ID: 1004150972

View in Genome Browser
Species Human (GRCh38)
Location 6:13119838-13119860
Sequence GATTCCTGGAAAATGACACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 241}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004150972_1004150976 5 Left 1004150972 6:13119838-13119860 CCCTGTGTCATTTTCCAGGAATC 0: 1
1: 0
2: 1
3: 17
4: 241
Right 1004150976 6:13119866-13119888 TTGTAGAGACAAAGTCTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004150972 Original CRISPR GATTCCTGGAAAATGACACA GGG (reversed) Intronic
901937414 1:12636348-12636370 CAGTGCTGGAAAATGCCACATGG + Intergenic
903267612 1:22167332-22167354 GACTCCTGGAAAGTGAGACTGGG + Intergenic
908162450 1:61423867-61423889 GCTTCTGGGAAAAGGACACAGGG - Intronic
911609915 1:99949571-99949593 GGTTCCTGGGAAATAACACTTGG + Intergenic
913171473 1:116236262-116236284 CATTCTAGGAAAAAGACACATGG - Intergenic
913685547 1:121228403-121228425 GATCCGAGGAAAATGAAACAGGG - Intronic
914037393 1:144016007-144016029 GATCCGAGGAAAATGAAACAGGG - Intergenic
914152060 1:145051925-145051947 GATCCGAGGAAAATGAAACAGGG + Intronic
914380127 1:147108258-147108280 GCTTGCTGGAAAATGTCTCAGGG - Intergenic
914746634 1:150506106-150506128 GAACCCTGGAAAATGAAAAAGGG - Intronic
915478051 1:156165410-156165432 GATTCCTGGAAAAGGATACATGG + Intronic
915716764 1:157951460-157951482 GATGCCTGTAAAATGAGACGGGG - Intergenic
917180942 1:172297003-172297025 GATTACAGGAACATGCCACAAGG - Intronic
917353670 1:174104424-174104446 GATTCCTGGAAAATAACGAAAGG + Intergenic
918727404 1:187943133-187943155 GATACCTGCAAGATGACTCATGG + Intergenic
920472866 1:206246961-206246983 GATCCGAGGAAAATGAAACAGGG - Intronic
920893264 1:210015333-210015355 GATCCCTTGAAAATGTCTCAGGG + Intronic
921421193 1:214950765-214950787 GATACCTGGAAAAAAACAGAAGG + Intergenic
922982253 1:229837234-229837256 CATTTTTGTAAAATGACACAAGG - Intergenic
923930583 1:238690916-238690938 GGTTACAGGAAAATGACAAAAGG - Intergenic
1063198137 10:3762167-3762189 AATTCCTGAAGAATGACACTGGG + Intergenic
1063628499 10:7713163-7713185 CAGTCCTAGAAAATGACAGAAGG - Exonic
1063900444 10:10727220-10727242 GATTCCTGGAATTTGACTTATGG - Intergenic
1065657763 10:27969718-27969740 GATTCCTGGTTGATCACACAGGG - Intronic
1065759328 10:28967257-28967279 GTCTCCTGAAAAATGACATAAGG - Intergenic
1067168759 10:43886890-43886912 AATTCCTGGAAGAAAACACAGGG + Intergenic
1067769540 10:49113654-49113676 CTTTCCTGTAAAATGAGACATGG + Intronic
1070617690 10:77981655-77981677 CATTTCTGGAAAACGGCACAGGG - Intronic
1072065979 10:91872045-91872067 GATTCCTGGAATCTGTCACTGGG - Intergenic
1075812640 10:125236472-125236494 GAGTCTTGGAAAATGACAGGTGG + Intergenic
