGTTGGAGAGGTAAGAGGG + Intronic
1095818867 12:46455101-46455123 TGGAGGCAGTGGAGGGAAGATGG - Intergenic
1096709918 12:53447881-53447903 TTGAGGAGGAACAGGGAAGAAGG + Intergenic
1096870815 12:54590940-54590962 GAGAGGAGGGAGAGGGAAGAGGG + Intergenic
1096961381 12:55581628-55581650 TGGAGGGTGGAGAGGGAGGAGGG - Intergenic
1098174953 12:67780788-67780810 GTGACTATGTAGAGGAAAGATGG - Intergenic
1098307751 12:69118460-69118482 TGGAGGATGAAGAGAGAGGAGGG - Intergenic
1099231624 12:80032518-80032540 TTGAGGAAGGAGTAGGAAGAGGG + Intergenic
1100250837 12:92821685-92821707 TTGAGAATGTAGAGATAATATGG - Intronic
1100633348 12:96409958-96409980 TTGAGGAAGTAGAGGGAGAAGGG - Intergenic
1101515606 12:105432204-105432226 TTGGGGATGTAGAGGGACAATGG + Intergenic
1101577013 12:106007057-106007079 TGGGGGATGCAAAGGGAAGAGGG - Intergenic
1102732096 12:115120631-115120653 TTGAGGGTGGGGGGGGAAGAGGG + Intergenic
1102902559 12:116649556-116649578 TTCAGGAGGTAGAGGTAACATGG - Intergenic
1103083148 12:118041314-118041336 ATGAGGATGCAGAGAGAAGGTGG + Intronic
1103131840 12:118475735-118475757 TAGGGGAAGTAGAGGGAAGCTGG + Intergenic
1103231071 12:119330910-119330932 TTTAGAATGTATAGTGAAGAAGG + Intergenic
1103301153 12:119927437-119927459 CTGAGGATGCAGTGAGAAGATGG + Intergenic
1103367687 12:120394957-120394979 TTGGGGATGCAGAGGCAGGAAGG + Intergenic
1103831878 12:123786773-123786795 TTGAGGGTGTAGGGAGATGATGG + Intronic
1104088509 12:125495137-125495159 TTCAGGGAGTAGGGGGAAGAGGG - Intronic
1104340225 12:127942596-127942618 TTGAGGCTGGAGAGGGAGGTAGG + Intergenic
1105234538 13:18536520-18536542 GTGAGGATGTAAAGAAAAGACGG - Intergenic
1106190223 13:27445907-27445929 TTGGGAATGAAAAGGGAAGAGGG + Intronic
1106456370 13:29930752-29930774 GGGAGGATATAAAGGGAAGAGGG + Intergenic
1106506685 13:30376575-30376597 TTGAGGAAGGAAAAGGAAGAGGG + Intergenic
1107389940 13:39953312-39953334 TTGAGTACTTAAAGGGAAGATGG + Intergenic
1107393568 13:39992763-39992785 TTGAGCATCGAAAGGGAAGAGGG + Intergenic
1107581119 13:41787545-41787567 TGGAGGATGAAGAGGGAGGAAGG + Intronic
1107824672 13:44317805-44317827 TTGAGGATGCAGTGGGATAAGGG - Intergenic
1108875111 13:55037724-55037746 GTGAGGAAGTTGAGGAAAGATGG + Intergenic
1109439056 13:62344466-62344488 ATGAGGATGTAGAGTTAAGTAGG - Intergenic
1110050726 13:70895094-70895116 TTGAGGATATCATGGGAAGATGG + Intergenic
1110080989 13:71311557-71311579 TTGAGGAAGTAGAGCCAAGAAGG + Intergenic
1110399816 13:75076859-75076881 TTGAGAAGGTAGGGTGAAGAGGG - Intergenic
1110433903 13:75458222-75458244 AAGAGGATGGAGTGGGAAGATGG + Intronic
1110506371 13:76292413-76292435 ATGAGGATGAACAGTGAAGAAGG + Intergenic
1110661831 13:78066191-78066213 TGGGGGATGGAGTGGGAAGATGG - Intergenic
1111802299 13:92995949-92995971 TTCAGGAGGTAGAGTGAAGTGGG - Intergenic
1112358722 13:98696933-98696955 GTGAGGACCTAGAGGGAAGGTGG + Intronic
1112497532 13:99916534-99916556 TGGGGGATGAAGAGGGAGGAAGG - Intergenic
1112733138 13:102389116-102389138 TCGAGGATGAAAGGGGAAGAAGG - Intronic
1113509467 13:110841489-110841511 TAGAAGCTGCAGAGGGAAGATGG - Intergenic
1115877463 14:37876529-37876551 TTCAGGAAGTAGATGGAACATGG - Intronic
1116141176 14:40995874-40995896 TAGAAGATGTAGAAGGAAAATGG + Intergenic
1116277894 14:42860215-42860237 CAGAGGATGCAGAGGGAAGAGGG + Intergenic
1116637441 14:47415807-47415829 GTGAGGATGCAGCAGGAAGACGG - Intronic
1118247793 14:64128256-64128278 GGGAGGATGTAGAGGGAAGAAGG + Intronic
1118501354 14:66365310-66365332 TTCAGGATTCAGAGGGCAGATGG + Intergenic
1118861754 14:69669618-69669640 TTGAAGATGTTTAGGGGAGAAGG - Intronic
1119128709 14:72152449-72152471 TTGAGGATGTACAGGGCTGTGGG + Intronic
1119170893 14:72535691-72535713 ATGAGGAAGTAGAGGGAGCAAGG - Intronic
1119191714 14:72687552-72687574 TAGGGGATGCAGAGGAAAGATGG - Intronic
1119476910 14:74935563-74935585 TTGAGGATGGAGAGAGAGAAGGG - Intergenic
1119675195 14:76548253-76548275 TGGAGGACGTAGAGAGGAGAAGG - Intergenic
1119905897 14:78301693-78301715 ATGAGGATGTTGAAGAAAGAAGG + Intronic
1120045138 14:79797313-79797335 AGGAGTAGGTAGAGGGAAGAGGG + Intronic
1120500936 14:85296638-85296660 TTGAGGAGATAGTGGGAAGTAGG - Intergenic
1121229265 14:92344648-92344670 TTTAGGATGTCCAGGGATGAGGG + Intronic
1121234118 14:92379901-92379923 GTGAGGGTGGAGAGGGGAGAGGG - Intronic
1121553909 14:94822114-94822136 CCGAAGCTGTAGAGGGAAGATGG + Intergenic
1121574463 14:94972197-94972219 GTGAGAATGCAGAGGGAAGAAGG + Intergenic
1121709464 14:96026843-96026865 CTGAGGGTGCAGAGGGAACATGG + Intergenic
1122519517 14:102333686-102333708 GGGAGTCTGTAGAGGGAAGAAGG - Intronic
1122916093 14:104859653-104859675 TGGAGGATGGAGATGGAAGGTGG - Intergenic
1123773518 15:23554021-23554043 GTGAGGATACAGAGAGAAGATGG + Intergenic
1123841811 15:24254892-24254914 TTGAGGGTGTAGAGGAAACATGG + Intergenic
1124354806 15:28986965-28986987 GTGAGGATGTAGTGAGAAGATGG - Intronic
