ID: 1004149833

View in Genome Browser
Species Human (GRCh38)
Location 6:13105722-13105744
Sequence AAGCACTTACACCTAATTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004149830_1004149833 2 Left 1004149830 6:13105697-13105719 CCAGAAGGACTCACAGAACTCAG 0: 3
1: 12
2: 18
3: 79
4: 280
Right 1004149833 6:13105722-13105744 AAGCACTTACACCTAATTAAAGG 0: 1
1: 0
2: 1
3: 12
4: 141
1004149828_1004149833 21 Left 1004149828 6:13105678-13105700 CCTTTGGCTTAGTAATTCTCCAG 0: 1
1: 0
2: 0
3: 26
4: 194
Right 1004149833 6:13105722-13105744 AAGCACTTACACCTAATTAAAGG 0: 1
1: 0
2: 1
3: 12
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004149833 Original CRISPR AAGCACTTACACCTAATTAA AGG Intronic
900723939 1:4202432-4202454 AAGGACTAATACCTAATTATGGG - Intergenic
901243941 1:7713546-7713568 ACACATTTACACCTCATTAAGGG - Intronic
904375773 1:30081492-30081514 AAGGACTTCCAGCTAATGAAGGG - Intergenic
906540241 1:46579789-46579811 AAGGCCTTACAGCTAATTAAAGG + Intronic
906563591 1:46779064-46779086 AAGGACTTAAACCTAATGAGAGG - Intronic
908880624 1:68727622-68727644 AAGTAGTTACACCTAATATAAGG - Intergenic
909125418 1:71662144-71662166 AAGGTCTTGCACCTAGTTAATGG - Intronic
909829015 1:80161684-80161706 AAGCCCTTGAACCAAATTAACGG - Intergenic
912068042 1:105771207-105771229 ATCCACTTACACATATTTAAGGG - Intergenic
914941507 1:152027299-152027321 AAGAACAGAGACCTAATTAAAGG - Intergenic
918274620 1:182941939-182941961 AAGCATTTACACTTAAAAAATGG + Intronic
918771875 1:188571507-188571529 AAAGACTGACACCTAATCAAAGG + Intergenic
919100241 1:193087443-193087465 AAGAACTTTCAACTAATAAAGGG - Intronic
923432629 1:233937943-233937965 AACTACTTTCAACTAATTAACGG - Intronic
924016686 1:239733424-239733446 AACCACTTGCCCCTTATTAATGG - Intronic
1063998102 10:11640206-11640228 AAGTCCTTACCCCTAATTGATGG - Intergenic
1064493938 10:15887859-15887881 AAGGCCTTGCACCTACTTAAGGG - Intergenic
1064829638 10:19447869-19447891 GAGAATTCACACCTAATTAATGG - Intronic
1069149479 10:64939512-64939534 AACCAATAACACATAATTAAAGG - Intergenic
1069938854 10:71939681-71939703 AAGGGCTTACAACTAACTAAGGG - Intergenic
1070563493 10:77585665-77585687 AAGCATGTAAACCTAATTAGGGG - Intronic
1078709872 11:13780819-13780841 AACCACTTACACATTATTCAAGG - Intergenic
1080281504 11:30562646-30562668 AGGCACCTACAGCTTATTAAGGG + Intronic
1080819742 11:35793967-35793989 AAGCACTTACAATTAATAAATGG - Intronic
1082689707 11:56285158-56285180 AATCCCTTACACCCTATTAAAGG - Intergenic
1090968843 11:131622178-131622200 TAGCACTTTTACCTAATTACAGG - Intronic
1091055459 11:132414212-132414234 AAGATCTCACACCTAGTTAACGG + Intergenic
1095776165 12:46012351-46012373 AAGGTCTTACAACTAATTAAAGG + Intergenic
1096168097 12:49442230-49442252 AATCACTTACACTTAATAAATGG + Intronic
1098585204 12:72146164-72146186 AGCCACTTACAACTAATAAATGG - Intronic
1099571791 12:84330334-84330356 TTGCAATTACACGTAATTAATGG + Intergenic