1078818736 11:14854102-14854124 CATTTCTGGAAAATGAAAAATGG + Intronic
1078866330 11:15301414-15301436 GAATCATGGAATATAACACACGG - Intergenic
1078906472 11:15692657-15692679 GATTCCTGGAAACAGACTCTAGG - Intergenic
1080049507 11:27844899-27844921 GCTTCCTGAAAAAGGACATATGG + Intergenic
1081210026 11:40321767-40321789 GATTCCTGAGAAATTAGACAAGG - Intronic
1081765056 11:45604610-45604632 GATTCCTGGAGAGGGACATAGGG - Intergenic
1084422853 11:69069179-69069201 GAGTCCTAGCAAGTGACACAGGG + Intronic
1084855203 11:71980058-71980080 GTCTCCTAGAAAATGACACCTGG + Intronic
1086186403 11:84022157-84022179 AATTCCTGGAATCTGACAGAAGG - Intronic
1087737462 11:101851219-101851241 CCTCCCTGGAAAATGACACATGG + Intronic
1087791831 11:102413960-102413982 GAATCCAGTAAAATGACACAAGG + Intronic
1087931129 11:103979109-103979131 AATTCCAGGAAAATGACCAATGG - Intronic
1088640926 11:111872129-111872151 GTTTCCTGGTAAATAAAACAAGG - Intergenic
1089410197 11:118234679-118234701 GATTCCTTGGAAATGGCACAGGG + Intronic
1091784667 12:3235937-3235959 GAATCCTGGAACATGAGCCATGG - Intronic
1091847772 12:3670491-3670513 GATTCTTTGCAAATGACTCAGGG - Intronic
1092587664 12:9916718-9916740 GATTCTTGGAAATGGACAAATGG - Exonic
1093296450 12:17397997-17398019 GAATCCTGGTATATGACAAATGG - Intergenic
1093669184 12:21852419-21852441 AATTCCTGCAAGATGACAAAAGG - Exonic
1094526868 12:31236985-31237007 GAATCCTGGAACATGAGGCATGG + Intergenic
1097750220 12:63344502-63344524 GACCCCTGGAGAATGACAGAAGG + Intergenic
1098495534 12:71130890-71130912 GACTTCTTGCAAATGACACATGG + Intronic
1098546633 12:71718804-71718826 GATTGATAGGAAATGACACAAGG - Intergenic
1099420765 12:82457463-82457485 GATTTCTTGAAAATGTTACAAGG + Intronic
1099575634 12:84377489-84377511 GATTGCTGGAAAATGTAAAATGG - Intergenic
1102565800 12:113796774-113796796 GACTCCTGGACAAAGGCACATGG - Intergenic
1102924141 12:116814077-116814099 TACTCCTGGAGAATGACACGGGG - Intronic
1105013086 12:132768671-132768693 TATTCCTGGCAAATGACAACGGG + Intergenic
1105302618 13:19149991-19150013 GATTCCTGGAAGAAGTCACAGGG - Intergenic
1105892663 13:24692716-24692738 GATTGCTGGACAGTGACTCATGG + Intronic
1107221886 13:37991869-37991891 AATTACTAGAAAAAGACACAGGG - Intergenic
1107441503 13:40431443-40431465 GTTTCCTGGAAAATTCCAGATGG + Intergenic
1110768448 13:79307174-79307196 GATATTTGGAAAAGGACACATGG - Intergenic
1113232293 13:108226215-108226237 GTCTAGTGGAAAATGACACAAGG + Intronic
1115102888 14:29724251-29724273 TATTTCTGGACATTGACACAAGG + Intronic
1115372315 14:32631094-32631116 TATTTGTGGAAAATGAGACATGG - Intronic
1116891542 14:50273509-50273531 GACTCCTGGAAGAAAACACAGGG + Intronic
1118016822 14:61669200-61669222 AATTCCTGAAAGATGAAACAAGG + Intergenic