1124389819 15:29244413-29244435 GTGAGGATTTACAGGGAAAAAGG - Intronic
1125124992 15:36209776-36209798 GTGAAGATAGAGAGGGAAGAAGG + Intergenic
1126526001 15:49654934-49654956 GTGAGGATATAGCAGGAAGATGG - Exonic
1126551084 15:49930238-49930260 TTAGGGATGAAGAGGGAGGATGG + Intronic
1126593255 15:50360572-50360594 TTGGGGAGGTGGAGGGAATAAGG + Intergenic
1127630757 15:60825604-60825626 TGAAGGATGGAGACGGAAGATGG - Intronic
1127680819 15:61296184-61296206 CTAAAGATGTTGAGGGAAGAAGG - Intergenic
1128555261 15:68627470-68627492 TCCAGGATGCAGAGAGAAGAGGG + Intronic
1128768573 15:70265723-70265745 TGGAGAATGGAGAAGGAAGATGG + Intergenic
1129269953 15:74414348-74414370 TGGAGGAGGTAGGGGCAAGAGGG - Intronic
1129383791 15:75184549-75184571 TTGAGCAGGTAGAGGATAGATGG + Intergenic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1130031122 15:80315201-80315223 ATGAGGATGGAAAGGGAAAAGGG + Intergenic
1130095215 15:80850666-80850688 TTGAAGGTGTGGAGGGAAGGGGG + Intronic
1130570569 15:85039459-85039481 GTGAGGATGTGGAGGAGAGAAGG + Intronic
1130751733 15:86719653-86719675 TTGAGGATAAAAAGGAAAGAAGG - Intronic
1131472408 15:92708607-92708629 TTGAAGTTGAAGAGGGAAGCAGG - Intronic
1131577000 15:93602227-93602249 TAGAGGCTGCAAAGGGAAGATGG - Intergenic
1132114044 15:99123000-99123022 TGGAGGATGTAGAAGGAGGTGGG + Intronic
1132504171 16:298397-298419 CTGAGGATGGAGAGGCAGGACGG + Intronic
1134122781 16:11596656-11596678 GGGAGGATGTGGAGGGAAAAAGG + Intronic
1134784835 16:16932655-16932677 TTGAGGGGATAGAGGGAACATGG - Intergenic
1135944660 16:26855274-26855296 TTGAGGAATCAGTGGGAAGATGG + Intergenic
1136072035 16:27793154-27793176 TTGAGGATGGAGAAGGAACAAGG - Intronic
1136498516 16:30658452-30658474 CTGAGGAGGAAGAGGGAGGAGGG + Exonic
1136579210 16:31141844-31141866 ATGAGTCTGCAGAGGGAAGAAGG + Exonic
1137268395 16:46886420-46886442 TTGAGGATGATGAGGACAGAAGG + Intronic
1137857185 16:51806740-51806762 ATGAGGATATAGTGAGAAGATGG - Intergenic
1138015926 16:53428671-53428693 GTGAGGATGAAGGGGCAAGAGGG + Intergenic
1138499187 16:57428353-57428375 GTGAGCATTTAGAGGGAAGCAGG - Exonic
1139994472 16:70967028-70967050 TAGAGGATGGAAAGGGGAGAAGG + Intronic
1140354489 16:74293648-74293670 TGGAGGATGGAGATGGGAGAAGG + Intergenic
1141327501 16:83075500-83075522 TTGTGGATGCAAAGGGAACAGGG + Intronic
1142168951 16:88610342-88610364 GTGAGCTTGCAGAGGGAAGAGGG + Intronic
1142678467 17:1530853-1530875 TGGAGGATGGAGAGCGGAGAAGG + Intronic
1142787532 17:2235852-2235874 GTGTGGAAGTAGAGGGGAGAAGG - Intronic
1142958237 17:3535425-3535447 GTGAGGAGGGAGAGGGAGGAAGG - Intronic
1142990754 17:3729210-3729232 ATGACGCTGTGGAGGGAAGAAGG - Intronic
1143720766 17:8807497-8807519 TGGAGGATGTGGAAGGAAGGGGG + Intronic
1143971241 17:10797439-10797461 GTGAGGATGTAGAGAGAAAAGGG - Intergenic
1148878033 17:50704134-50704156 TTGAGGTGGTAGAGGGATGAGGG + Intronic
1148982748 17:51593008-51593030 TTGATGATGGGGAGGGGAGAAGG + Intergenic
1149109906 17:53016175-53016197 GTGTGGATTTAGAGGGGAGAGGG - Intergenic
1149457258 17:56797986-56798008 TAGAAGATGGAGAGGGAAGGAGG - Intronic
1150998314 17:70344894-70344916 TTGAAGAGGCAGAGGGAAGAGGG - Intergenic
1151052643 17:70995874-70995896 GAGAAGATGGAGAGGGAAGATGG - Intergenic
1151106486 17:71621779-71621801 TTGAGGAAGTAGAGAGGACACGG - Intergenic
1151659182 17:75509634-75509656 TTGAGGCAGTAGAAAGAAGAGGG + Intronic
1151790014 17:76299280-76299302 TTGAAAATGTAGACGGAAGCAGG + Intronic
1151790604 17:76303336-76303358 TTGAAAATGTAGACGGAAGCAGG - Intronic
1151827000 17:76529263-76529285 TAGAGGGTGTAAAGGGATGAGGG + Intronic
1151932453 17:77241263-77241285 TTGAACATGTTGTGGGAAGATGG + Intergenic
1152469606 17:80483354-80483376 CTGAGGGTGCAGAGGGAGGACGG + Intergenic
1152548031 17:81012742-81012764 CTGAGGCTGTATAGGGAAGTGGG - Intergenic
1153410700 18:4789455-4789477 TGGAGGATGCAGTGGGAGGAGGG - Intergenic
1153602403 18:6794376-6794398 TTGAGCATGTAGCAGGAAAATGG + Intronic
1154031293 18:10756308-10756330 TGGAGGATGAAGAGGAAGGATGG + Intronic
1154515004 18:15153338-15153360 GTGAGGATGTAAAGAAAAGACGG + Intergenic
1154639627 18:16905724-16905746 TTGAGGATTTCGTTGGAAGAGGG + Intergenic
1154666613 18:17276211-17276233 TTGAGGATTTAGTGGGAAACGGG + Intergenic
1154673188 18:17365768-17365790 TTGAGGATTTAGTGGGAAACGGG + Intergenic
1154702913 18:17773080-17773102 TTGAGGATTTCGATGGAAGCGGG + Intergenic
1154705704 18:17811067-17811089 TTGAGGATGTCGGGGGAAACGGG + Intergenic
1154745362 18:18354824-18354846 TTGAGGATTTCGTTGGAAGAGGG + Intergenic
1154768988 18:18678805-18678827 TTGAGGATTTCGTGGGAAAAGGG + Intergenic
1154785299 18:18902880-18902902 TTGAGGATTTCGTGGGAAAAGGG + Intergenic
1154793808 18:19020045-19020067 TTGAGGATTTAGTGGGAAACGGG + Intergenic
1154837574 18:19622986-19623008 TTGAGGATTTCGTGGGAAAAGGG + Intergenic
1154837893 18:19627392-19627414 TTGAGGATTTCGTTGGAAGAGGG + Intergenic
1154838400 18:19634356-19634378 TTGAGGATTTCGTTGGAAGAGGG + Intergenic