1101473029 12:105017040-105017062 AAGCCATTACACCTAATTTTCGG - Intronic
1105445083 13:20446838-20446860 AAGCACTATCCCCAAATTAAAGG - Intronic
1111237513 13:85429085-85429107 ATGCAATTACACAAAATTAATGG + Intergenic
1111292539 13:86187219-86187241 CAGTACTTACAGCAAATTAAGGG + Intergenic
1111305510 13:86408234-86408256 ATGCACTCAAATCTAATTAACGG + Intergenic
1112067468 13:95809141-95809163 AAGCATTTACACTTAAAAAATGG + Intronic
1114307375 14:21436647-21436669 AAGCACTCACACCTCAATCAAGG + Intronic
1115101181 14:29702219-29702241 AAGCTCTTACACGCAATTAGAGG - Intronic
1117462974 14:55964507-55964529 AAGAACTTACACCCAAATAGTGG - Intergenic
1118762261 14:68887620-68887642 AAGCATTTACACTTAAAAAATGG + Intronic
1120092625 14:80350715-80350737 ACGCATTTAGACCTACTTAAAGG - Intronic
1122256491 14:100481419-100481441 AAGCATTTACACTTAAAAAATGG - Intronic
1123147965 14:106152374-106152396 AAGCACTTACACACTGTTAATGG + Intergenic
1123401253 15:19989432-19989454 AAGGACTTATTCCTAATGAATGG + Intergenic
1126272076 15:46831697-46831719 AAGCACCTACTCACAATTAAAGG + Intergenic
1127786677 15:62361863-62361885 AAGCATTTACACTTAAAAAATGG + Intergenic
1127851773 15:62919662-62919684 AAGCTCTTACAGCTAGTAAAAGG + Intergenic
1128520721 15:68372917-68372939 ATACACTTACACATAATTAGGGG - Intronic
1130407880 15:83618247-83618269 GATCACTTCCACGTAATTAATGG - Exonic
1131005926 15:88978311-88978333 AAGCTCTCACAGCTAATTGATGG - Intergenic
1131473005 15:92712253-92712275 AAGCATTTACACTTAAAAAATGG - Intronic
1135639282 16:24106606-24106628 AAGCATATACACATTATTAAAGG + Intronic
1135889371 16:26343352-26343374 AACCACTTACAGCTAGCTAATGG + Intergenic
1136051263 16:27652074-27652096 GAGCACACACACCTAAGTAAGGG - Intronic
1141888371 16:86909157-86909179 AAGCACTTAGACAAAATTAAGGG + Intergenic
1147807975 17:43145718-43145740 AAGCATTTACACTTAAAAAATGG - Intergenic
1149120825 17:53161989-53162011 AAGCCCTTGCAGCTAATTAAAGG - Intergenic
1149939830 17:60851884-60851906 AAGCATTTACACTTAAAAAATGG - Intronic
1149969206 17:61199480-61199502 AATCACATACACCTAAACAATGG - Intronic
1158417928 18:57266113-57266135 AAGCACATACAACTACGTAAAGG + Intergenic
1161523341 19:4738270-4738292 CAGCAATTACAGCTAATAAACGG - Intergenic
1164627085 19:29736921-29736943 AAGCACTGACACCTTTTAAAAGG - Intergenic
926626124 2:15091429-15091451 ATCCACTTCCACCTAATGAATGG + Intergenic
927569243 2:24144045-24144067 AAGCACTTACACATCATAAATGG - Intronic
928354201 2:30594552-30594574 ATGCACATACACACAATTAAAGG - Intronic
929872286 2:45769336-45769358 AAGCCCTAACACCTAACAAAAGG - Intronic
930603834 2:53472163-53472185 AAGAAATTACACCTCCTTAATGG - Intergenic
931849426 2:66237533-66237555 AAGCACTGACCCCTCATTAAAGG + Intergenic
932985392 2:76720467-76720489 AAGAACTTCCTCCCAATTAACGG - Intergenic
934867687 2:97827693-97827715 AAGCATTTACACTTAAAAAATGG - Intronic
935320405 2:101882433-101882455 CAGCACTTAAACCTAGTGAAAGG - Intronic