1119354792 14:73997129-73997151 TATCCTGGGAAAATGACACAAGG + Intronic
1121605584 14:95237641-95237663 GCTTCTTGGGAAATGACACCTGG - Intronic
1121787684 14:96674629-96674651 GATACCTGGGAAAGGACAGAGGG - Intergenic
1121904076 14:97723739-97723761 GAGCCCTGGGAAATGAAACAAGG - Intergenic
1121988684 14:98533228-98533250 GATCCCTTGAAAATGTCTCAAGG - Intergenic
1125035032 15:35113414-35113436 GATTGCTGGACACTGAAACATGG - Intergenic
1128695588 15:69759670-69759692 GAATCCTTGAAAAGGAAACAGGG - Intergenic
1129481637 15:75831127-75831149 TATTCCTGGAAAAGGATACCAGG - Intergenic
1133022389 16:2972525-2972547 TCTTCCAGGAAACTGACACAGGG + Exonic
1134221570 16:12358858-12358880 GATTCCTGGAGGTTGATACATGG + Intronic
1134833078 16:17339155-17339177 GATTCCAGAAAAATGACTCTGGG - Intronic
1136631941 16:31493932-31493954 GTCTCCTGGAAAATGGCAGAGGG + Exonic
1137942295 16:52699999-52700021 GAGGCCTGGAAGATGACCCAGGG - Intergenic
1138837669 16:60458280-60458302 GAGTCATGGAAAATGGCAAAAGG - Intergenic
1140271260 16:73468341-73468363 GGTTCCTGGAAACTGACATACGG + Intergenic
1141302145 16:82826960-82826982 AATTACAGGAAAATGCCACACGG + Intronic
1142590519 17:1003418-1003440 GATTCCTGGAAACTCACATCTGG + Exonic
1144004151 17:11085117-11085139 GATTCTTTGAGAATGAGACAGGG + Intergenic
1147359302 17:39921221-39921243 GACCCCTGGAAGAGGACACAGGG + Intronic
1147415163 17:40283617-40283639 GATTCAAGGAAAAGGTCACAAGG - Exonic
1150156751 17:62860399-62860421 GATTCCAGAAAAATAAAACATGG + Intergenic
1151123529 17:71819901-71819923 GATGCCTGGAAAAGGAAAGAGGG + Intergenic
1151536275 17:74740694-74740716 GATTCCAGGAGAGAGACACATGG - Intronic
1153207514 18:2719142-2719164 AATTCCTAGAAAATAAAACAGGG - Intronic
1155785436 18:29893285-29893307 TATTACTGGAAAAAGAAACAGGG + Intergenic
1156849739 18:41712533-41712555 AATTCCTGGAAAAAAACACAAGG + Intergenic
1157131752 18:45013775-45013797 GATGCCTGGGAACTGACACAGGG - Intronic
1157258048 18:46155803-46155825 GAGTCCTAGAAACTGAGACAAGG - Intergenic
1157401987 18:47396383-47396405 TATGCCTGGCACATGACACAGGG + Intergenic
1157401997 18:47396429-47396451 TATGCCTGGCACATGACACAGGG + Intergenic
1159016523 18:63105460-63105482 GTTTCCTGGAAGATGCCAGAGGG + Intergenic
1159205538 18:65246273-65246295 AAGCCCTGGAAAATTACACATGG + Intergenic
1159210521 18:65315708-65315730 AATTCCTAGAAAAAGACATAGGG + Intergenic
1159690996 18:71486886-71486908 GTGACCTAGAAAATGACACATGG - Intergenic
1162722920 19:12673080-12673102 GGCTCCTGGACAAAGACACAGGG + Exonic
1163083572 19:14962211-14962233 GCTTCCTGGAAAATGTCACTCGG - Exonic
1167259900 19:48452550-48452572 GAGTCCAGGAAAGGGACACAGGG - Intronic
926748937 2:16182880-16182902 AATTCCTGGATAAAGAGACATGG + Intergenic
926851107 2:17198294-17198316 GCTTCCTTGAAAATTACCCAAGG + Intergenic
