ID: 1004154838

View in Genome Browser
Species Human (GRCh38)
Location 6:13158382-13158404
Sequence GGCTATATGGGAGGACAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4192
Summary {0: 1, 1: 0, 2: 1, 3: 160, 4: 4030}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004154838_1004154848 -1 Left 1004154838 6:13158382-13158404 CCCCCTTGTCCTCCCATATAGCC 0: 1
1: 0
2: 1
3: 160
4: 4030
Right 1004154848 6:13158404-13158426 CCTCCTGCCGTCACTTCTGTGGG No data
1004154838_1004154846 -2 Left 1004154838 6:13158382-13158404 CCCCCTTGTCCTCCCATATAGCC 0: 1
1: 0
2: 1
3: 160
4: 4030
Right 1004154846 6:13158403-13158425 CCCTCCTGCCGTCACTTCTGTGG 0: 1
1: 0
2: 1
3: 22
4: 201
1004154838_1004154851 24 Left 1004154838 6:13158382-13158404 CCCCCTTGTCCTCCCATATAGCC 0: 1
1: 0
2: 1
3: 160
4: 4030
Right 1004154851 6:13158429-13158451 CAGATTTATGTCTCTATTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004154838 Original CRISPR GGCTATATGGGAGGACAAGG GGG (reversed) Intronic
Too many off-targets to display for this crispr