1154843193 18:19700142-19700164 TTGAGGATTTCGTGGGAAAAGGG + Intergenic
1154889301 18:20336226-20336248 TTGAGGATTTCGTTGGAAGAGGG + Intergenic
1154901352 18:20502029-20502051 TTGAGGATTTAGTGGGAAACGGG + Intergenic
1155513569 18:26601139-26601161 ATGAGCATTTAGAGGGAAGCAGG + Intronic
1156578615 18:38349385-38349407 GTGAGGATGCAGTGAGAAGATGG + Intergenic
1156709051 18:39919633-39919655 TATAGGAAGTAAAGGGAAGAGGG + Intergenic
1157096478 18:44689773-44689795 TTGGGAATGTAGAGGGAGAAAGG + Intronic
1159103524 18:63980779-63980801 AAGAGGATATAGAGGGAAGGAGG - Intronic
1160400314 18:78605964-78605986 CTTAGGATGCAGAGGGAGGATGG - Intergenic
1160421382 18:78749053-78749075 TGGAGGATGAAGAGGAAAGTGGG - Intergenic
1160676607 19:394531-394553 GAGAGGATGGAGAAGGAAGATGG + Intergenic
1161620988 19:5296989-5297011 TTGGGGATGTACAGAAAAGAGGG + Intronic
1161983648 19:7642960-7642982 CTGGGGAAGTAGGGGGAAGAGGG - Intronic
1163054599 19:14708849-14708871 GTGAAGATATAGAGAGAAGATGG - Intronic
1163499381 19:17666790-17666812 TTTGGGAGGTAGAGGGAAGTCGG - Intronic
1164531485 19:29051656-29051678 TTGAGGGTGTGGAGGGGAGGAGG - Intergenic
1164721269 19:30433319-30433341 TTGGGGAAGTGGGGGGAAGATGG - Intronic
1164742544 19:30587099-30587121 TTGAGGATCTAGAAGGAAAAAGG - Intronic
1165912855 19:39239882-39239904 CTGAGGATGGAGGGGCAAGAGGG - Intergenic
1166398844 19:42462889-42462911 TAGAGGGTGAAGAGGAAAGAGGG + Intergenic
1167145117 19:47676615-47676637 CTGATGATGAAGAGGGAAGGCGG - Intronic
1168505930 19:56935012-56935034 TCAAGGATGTAGAGAGTAGAAGG + Intergenic
925095850 2:1201350-1201372 TTCATGAAGTAGAGGGTAGAAGG + Intronic
925428493 2:3771132-3771154 CGGAGGATGCAGAGGGAGGACGG - Intronic
926517248 2:13863471-13863493 TTGAGTATGTAGTGAGAAGCAGG - Intergenic
926592457 2:14754067-14754089 ATGATGATGTAGCAGGAAGAAGG - Intergenic
926608554 2:14922510-14922532 GTGAGGATGTAAAGGAAAGGTGG - Intergenic
926624961 2:15083299-15083321 GTGGAGATGGAGAGGGAAGAAGG - Intergenic
927009337 2:18886457-18886479 TTGAGAATTTAGAGGAAATAGGG - Intergenic
927951757 2:27175023-27175045 CTGAGGATGCAGAAGGCAGAGGG - Intergenic
927991130 2:27447921-27447943 TTCTAGAGGTAGAGGGAAGAAGG + Exonic
928895087 2:36252276-36252298 TTAGGGATGGAGAGGGATGAAGG - Intergenic
929736485 2:44555441-44555463 GTGAGGATGGGGAGGGAGGATGG + Intronic
929849295 2:45569039-45569061 TTTAGGGTGTAGAGGTAACATGG - Intronic
930033698 2:47072872-47072894 AAGAGGATGTAGAGGGGACAAGG + Intronic
930367527 2:50459455-50459477 TTGAGGGTGGAGTGGGAAGAGGG - Intronic
930952767 2:57163292-57163314 ATGAGGATGGAGAGAGAAGCTGG + Intergenic
931000174 2:57770884-57770906 CTGAGGAAGGAAAGGGAAGAAGG - Intergenic
931984950 2:67732703-67732725 TTGAGGATATCAAGGCAAGAAGG - Intergenic
932010397 2:67971958-67971980 TTTAGGATGTGGAGAGAAGAAGG - Intergenic
932186385 2:69699795-69699817 TTGAGGCTTTCAAGGGAAGAGGG + Intronic
932336663 2:70935684-70935706 TGGAGGATGTGGAGGGAGAAGGG - Intergenic
932850291 2:75178056-75178078 TTCTGGATCTAGAGGGAAGGTGG - Intronic
932959305 2:76394133-76394155 GTGAAGATGCAGAGGGAAGATGG - Intergenic
933428884 2:82149460-82149482 GTGAGGTTGAAGAGAGAAGAGGG + Intergenic
933933499 2:87179584-87179606 TTAAGGATTGATAGGGAAGAAGG - Intergenic
934744670 2:96751305-96751327 TTGAGGAAAGAGAGAGAAGAAGG - Intergenic
934745428 2:96756486-96756508 GTGTGGATGATGAGGGAAGAAGG - Intergenic
934861582 2:97767959-97767981 TTGAGGATGTTGGGGAATGAGGG - Intronic
936359614 2:111785861-111785883 TTAAGGATTGATAGGGAAGAAGG + Intronic
937340318 2:121086936-121086958 TCAGGGATGTAGAGGGAAGATGG + Intergenic
937397277 2:121547687-121547709 TTGAGAATTGAGAGGGAACACGG + Intronic
937416993 2:121723320-121723342 TTTGGGATGAGGAGGGAAGACGG + Intergenic
937987095 2:127642810-127642832 TTGAGGAGGGAGAGGGGAGCAGG - Intronic
940088962 2:149895097-149895119 TGGAGGCTCTAGAGGGAATAGGG + Intergenic
940159010 2:150691904-150691926 TTGGGCATGGAGAGGGAAAAGGG + Intergenic
940392434 2:153147850-153147872 TTGAGGATATAAAAGGGAGAAGG + Intergenic
940614471 2:156033367-156033389 TTAAGCATTTTGAGGGAAGAAGG - Intergenic
940822446 2:158372135-158372157 TGGAGGATATAGAGGGAGTAAGG - Intronic
940962656 2:159802203-159802225 TTGATGATGCAGTGGGGAGAGGG - Intronic
941196520 2:162459553-162459575 TTCATGAGGTAGAAGGAAGAAGG - Intronic
941356875 2:164504634-164504656 ATGAGGCTGAAGAGGGAAGGAGG - Intronic
941507164 2:166360793-166360815 TTCAGTCTGTATAGGGAAGAAGG - Intronic
941801254 2:169662403-169662425 ATGAGGAAGAAGAGGAAAGAAGG - Exonic
942255521 2:174093205-174093227 TTGGGGATTTGGTGGGAAGATGG + Intronic
944297239 2:198080203-198080225 TTGTGTATGTATTGGGAAGATGG - Intronic
945094007 2:206202338-206202360 TGGAGGCTATAGAGAGAAGACGG + Intronic
946075710 2:217071941-217071963 TGGAGGATGAAGATGGAACAGGG + Intergenic
946440297 2:219689396-219689418 TTGTGGAAGGAGAGGGAGGACGG - Intergenic