928421308 2:31139174-31139196 GATTCTTGGAAAGTGACCCTGGG + Intronic
928914700 2:36458371-36458393 GATTCCTGGAGGAGGCCACAGGG - Intronic
929953211 2:46433304-46433326 AATTCCTGGGAAAGGATACATGG + Intronic
930063038 2:47306592-47306614 CATGCCTGGAAAATGCCACTAGG + Intergenic
930374181 2:50543150-50543172 GGTTCCTGGAAAAAGATAGAGGG - Intronic
931690474 2:64831223-64831245 GCTTCCTGGAAAACAGCACAAGG - Intergenic
932399488 2:71470097-71470119 GGTTCCTGGCTGATGACACAGGG - Intronic
932501478 2:72186782-72186804 TATTTCTGGTTAATGACACATGG + Intronic
933089126 2:78097527-78097549 GATGAATGGAAAAAGACACAAGG + Intergenic
934551827 2:95267507-95267529 GCTTCCTGGGAGATGCCACATGG + Intergenic
934713453 2:96529975-96529997 GACTCCTAGAAGAGGACACAGGG - Intergenic
935853723 2:107251195-107251217 AACTCCTGGAAGATAACACAAGG - Intergenic
936889554 2:117353327-117353349 GGTACCTGGATTATGACACAGGG + Intergenic
937516657 2:122663305-122663327 GATTCCTGGTGAATGAAATACGG + Intergenic
938881304 2:135592629-135592651 GATTCCTGGAAACTGAGCTATGG - Intronic
938901330 2:135800805-135800827 GACTCCTGGAAACATACACATGG + Exonic
938935938 2:136127628-136127650 AAATTCTGGAAGATGACACAGGG - Intergenic
939683223 2:145164761-145164783 GACTCTTGGAAATTGAGACATGG - Intergenic
941077340 2:161020741-161020763 GATTCTTGTAAAATAACAAATGG + Intergenic
941893525 2:170606610-170606632 CATTCCTAGAAAGTGACACATGG + Intronic
942163394 2:173216247-173216269 GATTTCTGTAACATGGCACATGG + Intronic
943473427 2:188324317-188324339 GTTCCCTGGAAAATGATTCAGGG - Intronic
944615820 2:201459106-201459128 GACTCCTGGAAAATGGCAGGAGG - Intronic
946779762 2:223181793-223181815 GATTCCTGGGAAGGAACACATGG + Intronic
948115103 2:235489439-235489461 CATTCCTGGTAAATGTCACTGGG + Intergenic
1169446991 20:5680518-5680540 GGTTCCTGGGAAGGGACACATGG + Intergenic
1170425373 20:16229932-16229954 GCTCACTGGAAAATGTCACATGG - Intergenic
1171342139 20:24438319-24438341 GATGCCTGGAAAAAAACAGATGG - Intergenic
1173650343 20:44659818-44659840 AATTCCAAGAAAATGACACAGGG - Intergenic
1177380504 21:20335720-20335742 GAAAATTGGAAAATGACACATGG + Intergenic
1177814353 21:25959758-25959780 GATTACTGGAAAGTGATTCAAGG + Intronic
1178033086 21:28550541-28550563 CATTCCTGTCAAATGACAGAAGG - Intergenic
1178086383 21:29115781-29115803 GCTTCCTGGCAAGTGTCACAGGG - Intronic
1178866645 21:36333465-36333487 GATTCTTGGAAGATAACACTGGG - Intronic
1179526423 21:41979813-41979835 GATTACAGTAAAAGGACACAAGG + Intergenic
1182475705 22:30575230-30575252 CAGGCCTGGAAAATGAGACAGGG - Intergenic
1183476964 22:38041050-38041072 GCCTCCTGGAAAATAACACAGGG - Intronic
1183583241 22:38737933-38737955 GCTTCCTGGAAAAGGACACCAGG - Intronic