935543772 2:104378950-104378972 AAGCACTTACAGGAAATTAGAGG + Intergenic
936979947 2:118255128-118255150 AAGCACTGACACCTCATGAGGGG - Intergenic
937173407 2:119901251-119901273 AACCACTAAGACCTAATTACAGG + Intronic
939516996 2:143181686-143181708 AAGAGCTAACACCTAATTGAGGG - Intronic
939654821 2:144811071-144811093 GAGCACTTACAGCAAATTTAAGG - Intergenic
939999962 2:148957351-148957373 AATCAGTTAAAGCTAATTAAGGG + Intronic
1169752045 20:9004496-9004518 AAGCAGTAACATCTAATTTAGGG + Intergenic
1169759519 20:9075909-9075931 AAGCACTTACAGCTAACAAAAGG - Intronic
1170416154 20:16144729-16144751 AAGCTCTTACAACTAATCACTGG + Intergenic
1178729617 21:35088381-35088403 ATGCACTTTCACCCACTTAATGG - Intronic
1179213122 21:39342947-39342969 AAGCATTTACACTTAAAAAATGG + Exonic
1180571731 22:16729128-16729150 ATGTATTTACACCCAATTAAGGG + Intergenic
1182568624 22:31218997-31219019 AAGCTCTTAGACCAAATTTAAGG + Intronic
949199364 3:1355078-1355100 ATGCATTTACACCTAATAATGGG + Intronic
951724660 3:25743844-25743866 AAACAGTAACACCCAATTAAGGG + Intronic
957360421 3:79149667-79149689 AAACACTGAAACCTAATTATAGG - Intronic
958632668 3:96702187-96702209 AAGGACTTAAAACAAATTAAGGG + Intergenic
959388670 3:105745282-105745304 AAGAAATTACACCTTATTAATGG - Intronic
960894144 3:122483734-122483756 AAGCATTTACACTTAAAAAATGG - Intronic
963015766 3:140822390-140822412 TAGCAATCACACCTCATTAAGGG - Intergenic
963152659 3:142062105-142062127 AACCACTTACACTTAATGAATGG + Intronic
963658190 3:148086989-148087011 AAGCACTTACTCATAATTGCAGG + Intergenic
964604039 3:158539808-158539830 AAGTACTTACACATAATAGAAGG - Intronic
964873124 3:161335128-161335150 AAGCACTTATCCCTTATAAAGGG + Intergenic
965357474 3:167694167-167694189 AAGCATTTACACTTAAAAAATGG + Intronic
971491104 4:27212804-27212826 ATCCACTTCCACCTAATGAATGG + Intergenic
973538596 4:51910326-51910348 AAGAACATAAACCTAAATAAGGG - Intronic
974486375 4:62510914-62510936 AAACATTTACACTTAAATAATGG - Intergenic
974702560 4:65470899-65470921 AGGCACATACTCCTAATTTAGGG - Intronic
977050411 4:92122124-92122146 AAGCTCCTACACATCATTAAGGG - Intergenic
978757223 4:112315490-112315512 AAGCCCTTTCCCCTATTTAAGGG + Intronic
981172409 4:141639895-141639917 ATGCACTAACACCTATTTGATGG + Intronic
984913954 4:184703335-184703357 AAGAACTAACACCTGATTTATGG - Intronic
986377359 5:7146004-7146026 AAGCACTTTCTCCTAATTCTTGG - Intergenic
994091693 5:95815262-95815284 AAGCACTCAAACCCAATTAATGG - Intronic
995086383 5:108115663-108115685 AAATATTTACAACTAATTAAAGG + Intronic
996432441 5:123396825-123396847 AAGATCTTACAGCTAGTTAATGG - Intronic
996549960 5:124720055-124720077 AAGTACTTAAACATAATTTAAGG + Intronic
996793846 5:127322475-127322497 AAGCACTTACAACCAGTGAATGG - Intronic
998024883 5:138807456-138807478 AAGCACTAACAACTAGTTTAGGG - Intronic
999025156 5:148221192-148221214 AAGCACTTACACTTAAGTAATGG + Intergenic
1003197555 6:3928514-3928536 AACCACTTACACCCAAATTAAGG - Intergenic