946668768 2:222079598-222079620 TAGAGGAGGGAGAAGGAAGAAGG - Intergenic
947847818 2:233259738-233259760 GGGAAGATCTAGAGGGAAGAAGG - Intronic
948091864 2:235301984-235302006 AGGAGGATGAAGAGGGAGGAGGG - Intergenic
1168764361 20:371811-371833 TGGAGGAAGTTGAGGGATGAAGG - Intronic
1169689253 20:8311978-8312000 TTGAGCAGTGAGAGGGAAGAGGG - Intronic
1170085959 20:12531824-12531846 CTGAGGATGTAAAGGAAAGCAGG + Intergenic
1170171575 20:13419290-13419312 GTGTGCATGTAGAGGGAGGAGGG + Intronic
1170268721 20:14499623-14499645 ATGAGGAAGAAGAGGGAAGGTGG + Intronic
1170803096 20:19606679-19606701 CTGAGAATGCAGAGGGAAGAAGG + Intronic
1172374811 20:34429911-34429933 TAGAGGAATTGGAGGGAAGAAGG + Intronic
1172562934 20:35905510-35905532 GTGAGGATGTAGCAAGAAGATGG + Intronic
1172789211 20:37490953-37490975 TGGAGAGTGTAGAGGGAAGATGG - Intergenic
1172789217 20:37490980-37491002 CAGAGAGTGTAGAGGGAAGATGG - Intergenic
1172984843 20:38976758-38976780 TAGGGGCTGCAGAGGGAAGAGGG - Intronic
1173123146 20:40312336-40312358 TTGAGGCTGTAGGGAGGAGATGG - Intergenic
1174085406 20:48004542-48004564 GTGAGGATGACAAGGGAAGAAGG + Intergenic
1174087493 20:48019531-48019553 CTGAGGTTGAGGAGGGAAGAGGG + Intergenic
1174130816 20:48342188-48342210 GTGAGGATGACGAGGGAAGAAGG - Intergenic
1174883674 20:54308005-54308027 TTGAGGATGTGGTGGGAAACTGG + Intergenic
1174910789 20:54605484-54605506 TTGGGGAGGTGGTGGGAAGAGGG - Intronic
1175180692 20:57144775-57144797 GTGAGGATATAGCGAGAAGATGG - Intergenic
1176778526 21:13164806-13164828 GTGAGGATGTAAAGAAAAGACGG - Intergenic
1178158890 21:29888043-29888065 TTGAGGTTGTTGGGGGAAGCAGG - Intronic
1178504194 21:33149961-33149983 TTGAGGTTGGAGAGGGGAGTCGG + Intergenic
1178944099 21:36931935-36931957 TTGGGGATGTGGGGGGAAAACGG - Intronic
1179072885 21:38089482-38089504 TTGAAGATGAAGATGGAGGAAGG + Intronic
1179340361 21:40502495-40502517 TTGAGCCTGTAGAAAGAAGACGG - Intronic
1180825486 22:18858161-18858183 ATGAGGATGTGGTGGGCAGAGGG - Intronic
1181116056 22:20633148-20633170 TGGAGGAGGGAGAGGGCAGAGGG - Intergenic
1181187246 22:21116386-21116408 ATGAGGATGTGGTGGGCAGAGGG + Intergenic
1181211952 22:21294107-21294129 ATGAGGATGTGGTGGGCAGAGGG - Intergenic
1181397545 22:22632779-22632801 ATGAGGATGTGGTGGGCAGAGGG + Intergenic
1181651861 22:24263279-24263301 ATGAGGATGTGGTGGGCAGAGGG - Intergenic
1181705516 22:24647460-24647482 ATGAGGATGTGGTGGGCAGAGGG + Intergenic
1181901551 22:26160323-26160345 GAGAGGAAGTAGAGGGAAGGAGG + Intergenic
1182049641 22:27302947-27302969 TTGAGGATGGAGGGAGAAGAGGG - Intergenic
1182395046 22:30029170-30029192 TTCAGGCTGTAGAGGGAATTTGG + Intronic
1182852653 22:33489258-33489280 TCGTGGAGGGAGAGGGAAGAGGG + Intronic
1183549169 22:38471235-38471257 CTGAGGATGAAGAGAAAAGAGGG + Intronic
1184445436 22:44544408-44544430 CTGATGATGCAGAGGTAAGAGGG - Intergenic
1184463255 22:44652465-44652487 GTGAAGATGTAGACTGAAGAAGG + Intergenic
1184463267 22:44652859-44652881 GTGAAGATGTAGACTGAAGAAGG + Intergenic
1184463279 22:44653216-44653238 GTGAAGATGTAGACTGAAGAAGG + Intergenic
1184959356 22:47917867-47917889 AGGAGGAAGGAGAGGGAAGAAGG - Intergenic
1185015872 22:48342232-48342254 GTGAGGATGAGGAGGGAAGGAGG + Intergenic
1203215002 22_KI270731v1_random:1325-1347 ATGAGGATGTGGTGGGCAGAGGG + Intergenic
1203275634 22_KI270734v1_random:84064-84086 ATGAGGATGTGGTGGGCAGAGGG - Intergenic
949125259 3:439456-439478 TGGAGGGTGCAGAGGGAGGAGGG + Intergenic
950196609 3:11013819-11013841 TTGAGGATTTAGAACGGAGAAGG - Intronic
950553641 3:13682423-13682445 GTGAGGGTGTAGAGGGAGCAGGG + Intergenic
950564900 3:13763079-13763101 TGGAGGATGTGGAGGGAAGCAGG - Intergenic
951724609 3:25743312-25743334 TTGAGGTCAGAGAGGGAAGAGGG - Intronic
951741061 3:25923841-25923863 TAGAGGATGAAGAAGGACGAAGG + Intergenic
952223533 3:31350243-31350265 ATGAGGATCTATTGGGAAGAAGG - Intergenic
953295224 3:41708556-41708578 TTGATTATATAGAGGGAATAAGG + Intronic
954271349 3:49512134-49512156 GGGAGGCTGAAGAGGGAAGAAGG - Intronic
954376488 3:50196590-50196612 TTGGGCATGAAGTGGGAAGATGG + Intergenic
954813462 3:53262390-53262412 AGGAGGAGGAAGAGGGAAGAGGG - Intergenic
954852254 3:53613338-53613360 TACAGGAAGAAGAGGGAAGAGGG - Intronic
955055921 3:55456171-55456193 TTCAGGGTGAAGAGGGAAGGGGG + Intergenic
955162483 3:56478111-56478133 TTGGGGCTGAAGAGAGAAGAAGG + Intergenic
956145653 3:66188423-66188445 TGGAGTATGCAGAGGGAAGGAGG + Intronic
956678784 3:71759007-71759029 TTGAGAATGTAGAGGGCTGATGG - Intergenic
957144054 3:76398869-76398891 CTGAGTATGAAGATGGAAGAAGG + Intronic
957179731 3:76861060-76861082 CTGATGTTGCAGAGGGAAGAGGG - Intronic
957216212 3:77323224-77323246 TTGAGTATGTAAAGGTAGGAGGG - Intronic
957924324 3:86789074-86789096 TTGAGGATGGAGAGGAAATCAGG - Intergenic
958925311 3:100150789-100150811 CTGATGCTGAAGAGGGAAGAGGG - Intronic
959356273 3:105333341-105333363 TAGAGGATGGAGAGGGTAGGTGG + Intergenic