949900354 3:8809470-8809492 GATTCCTGCTGCATGACACAAGG - Intronic
950603071 3:14052568-14052590 GAGTATTGGAAAGTGACACATGG - Intronic
951241456 3:20290389-20290411 AAATCCTAAAAAATGACACATGG - Intergenic
951780622 3:26359186-26359208 GTTGCCTGGAAAAGGATACAAGG + Intergenic
951993437 3:28701266-28701288 GATTCATGGAAAATGCCATGGGG + Intergenic
952849118 3:37713337-37713359 AACTGCTGAAAAATGACACATGG - Intronic
953107633 3:39900480-39900502 GATTTCTGCAAAATGCCAAAAGG - Intronic
953636331 3:44668277-44668299 GAATCCTGGAAAACCACACATGG - Intergenic
953679136 3:45026490-45026512 GCTCCCTGGAAGATGGCACAGGG - Intronic
954381398 3:50221013-50221035 GATTCCTGGAAAGTGAGGTACGG + Intergenic
954492044 3:50915677-50915699 CATTCCAGGAAAATGATACCTGG - Intronic
956075794 3:65503902-65503924 GCTTCCAGGAAAAGGATACATGG - Intronic
956211788 3:66809146-66809168 GCTTTCAGGAGAATGACACATGG - Intergenic
956951018 3:74282247-74282269 GATTAATGTAAAATAACACAAGG - Intronic
959054808 3:101556966-101556988 CATTCCTGGTAACTGTCACAGGG + Intergenic
960031961 3:113063139-113063161 GCTTCCAGGAAAATGTCATATGG - Intergenic
964700495 3:159560593-159560615 GATGCGTGGAAAAAGAGACATGG - Intronic
966997870 3:185301556-185301578 CACTCCTGGAAGATAACACAGGG - Intronic
967993900 3:195152497-195152519 GTGTTCTGGAAAGTGACACAGGG - Intronic
967998543 3:195185325-195185347 GATTGCTGGAACATGAAACTTGG + Intronic
970525706 4:16929649-16929671 TATTGTTGAAAAATGACACAAGG + Intergenic
971083408 4:23242082-23242104 ATTTCCTGGAAAATAAAACAGGG - Intergenic
971839626 4:31834648-31834670 GATTCCTGGCATGGGACACAGGG + Intergenic
972366586 4:38381366-38381388 GATTCCTTAAAAATTAAACATGG + Intergenic
975360613 4:73466329-73466351 AATACCTGGAAAAATACACAGGG + Intergenic
975690577 4:76958471-76958493 GAGTCCTGGGAAGTGACCCAGGG - Intronic
976813230 4:89119332-89119354 GATGCCTGGAACAGGACACCAGG - Intergenic
977371831 4:96147072-96147094 GATGCCTGTAAAATGAGAGAGGG - Intergenic
977447340 4:97147742-97147764 GAGTCCTGAGGAATGACACAGGG + Intergenic
979920843 4:126493937-126493959 GATTCAAGGAAAATGACAAGGGG - Intergenic
980282644 4:130740112-130740134 GATTTCTGGAAAACAACTCAAGG - Intergenic
980777135 4:137451949-137451971 GAATCCAAGAAAATGATACATGG - Intergenic
982599713 4:157431849-157431871 TATTCCTGTAGAATGACACCTGG - Intergenic
982784928 4:159525654-159525676 GAATCCTGGAATATTACAAATGG - Intergenic
985227630 4:187780024-187780046 TATACCTGGAAAATGACTCAAGG + Intergenic
985845200 5:2339453-2339475 GATTCCTTGACAGTGTCACATGG - Intergenic
986865731 5:11984383-11984405 GTCAACTGGAAAATGACACATGG + Intergenic
987009801 5:13750946-13750968 GATTAATGGAAAAAAACACAGGG + Intronic
990194523 5:53299340-53299362 GATTTCTGAAAAATAACAAATGG - Intergenic