1004149833 6:13105722-13105744 AAGCACTTACACCTAATTAAAGG + Intronic
1006243662 6:32709554-32709576 AAACACTTAGACCTATTTTATGG + Intergenic
1009548258 6:65050250-65050272 TAGCACTTACAACGAACTAAAGG + Intronic
1010490455 6:76469944-76469966 AAGCACATACTCCTAAATTAGGG + Intergenic
1010609537 6:77937046-77937068 AATAACTTACACCTAATATATGG - Intergenic
1012015776 6:93848862-93848884 AAACAATTACACGTGATTAATGG - Intergenic
1015053511 6:128871396-128871418 AAGCAAATAAACCTAATAAAAGG - Intergenic
1018306009 6:162456292-162456314 AAGCCCATTCATCTAATTAAGGG + Intronic
1018530352 6:164756588-164756610 AGGCAGTAACACCTAATTCAAGG + Intergenic
1021568143 7:22034904-22034926 GACCACTTACACAGAATTAATGG - Intergenic
1022196424 7:28071666-28071688 CGGCACTTACAGCTGATTAAAGG + Intronic
1026413169 7:70148058-70148080 AAACACTTACAGGGAATTAAAGG - Intronic
1026779278 7:73253656-73253678 CAGCACTTAGACATATTTAAAGG - Intergenic
1027020136 7:74807062-74807084 CAGCACTTAGACATATTTAAAGG - Intronic
1027067890 7:75138877-75138899 CAGCACTTAGACATATTTAAAGG + Intronic
1028007683 7:85596971-85596993 AGGCACGCACACCTCATTAAAGG - Intergenic
1029891114 7:103931463-103931485 AGGCACTTACACCTTACCAAGGG - Intronic
1030001000 7:105062067-105062089 AAGTACTTACAGCAAAATAATGG - Intronic
1030780264 7:113592223-113592245 AAGAATTTATACCTAGTTAATGG - Intergenic
1031046555 7:116894926-116894948 AAGCACTTTAATATAATTAATGG - Intronic
1032467688 7:132156734-132156756 AAGCACTTTCACCTACATGATGG + Intronic
1033150355 7:138909146-138909168 AAGCACAAACACCTCATTTATGG - Intronic
1038362502 8:26895346-26895368 AAGCACATACACCTAGTTTGGGG + Intergenic
1041776774 8:61531440-61531462 AAGCTCTTATACCTGATTGAAGG + Intronic
1042106434 8:65332373-65332395 TAGCACTTATACCTATTAAATGG + Intergenic
1045688336 8:104734784-104734806 AAGAACTTACAACTTAGTAATGG + Intronic
1055381832 9:75715791-75715813 AATCACTTACAGCTAACTTAGGG + Intergenic
1056342545 9:85652160-85652182 AAGCAATCACACCTACATAATGG + Intronic
1056435732 9:86574609-86574631 AAGCACTGAGTTCTAATTAAGGG + Intergenic
1056749367 9:89336061-89336083 AAGCACTTAAAATTACTTAAGGG - Intronic
1057326043 9:94065131-94065153 TGGCACTTACAACTAATGAAAGG - Intronic
1058770338 9:108224958-108224980 AAGCCCTTAAACCTAGTGAAAGG + Intergenic
1186657266 X:11627605-11627627 AATCACTTTGACCTAATTACTGG - Intronic
1189902143 X:45717532-45717554 TAGCAATTACACCTCAATAAAGG + Intergenic
1195270789 X:103228592-103228614 AAGATCATACACCTAATAAATGG - Intergenic
1195449632 X:104996745-104996767 AAGAACTTACATCTAATGGAAGG + Intronic
1195638353 X:107144369-107144391 AAGAACACACAGCTAATTAATGG - Intronic
1196289441 X:113922073-113922095 AAGGATTTAGACCTACTTAAAGG + Intergenic
1197969197 X:132097189-132097211 AAGCACTTGCCCCCAATAAATGG + Intronic
1199503890 X:148539906-148539928 TAGCATTTACCCTTAATTAATGG - Intronic
1199825403 X:151493887-151493909 AAGCTCTCACACCCAATTGATGG - Intergenic