959662411 3:108883510-108883532 TTGAGGAGGTGGAGGCAGGAAGG + Intergenic
959673068 3:109001469-109001491 TTAATGATTTAGAGGTAAGAGGG - Intronic
959714753 3:109420442-109420464 CTGAGGATGGAGAGAGAGGAAGG - Intergenic
960374069 3:116877210-116877232 TTGAGGATAGAAAGAGAAGATGG - Intronic
960664849 3:120098767-120098789 TTGAAGATGAAGAAAGAAGAGGG + Intergenic
960878033 3:122315975-122315997 CTGAGAATGAAGATGGAAGATGG - Intergenic
961108533 3:124263253-124263275 ATCAGGATGTTGAGGGACGATGG - Intronic
961130564 3:124462849-124462871 ATGAGGATGTTGAGGAGAGATGG - Intronic
961169231 3:124784558-124784580 TTAAGGCAGTGGAGGGAAGATGG + Intronic
961635778 3:128331447-128331469 CTGAGGAAGGGGAGGGAAGAGGG - Intronic
961635794 3:128331507-128331529 TTGAGGAAGGAGAGGGAAGAGGG - Intronic
963064559 3:141253101-141253123 TGCAGGATGGAGCGGGAAGAGGG - Intronic
963673870 3:148284204-148284226 ATGAGGACATAGAGAGAAGATGG - Intergenic
964147996 3:153489354-153489376 TTGTAGAGGTGGAGGGAAGAAGG - Intronic
964958347 3:162391073-162391095 TTGAAGATGTGGAGGGCTGAAGG + Intergenic
965621344 3:170644950-170644972 GTGAAGCTGTAGAGGGAGGAGGG - Intronic
965797560 3:172457232-172457254 GTGAGGATGCAGTGAGAAGATGG - Intergenic
966164259 3:176999412-176999434 CTGAGGATATAGAGGCAAAAAGG + Intergenic
966276922 3:178184187-178184209 TTCAGGATTAGGAGGGAAGAGGG - Intergenic
966434544 3:179868831-179868853 TTGAGGTTGTGGAGAGAATATGG - Intronic
966564986 3:181369178-181369200 TTGAGGAAATAGAGGGAATATGG - Intergenic
966654625 3:182341699-182341721 TTGAGGATGGAGGTGGGAGAAGG + Intergenic
967145874 3:186605608-186605630 TTGAGGATGTGGAGATATGAGGG - Intergenic
967674561 3:192281194-192281216 TAGAGGATTCAGAGGGAAGATGG - Intronic
968238823 3:197056243-197056265 TTATGGAGCTAGAGGGAAGATGG - Intronic
969147707 4:5138787-5138809 CTGAGGATGTAGAGAGAACAAGG + Intronic
969191655 4:5526195-5526217 TCCTGTATGTAGAGGGAAGAAGG - Exonic
969545085 4:7820746-7820768 GTGAGGATGTGGAGGGAAGAGGG + Intronic
969548797 4:7850423-7850445 TGGAGGAGGGAGAGGGAAGAGGG + Intronic
969799561 4:9552293-9552315 TTGAGGATGTTGGGGGATGGAGG + Intergenic
969851992 4:9964822-9964844 TTGTTGATGGAGAGGCAAGAGGG - Intronic
970748654 4:19331347-19331369 TTGTAGATGTATAGGAAAGAAGG + Intergenic
970813994 4:20131424-20131446 GTGAGGATGGAGTGGGAAGGTGG + Intergenic
970874940 4:20858285-20858307 GTGAAGATGGAGTGGGAAGATGG + Intronic
970998918 4:22300793-22300815 TGGAGAATAAAGAGGGAAGAAGG - Intergenic
971141080 4:23925594-23925616 TTGAGGATGATGAGAGAAAATGG + Intergenic
971156368 4:24087573-24087595 ATGAGGACTTGGAGGGAAGATGG - Intergenic
971289467 4:25323582-25323604 TTGAGACTGTAGGGGGAAGGAGG + Intronic
972821122 4:42702418-42702440 TTGAGGAGGTGGAGCCAAGATGG - Intergenic
973406021 4:49737537-49737559 TTGAGGATTTCGTTGGAAGAGGG + Intergenic
973447015 4:50415442-50415464 TTGAGGATTTCGTTGGAAGAGGG + Intergenic
974174984 4:58310014-58310036 AAGGGGATGTAGTGGGAAGATGG + Intergenic
974935020 4:68401215-68401237 ATGAGGAGGAAGAGGTAAGAAGG - Intergenic
975029299 4:69594702-69594724 TTGAGGATGGAGTGAGAAGTGGG + Intronic
975648818 4:76571991-76572013 TGGAGGAAGCAGAGAGAAGATGG - Intronic
975787386 4:77906509-77906531 TTGACAATGTAGAGGAAAGAAGG + Intronic
976077090 4:81312144-81312166 CTGAGGATTTGGAGGCAAGAAGG + Intergenic
977638587 4:99329535-99329557 GTGAGGATACAGAGGGAAGGTGG + Intergenic
978035137 4:103983901-103983923 TTGGAGATGGAGAGGGAAGAGGG + Intergenic
978627912 4:110708342-110708364 TTCAGAATGTAGAGTGGAGATGG + Intergenic
979349178 4:119626762-119626784 TTTAGGATTTTGAAGGAAGAAGG + Intronic
981669437 4:147270465-147270487 TTGGGGACTAAGAGGGAAGAGGG - Intergenic
982074778 4:151727536-151727558 TTGAGAATGTTGTGGGAACAAGG - Intronic
982101301 4:151970885-151970907 GTGAGGATGTGGCGGGAAAAGGG - Intergenic
982118841 4:152119743-152119765 TTGATGATGAAGAGGCACGAGGG - Intergenic
982259160 4:153479322-153479344 ATGGGGATGAAGAGGAAAGAGGG - Intronic
983203230 4:164885023-164885045 TACAGCATGCAGAGGGAAGAGGG - Intronic
983325722 4:166253481-166253503 ATGATGGTGTAGAGGGAAGTAGG - Intergenic
983476480 4:168218333-168218355 TTAAGGATGTATAGGAAACAAGG - Intronic
983575162 4:169253534-169253556 TTGAGAATGGAGCGGAAAGAGGG - Intronic
984153175 4:176160166-176160188 TTGAGCATGTAGAAGGGAGAAGG + Intronic
984763228 4:183379948-183379970 GTGAGGATGTGGTGAGAAGATGG + Intergenic
984825069 4:183916855-183916877 GATAGGAAGTAGAGGGAAGAGGG - Intronic
984910285 4:184668045-184668067 GTGAGGATAGAGTGGGAAGAGGG - Intronic
985117277 4:186604817-186604839 GTGAGGAGGAAGAGGGAGGAGGG + Intronic
985282367 4:188300119-188300141 CTGAGGAAGCAGAGGGAACAGGG - Intergenic
985761479 5:1751445-1751467 TGGAGGAAGGAGAGGGATGAGGG - Intergenic
986009049 5:3695443-3695465 TGGGGGAGGTGGAGGGAAGAAGG - Intergenic
986057484 5:4153116-4153138 TTGATGATGGTGAGGCAAGAAGG + Intergenic
986454141 5:7898938-7898960 TTTAGGCTGTAGAGGAAACATGG + Intronic