992445661 5:76831244-76831266 GTTTCCTGGAGAATGTCCCATGG - Intronic
992862794 5:80929185-80929207 CATTCCTGCAAGATGACATATGG + Intergenic
993517871 5:88860361-88860383 GCTTCCTGGCAATTGAGACAAGG - Intronic
993705433 5:91164303-91164325 GATTCATGCAAGATGGCACAGGG - Intergenic
995067095 5:107874789-107874811 TATTCCTGGTAATTGAAACAGGG - Intronic
995079122 5:108026341-108026363 TATTTCTGGAACATGACAGATGG + Intronic
995599650 5:113781416-113781438 GATTTCTGAAAAATAACTCAGGG + Intergenic
997599310 5:135128341-135128363 GATTCGGGGAAAATAGCACATGG + Intronic
998724621 5:144996297-144996319 GATTCCTAAAAAATGATAAAGGG + Intergenic
999872394 5:155766002-155766024 GATCCCTTTAAAATGACCCAAGG - Intergenic
1003007916 6:2398559-2398581 GCTTCCTGAAGAATGAGACAGGG - Intergenic
1004150972 6:13119838-13119860 GATTCCTGGAAAATGACACAGGG - Intronic
1005648246 6:27862922-27862944 GATTCCTGGAAAAGGCAAAATGG + Intronic
1007138269 6:39544082-39544104 GATGGCTGAAAAATGACAAATGG - Intronic
1008481953 6:51994988-51995010 GATTCCTGGTAAGTTACAGAGGG - Intronic
1009962728 6:70543587-70543609 TATTCCTACAAAATGAAACATGG + Intronic
1010267836 6:73886767-73886789 GACTCCTGAAAAAGGACAAAGGG + Intergenic
1010396799 6:75402050-75402072 GATTCCTGTAAAATAATAAAAGG + Intronic
1013530516 6:111015614-111015636 GATTCCTGAAAAATGTCTGAAGG - Intronic
1013563434 6:111330074-111330096 CATTCTTTCAAAATGACACATGG + Intronic
1013631295 6:111988643-111988665 GATTGCTGGAAAAAAAAACAAGG - Intergenic
1013651454 6:112199234-112199256 CAGTCCTGTAAAATCACACAGGG - Intronic
1015528392 6:134195762-134195784 GCTTCCTGGAAATAGACATATGG - Intronic
1017115665 6:150974268-150974290 GAGTCCTGGCACCTGACACATGG + Intronic
1019678398 7:2329732-2329754 GGTTCCTGGAAAGTGGCACGGGG + Intronic
1021356127 7:19655096-19655118 GATTAAGGGAAAAAGACACAGGG - Intergenic
1024676821 7:51644914-51644936 GATTACTGGAAAATGAAATGGGG - Intergenic
1027503740 7:78988561-78988583 GAGTACTGCAAAATAACACAGGG - Intronic
1027968942 7:85051809-85051831 GATTCCTGGAAGATACAACATGG - Intronic
1028277152 7:88871164-88871186 GATACCTGAAAAATAAAACATGG + Intronic
1031714675 7:125093947-125093969 GCTTCCTGTTAAATGATACAAGG + Intergenic
1031852697 7:126884931-126884953 GATTCCAGGAATAGGATACAAGG - Intronic
1032348221 7:131136522-131136544 CATTTGAGGAAAATGACACAGGG - Intronic
1033029056 7:137807291-137807313 GATGCCTGGAAAATGTCTAATGG + Intronic
1034256773 7:149729036-149729058 GCTCCCTGGAACATGACAGATGG + Intronic
1035035825 7:155893128-155893150 TATTCCTGCAAAACGCCACAGGG - Intergenic
1035842573 8:2828332-2828354 GGTTCATGGAAAATGACACCAGG - Intergenic
1035934769 8:3824829-3824851 GATTTCAATAAAATGACACAGGG + Intronic
1036014980 8:4772939-4772961 CATTGCTGGAATATAACACATGG + Intronic
1036706937 8:11053174-11053196 GATTCCTCCACAATGGCACATGG - Intronic
1038560748 8:28577137-28577159 GAGTAATGGAAAATGGCACAAGG + Intergenic
1039035309 8:33353088-33353110 GATGGCTGGAAAGTGACACTGGG - Intergenic
1041422085 8:57678745-57678767 AAATGCTGGAAGATGACACAAGG + Intergenic
1042799379 8:72702295-72702317 GTTCCCTGGAAAATGACAAGCGG - Intronic
1043598278 8:81909574-81909596 GGTTCCTTGGAGATGACACATGG - Intergenic
1046273517 8:111926412-111926434 GACTCTTTGAAAATGACACGTGG + Intergenic
1046336803 8:112801179-112801201 GATTGCTGGAAAATTACATCAGG + Intronic
1046956316 8:120066271-120066293 GATTCCTGTAGGATGACAGATGG + Intronic
1047042363 8:121010068-121010090 GATTACAGGGAATTGACACATGG + Intergenic
1048733294 8:137468448-137468470 GTTTTTTGGAGAATGACACATGG + Intergenic
1049195952 8:141315667-141315689 GTTTCCTGGAGGAGGACACATGG - Intergenic
1051516745 9:17938244-17938266 CAGTCCTGTAAAATGACATAAGG + Intergenic
1052004223 9:23327016-23327038 AATTCGTGGAAAATGACTCAGGG + Intergenic
1053482520 9:38426080-38426102 GATTCCTGGAAGAGCACAGAGGG - Intergenic
1056326305 9:85481687-85481709 GTTTCCTGAGAAAGGACACATGG - Intergenic
1057730540 9:97604649-97604671 TATTCTAGAAAAATGACACAGGG - Intronic
1058809677 9:108627313-108627335 CAGTCCTGGAAAAAGACAGATGG - Intergenic
1059344313 9:113617714-113617736 GATTCCTGACAAAAAACACATGG + Intergenic
1203456477 Un_GL000219v1:172700-172722 GATTCCAGAATAATGACACGAGG - Intergenic
1203496457 Un_GL000224v1:156161-156183 GATTCCAGAAAAATGCTACAAGG - Intergenic
1203509079 Un_KI270741v1:98083-98105 GATTCCAGAAAAATGCTACAAGG - Intergenic
1186340537 X:8640987-8641009 TATTCTTAGAGAATGACACAGGG - Intronic
1186387533 X:9125259-9125281 GATTCTTGCACATTGACACAGGG + Intronic
1186588852 X:10906663-10906685 AATTCCTAGAAAACGAAACAGGG - Intergenic
1188125849 X:26367900-26367922 AAGTCCTGGAAAAAAACACAGGG - Intergenic
1188214105 X:27457393-27457415 GATTCCAGGAAAAACAGACATGG + Intergenic
1188832235 X:34913049-34913071 GATTTGGGGAAAATGTCACAGGG + Intergenic
1189219404 X:39358164-39358186 GATTCCTGAGAAGTTACACATGG + Intergenic
1190630623 X:52381818-52381840 GGCTCCTGGCAAAAGACACAGGG - Intergenic
1190650225 X:52562514-52562536 GGCTCTTGGCAAATGACACAGGG + Intergenic
1191772879 X:64781895-64781917 GGTTCCTTAATAATGACACACGG - Intergenic
1193658109 X:84223348-84223370 GAATCCTGGGAAATGTCACTGGG - Intergenic
1194537637 X:95125718-95125740 GATTGCTGGACAATGACCTAAGG + Intergenic
1195431636 X:104796047-104796069 AATTCCTTGCAAATGCCACAAGG - Intronic
1201324420 Y:12740122-12740144 TATTCCTGAATAATGACATATGG - Intronic
1202048239 Y:20755302-20755324 AATACCTAGAAAATAACACAAGG + Intergenic