986776120 5:11015708-11015730 TTCAGGATCTAAAGGAAAGAGGG + Intronic
986792857 5:11180622-11180644 GGCAGGATGTAGAGTGAAGAAGG + Intronic
987729660 5:21752732-21752754 TAGAGGAAGTAGAGGAAGGAAGG + Intronic
988296628 5:29371226-29371248 TAAAGGAAGTAGGGGGAAGAAGG + Intergenic
988417205 5:30960267-30960289 TTGGGGATGTACAGGAAAAAGGG - Intergenic
988490391 5:31700712-31700734 CTGAGGAGGAAAAGGGAAGAAGG + Intronic
988773194 5:34452074-34452096 TTCAGGATGTAAAGGGAATTTGG - Intergenic
988994055 5:36697650-36697672 ATCAGGATGGAGAGGGAAGCAGG - Intergenic
989410420 5:41113621-41113643 TTGAGGATGGATAGTGAAGTAGG + Intergenic
989502133 5:42179864-42179886 TTGAGGGTAGAGAGGAAAGAGGG + Intergenic
989585032 5:43067801-43067823 TTGAGGATTTCAAGGGGAGAGGG - Intronic
989820074 5:45786141-45786163 TTGAGGAGGTGGAGCCAAGATGG + Intergenic
990146740 5:52769530-52769552 TTGAGGTTCTATAGAGAAGACGG + Intergenic
990227334 5:53669380-53669402 ACGAGGTTGTAGAGGGAGGAAGG - Intronic
990275019 5:54186172-54186194 TTGAGGATGTACAGGGATTACGG - Intronic
990325108 5:54667536-54667558 TTGAGGATGCAGAAGGGTGAGGG - Intergenic
990893300 5:60671172-60671194 TTGAGGATGAAGAGTCAAGGAGG + Intronic
992155332 5:73949893-73949915 TTGATGATTTAGAGGGAAAGTGG - Intergenic
992813604 5:80413953-80413975 TTGGGAATATAGAGGGGAGAGGG - Intronic
993923518 5:93837124-93837146 TTGAGGGTGGAGTGGGAGGAGGG - Intronic
994193342 5:96893822-96893844 ATGAGGATGGAGAGGTAAAAAGG - Intronic
995259356 5:110083809-110083831 ATGAGGAAGAAGAGGGAAGGTGG - Intergenic
995466270 5:112452230-112452252 TTGAAGCTGTAGGAGGAAGATGG - Intergenic
996410954 5:123158353-123158375 TTGGAGATGCAGAGGGAGGAAGG + Intronic
996487699 5:124056256-124056278 TTGGGGATGGAGTGGGAGGAAGG + Intergenic
997263005 5:132478077-132478099 TTGTGGATGCTGAGGGAAGGCGG - Intergenic
997432561 5:133850808-133850830 TTGAGGATTTATAGGGATGTGGG - Intergenic
997977933 5:138451120-138451142 TTCAGGATCAAGAGGGGAGAGGG + Intergenic
998216749 5:140243281-140243303 TGGAGGGAGAAGAGGGAAGAGGG - Intronic
998732978 5:145102389-145102411 TTGAGAATTTAGAGGAAAGCTGG + Intergenic
999072795 5:148765349-148765371 ATGAGAAAGGAGAGGGAAGAGGG - Intergenic
999672651 5:153971365-153971387 GTGAGGATGGAGAGAGGAGATGG - Intergenic
1000681940 5:164196045-164196067 CTGAAGAGGTAGAGAGAAGATGG - Intergenic
1000755824 5:165158375-165158397 TTGAAGATTTACAGGTAAGAAGG + Intergenic
1001682490 5:173569267-173569289 GGGAGGGGGTAGAGGGAAGAAGG + Intergenic
1001815712 5:174667751-174667773 TGGAGGATGTACAGAGGAGAAGG + Intergenic
1001833519 5:174809884-174809906 TTCAGGATGTTGAAGGAAGTGGG - Intergenic
1001960477 5:175877687-175877709 TCAGGGATGTAGGGGGAAGATGG + Intronic
1001961216 5:175881146-175881168 GTGGGGATGGTGAGGGAAGAGGG + Exonic
1002288354 5:178180608-178180630 TTGACGAAGAAAAGGGAAGATGG - Intergenic
1002850909 6:995645-995667 TTGAGGATGGAGAGGGAAGGAGG - Intergenic
1003066489 6:2908343-2908365 AAGAGGATGTAGAGAGGAGAAGG + Intergenic
1003126350 6:3359027-3359049 TTCAGGATGAAGAGAGAATAGGG + Intronic
1003460232 6:6321864-6321886 TTGGAGATGCAGAGGGAGGAGGG - Intergenic
1004144742 6:13054874-13054896 TTGAGGATGTAGAGGGAAGAAGG - Intronic
1004816450 6:19316286-19316308 GTGAGGATACAGAGAGAAGACGG + Intergenic
1004893009 6:20119913-20119935 ATGAGGCTGGAGATGGAAGAAGG - Intronic
1005211306 6:23467444-23467466 TTGAGGATGTAAAGGGAGGATGG + Intergenic
1005473466 6:26184643-26184665 GTGAGGCGGTAGAGGGAAGAGGG - Intergenic
1005683068 6:28225700-28225722 TTCAGAATCTAGAGGTAAGAGGG - Intronic
1006342745 6:33455574-33455596 TAGAGGATGTAGTGGAAAGAAGG - Exonic
1006641200 6:35490717-35490739 TAGAGGATCTAGGGAGAAGAAGG - Intronic
1007371608 6:41429872-41429894 TTGAAGAGGGAGAGGGGAGAGGG - Intergenic
1008864982 6:56199668-56199690 TTGAGAATGTTGAGAGAATAAGG + Intronic
1008932848 6:56957848-56957870 TTGAGAATCTAAAGGGAAGAAGG - Intronic
1010038034 6:71348367-71348389 ATGAGGATGGAGAGGGAGGTAGG - Intergenic
1011140627 6:84151681-84151703 TTGGGGATGGAGAAGGAAGAAGG + Intronic
1011221436 6:85058355-85058377 TTGAGTTTGAGGAGGGAAGAAGG + Intergenic
1011443446 6:87411922-87411944 GTGAGGATGCAGAGAAAAGATGG + Intronic
1012954597 6:105555188-105555210 TTGAGGATGAAGCAGGAACAAGG + Intergenic
1012995274 6:105966685-105966707 CTGATGATGAAGTGGGAAGATGG - Intergenic
1013420103 6:109959705-109959727 TTGATGCTGAAGAGGCAAGAAGG - Intergenic
1013422384 6:109978494-109978516 TTGAGGATGTGGGGAGAGGAGGG + Intronic
1013500091 6:110740620-110740642 TTGAGGATATAGTGGGATGCTGG - Intronic
1013512371 6:110856766-110856788 TTCAGGCTCTGGAGGGAAGAAGG + Intronic
1014302131 6:119694802-119694824 ATGAGGAAGGAGAGGCAAGAAGG - Intergenic
1014340336 6:120197647-120197669 TTGAGGAGGAGGAGGGATGATGG - Intergenic
1014688636 6:124533870-124533892 GTGAGGACACAGAGGGAAGATGG - Intronic
1014792260 6:125686758-125686780 TTGGGGATTCAGGGGGAAGAGGG - Intergenic
1015119742 6:129687950-129687972 TTGACACTGTAGTGGGAAGAGGG - Intronic
1015649785 6:135443813-135443835 TGGAGGATGCAGAGAAAAGATGG - Intronic
1016306669 6:142692186-142692208 TTGAGGTGGCAGAGGGAGGAAGG - Intergenic
1016708614 6:147143282-147143304 TTGGGAAGGTAGAGGAAAGAAGG - Intergenic
1016792366 6:148079173-148079195 GTGAGGAAGGAGAGTGAAGAGGG + Intergenic
1017239315 6:152149280-152149302 TTGAGGAAGCTGAGGCAAGAAGG + Intronic
1017419462 6:154258735-154258757 TTGAGGATCTAGACTGTAGACGG - Intronic
1017467440 6:154707531-154707553 TGGAGGCTGCAGAGGAAAGAAGG + Intergenic
1018317458 6:162570809-162570831 TTGGGAAGGTAGAGGGAGGATGG + Intronic
1018452107 6:163918980-163919002 TTGAGAATGCTGGGGGAAGACGG + Intergenic
1018897172 6:168027697-168027719 GTGGGGATGTGGAGGGAAGCCGG - Intronic
1019220758 6:170470731-170470753 TTCAGGAAGGAGAGGGGAGAGGG + Intergenic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1020040911 7:5000207-5000229 TTGAGGCTTTCAAGGGAAGAGGG + Intronic
1020108587 7:5434859-5434881 GTGAGGACGTAGGGAGAAGACGG - Intronic
1021202988 7:17746309-17746331 TTGAGGTTGTAGAAAGAATAGGG - Intergenic
1021295909 7:18905799-18905821 TTGATGAGGGAGAAGGAAGAAGG - Intronic
1021508250 7:21408615-21408637 ATGAGGAAGTAGAGGTATGAAGG + Intergenic
1021697362 7:23287779-23287801 TTGAGGGTGGAGAGGGAGGGTGG - Intergenic
1022196322 7:28070680-28070702 TAGAGGAGGTAGCAGGAAGATGG + Intronic
1022270976 7:28807810-28807832 TTGAGAATGAAGAAGGAGGAAGG + Intronic
1022591585 7:31668988-31669010 TTGAGGAAGGAGAAGGAAGTAGG + Intergenic
1022633216 7:32105640-32105662 GGGAGGATGAAGAGGGAGGATGG - Intronic
1023770661 7:43553840-43553862 TTGTGCAAGTGGAGGGAAGAAGG - Intronic
1024145603 7:46513535-46513557 GTGAGGATGTGGAGGAATGAGGG - Intergenic
1024754840 7:52517843-52517865 TAGAGGATGAAGGGGGAAGTAGG + Intergenic
1025274397 7:57564214-57564236 TGGAGGATGCAGACAGAAGAGGG + Intergenic
1025640867 7:63367426-63367448 TTGAGGATGTTGAAATAAGAAGG + Intergenic
1026009837 7:66628467-66628489 TGGAGGATGTGGCGGGAGGAGGG - Intergenic
1026134402 7:67646798-67646820 TTGAGGATGTGGAGGAGGGAAGG - Intergenic
1026154775 7:67817444-67817466 ATGAGGATACAGAGAGAAGATGG - Intergenic
1026222845 7:68415414-68415436 AAGACGATGGAGAGGGAAGAGGG + Intergenic
1026403165 7:70036873-70036895 GTGGGGATGTAGAGGGACAAAGG + Intronic
1026556366 7:71412107-71412129 TAGAGAATGTAGAAGGAAGAAGG - Intronic
1027941414 7:84685752-84685774 ATGAAGATGGAGAGGGAACAAGG + Intergenic
1028684375 7:93575524-93575546 GAGAGGATGGCGAGGGAAGACGG + Intergenic
1030519113 7:110575374-110575396 TAGAGGAGGTAGATGGAAGGTGG - Intergenic
1031185228 7:118471330-118471352 CAGAGGATGTAGAAGAAAGAAGG + Intergenic
1031247688 7:119337675-119337697 GTGAGGAGGGAGAGGGAGGAGGG - Intergenic
1031325125 7:120386375-120386397 TTGAGGGGGAAGAGGCAAGAAGG - Intronic
1031695369 7:124845042-124845064 TGGAGGATTTAGAGGAAAGGAGG - Intronic
1032486071 7:132288378-132288400 TTGAGAATGAAGTGGGAAGTGGG + Intronic
1032960439 7:137027355-137027377 GTGAGGATGGAGAGGAAGGAGGG - Intergenic
1033116814 7:138632682-138632704 TGGAGAATGTGCAGGGAAGATGG + Intronic
1033561492 7:142536344-142536366 TTGAGGATGTAATAGGGAGAAGG + Intergenic
1034366679 7:150555740-150555762 TGGAGGATGGAGAGTGAAGATGG - Intergenic
1034402703 7:150876078-150876100 GTGAGGACGCAGTGGGAAGATGG - Intergenic
1034623532 7:152474847-152474869 ATGAGGAAGTAGATGGAGGAGGG + Intergenic
1036574105 8:10009257-10009279 TTGAGGATGTAAAGTGATGAGGG - Intergenic
1038254162 8:25935231-25935253 TTAAGGATGGAGAGGGAGGTGGG + Intronic
1039343888 8:36682547-36682569 TTGAGACTGAAGAGGGAAGTTGG + Intergenic
1039842205 8:41302277-41302299 TTGTGGATGAAGATGGAAGCTGG - Intronic
1040946710 8:52892796-52892818 TTGAGGACCTAATGGGAAGATGG + Intergenic
1041246026 8:55889314-55889336 TGGAGGCTGAAGTGGGAAGATGG - Intronic
1041497768 8:58505955-58505977 ATGAGGAAGTAGAGGCAAGAAGG + Intergenic
1041654438 8:60335062-60335084 CAGAGGATGCAGAGGGAAGGGGG + Intergenic
1041747694 8:61226735-61226757 CTGAGGCTGGGGAGGGAAGAGGG + Intronic
1041812851 8:61931191-61931213 TAGAGCATGTAAAGGGAAAATGG - Intergenic
1042942428 8:74121292-74121314 AGGAGGATGAAGTGGGAAGATGG - Intergenic
1043523796 8:81074313-81074335 GTGAGGATCATGAGGGAAGAGGG + Intronic
1043810529 8:84733422-84733444 TTGATGAGGTAGATGGATGAGGG - Intronic
1045199273 8:99962593-99962615 TTCAGAATGTACAGGGAGGAAGG - Intronic
1045281126 8:100750554-100750576 TTTAGGAAGAGGAGGGAAGAGGG + Intergenic
1045962880 8:107989379-107989401 TGGAGGAGGTAGAGGGAAGAAGG - Intronic
1047056645 8:121172251-121172273 TTAAGGAAGAAGAGGCAAGAAGG + Intergenic
1047318640 8:123757502-123757524 CTGAGGCTGAAGAGGGGAGAGGG + Intergenic
1047631015 8:126708583-126708605 TTGGGGATTGAGAGGGAAGATGG - Intergenic
1047746998 8:127852748-127852770 GTGTGGATGGAGAGGGAGGAGGG - Intergenic
1048020990 8:130538838-130538860 CTGAGGATGTAGAGAGAAATTGG + Intergenic
1048450312 8:134527705-134527727 TTGAGGATCCTGTGGGAAGAGGG - Intronic
1048831544 8:138482249-138482271 GTGAGGAAGTGTAGGGAAGAGGG + Intronic
1048876642 8:138841678-138841700 TTGACGAAGAGGAGGGAAGAGGG + Intronic
1049274739 8:141714527-141714549 TATAGGAGGTAGAAGGAAGATGG + Intergenic
1049609900 8:143550069-143550091 TTGCGGACCCAGAGGGAAGAAGG - Intergenic
1049652976 8:143783839-143783861 TTGATGGTGTAGAGTGAGGAGGG - Intergenic
1050266467 9:3895692-3895714 ATGAAGATGAACAGGGAAGATGG - Intronic
1050312027 9:4362898-4362920 TTGAGGAGTTAGAGGGAGGAAGG + Intergenic
1050397176 9:5211215-5211237 TTGACGATGAAGAGGGATCATGG + Intergenic
1050399411 9:5235356-5235378 TTGAAGATGAAGAGGGATCATGG + Intergenic
1051389537 9:16549110-16549132 TTTTGGATGTAGGGGGAAGAGGG - Intronic
1051784051 9:20722306-20722328 TTGTGGATGTCTAGAGAAGAGGG - Intronic
1051888657 9:21921729-21921751 GTGAGGCTGAAGAGGGCAGATGG + Intronic
1051920669 9:22260141-22260163 TTGATGCTGTAAAGGGAAGCAGG - Intergenic
1051957946 9:22720070-22720092 TTTATTATGTAGAGGAAAGATGG - Intergenic
1052145878 9:25048512-25048534 TTGATTATGGAGTGGGAAGAAGG - Intergenic
1052394370 9:27921143-27921165 TTGAGGATGCAGAGGAGAAAAGG + Intergenic
1052597559 9:30579575-30579597 TTAAGGAAGAACAGGGAAGATGG + Intergenic
1052603420 9:30669984-30670006 TTGTGGCTCTAGAGAGAAGAGGG + Intergenic
1052660487 9:31422785-31422807 TGGAGGCTGTAAAGGGAACATGG + Intergenic
1052861907 9:33442585-33442607 TTTAAGAGCTAGAGGGAAGACGG - Intronic
1053470575 9:38343413-38343435 CTGAGGATGCAGAGTGATGATGG - Intergenic
1053545731 9:39021054-39021076 TGGAGGATGTAGAGACAGGAGGG - Intergenic
1053599334 9:39594117-39594139 GTGAGAATGTACAGGAAAGAAGG - Intergenic
1053810054 9:41842741-41842763 TGGAGGATGTAGAGACAGGAGGG - Intergenic
1053857039 9:42348303-42348325 GTGAGAATGTACAGGAAAGAAGG - Intergenic
1054254190 9:62748269-62748291 GTGAGAATGTACAGGAAAGAAGG + Intergenic
1054568255 9:66782439-66782461 GTGAGAATGTACAGGAAAGAAGG + Intergenic
1054620539 9:67344687-67344709 TGGAGGATGTAGAGACAGGAGGG + Intergenic
1054720185 9:68596104-68596126 TTGAGGCTGAAGAGGGCAGAGGG - Intergenic
1054850739 9:69843986-69844008 TTAAAAATGTAGATGGAAGAAGG - Intronic
1055097690 9:72430809-72430831 TTGAGGATGAAGAGGGAGATGGG - Intergenic
1055378040 9:75671798-75671820 TTGAAGAAGAAGAGGGAAGGGGG + Intergenic
1055977486 9:81969223-81969245 TTGGGGATGTATAGGGGTGAGGG - Intergenic
1056198659 9:84253279-84253301 ATGAGGCTGTGTAGGGAAGAGGG - Intergenic
1057226699 9:93296568-93296590 AGGAGGATGAAGGGGGAAGAAGG - Intronic
1057637744 9:96786606-96786628 TTGGAGATGTAGAGGGCTGAAGG - Intergenic
1058412147 9:104745979-104746001 CTGAGGCTGAGGAGGGAAGAAGG - Intergenic
1058634242 9:107020929-107020951 TTAAGTATGAAGATGGAAGATGG + Intergenic
1059370200 9:113824501-113824523 TTGAGGATATAATGAGAAGATGG + Intergenic
1059639618 9:116203949-116203971 TTGAGGTTGTAGAAGGAAGAAGG + Intronic
1060817207 9:126641334-126641356 CTGAGGATGCAGAGAGATGATGG - Intronic
1061298035 9:129687543-129687565 TTGAGTGTGCAGAGGGAAGCCGG - Intronic
1062517971 9:136945561-136945583 TGGGGGGTGTAGAGGGAAGCAGG + Intronic
1062731374 9:138112065-138112087 ATGAGGATTTAGGAGGAAGATGG - Intronic
1203354924 Un_KI270442v1:127042-127064 TTGAGGATTTAGATGGAAACGGG - Intergenic
1186063784 X:5739833-5739855 TTGAGGATGCAGAGAAAACAAGG + Intergenic
1186357562 X:8803160-8803182 TTTAAAATGTTGAGGGAAGAAGG - Intergenic
1186617931 X:11208981-11209003 TTTAAAATGTTGAGGGAAGAAGG + Intronic
1186958608 X:14710296-14710318 TTGAGCAGTAAGAGGGAAGAGGG + Intronic
1190088226 X:47414821-47414843 TTGGGGCTGGAGAGGGAAGAAGG + Intergenic
1190305491 X:49079412-49079434 TTGAGGATTTGAAGGGAAGTTGG - Intronic
1190773777 X:53536500-53536522 TTGGGGTTGCAGTGGGAAGATGG + Exonic
1190857968 X:54315983-54316005 TTGAGGGTCTAAAGGGTAGACGG - Intronic
1191885639 X:65885042-65885064 CTGAGGATGCAGCAGGAAGATGG + Intergenic
1192216755 X:69164671-69164693 TTGAGGATGGAGGGGCAAGGAGG + Intronic
1194868294 X:99096704-99096726 TTGGGGAGGTAAAGGGAATATGG - Intergenic
1195364149 X:104111609-104111631 GTGAGGAGGTAGTGGGGAGAGGG - Intronic
1195619583 X:106939607-106939629 ATGAGGCTTTAAAGGGAAGAAGG - Intronic
1195961664 X:110393613-110393635 AGGAGGATGAAGAGAGAAGAGGG - Intronic
1196008113 X:110856809-110856831 TGGGAGATGTAAAGGGAAGAAGG - Intergenic
1196376630 X:115040106-115040128 AGGAGGATGTAGTGGGAAGGTGG - Intergenic
1197663795 X:129201346-129201368 ATGAGGATGGAGAGGGGAGTAGG - Intergenic
1198516766 X:137416500-137416522 TTGACGATATAGAAGGAAGAGGG + Intergenic
1198798400 X:140424390-140424412 TTGAGGCTGGAGGAGGAAGAAGG + Intergenic
1199550582 X:149057037-149057059 TTAAGGAAGTAGATGGAGGAGGG - Intergenic
1199868054 X:151872084-151872106 TTGAGGGTGAAGAGGTAGGAAGG + Intergenic
1199974902 X:152888505-152888527 TTGTTGATGTAAAGGGAAGAAGG + Intergenic
1201983848 Y:19939723-19939745 ATGAGGTTGCAGAGGAAAGAGGG - Intergenic