ID: 1004162499

View in Genome Browser
Species Human (GRCh38)
Location 6:13227313-13227335
Sequence CTAGTTTTCTAAAGCTACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004162499 Original CRISPR CTAGTTTTCTAAAGCTACAC AGG (reversed) Intronic
907350657 1:53827655-53827677 CTTGTTTTCTGAACCTCCACAGG + Intronic
909971517 1:81996599-81996621 CTAGTTTTTTAAAGATACCTCGG + Intergenic
911286902 1:96005957-96005979 ATTGTTTTCCAAAGCTACATAGG + Intergenic
911583424 1:99661865-99661887 CTAGTTTTCTAACGATCCATAGG + Intronic
912167096 1:107054988-107055010 CTAGTTTTTAAAAGCTCCCCAGG - Intergenic
913096169 1:115517739-115517761 CTAGTATTCAAAAGCACCACAGG - Intergenic
915987634 1:160482232-160482254 TAAGTGTCCTAAAGCTACACGGG + Intergenic
916400683 1:164445257-164445279 CAAGTTGTCTAAGTCTACACAGG + Intergenic
918422689 1:184380124-184380146 CTAGTTTTCAAAAGCTATACTGG - Intergenic
918833134 1:189424615-189424637 CTAATTTTCTAAAGCTTGATAGG + Intergenic
922148380 1:222972934-222972956 CTAGTTTTAGTAAGCTACCCAGG + Intronic
922867838 1:228875644-228875666 CTAGTCTACTAAAGCTCCCCAGG + Intergenic
1064806319 10:19137836-19137858 CATGTTTTCTAAAGAGACACAGG - Intronic
1068092462 10:52449638-52449660 CTAGTTTTTTGAAACTACATTGG + Intergenic
1068856678 10:61805040-61805062 CTACTTGTCTGAAGCTACAGTGG + Intergenic
1072496334 10:95963816-95963838 CAAGTTTTATAAAGTTACAGCGG + Intronic
1072646222 10:97256740-97256762 CTAGTTTTCTAAAGAGGCAGTGG - Intronic
1073382690 10:103092029-103092051 CTAGATTTCTAAAACTTCATAGG + Intronic
1073411213 10:103343426-103343448 CTAGTTTTCAAACGCTTAACTGG - Intronic
1078227073 11:9402091-9402113 CTAGCATTCTTAACCTACACTGG - Intronic
1078228654 11:9418019-9418041 CTAGTTTTCTAGAGATATAGGGG + Intronic
1079427245 11:20355371-20355393 TTATTTTTCTAAAGCTTCAAGGG + Intergenic
1087034998 11:93746176-93746198 CTAATTTTCCAAAGATTCACAGG - Intronic
1087866933 11:103240936-103240958 TTATTTTTCTTTAGCTACACCGG + Intronic
1092357380 12:7807833-7807855 CCAATTTTCTAAAGCTAAATAGG - Intergenic
1093363372 12:18260489-18260511 CTTCTGTTCTAAAGCTACAAAGG - Intronic
1095564007 12:43599260-43599282 CTAATTATCAAAAGCAACACTGG + Intergenic
1095728440 12:45477544-45477566 CTAGTTTCCCAAAGCTACTATGG - Intergenic
1098848717 12:75569095-75569117 CTAATTTTCTAAGTCTAGACAGG + Intergenic
1100818176 12:98405826-98405848 CCAGGTTTCTAAAAATACACTGG - Intergenic
1101542473 12:105677327-105677349 CTGCTTTTCTAATGCTTCACTGG + Intergenic
1104110543 12:125700409-125700431 CTATTTTTCCAAAGCTACATAGG + Intergenic
1107777322 13:43859431-43859453 GTAGTTTTATAAATCTACAGGGG + Intronic
1109528269 13:63605278-63605300 TTAGTTTTCTAAATCCTCACAGG + Intergenic
1109832430 13:67808953-67808975 CCAATTTTCTAAAACTACAAAGG + Intergenic
1111785618 13:92782975-92782997 TTAGTTTCCTAAAGCTATTCTGG - Intronic
1111911085 13:94312826-94312848 TTAGTTTTCTAAAGATAAATGGG + Intronic
1113046328 13:106159203-106159225 ATATTTTTTCAAAGCTACACGGG - Intergenic
1116258168 14:42585051-42585073 CTACTTGTCTAAATCTATACTGG - Intergenic
1118605407 14:67499351-67499373 ATAGTTTTCTTAAGCTCCAGAGG - Intronic
1123962839 15:25424194-25424216 TTACTTTTCTAAAGCTACACTGG + Intronic
1128951936 15:71894096-71894118 CTAGTATTCTAAAGATTCAGGGG - Intronic
1137022819 16:35446780-35446802 CTTGTTTTTTAAAGTTACTCTGG - Intergenic
1140303850 16:73783964-73783986 CTTGTTTTCTAAAGACACCCAGG - Intergenic
1144379097 17:14675298-14675320 ATAGTGTTCTTAAGCAACACAGG - Intergenic
1146497026 17:33331926-33331948 CTATTTTTCAAAAGCTCCACAGG - Intronic
1148553628 17:48564894-48564916 CGAGTTTTCTAAAGCTGCTTAGG + Intronic
1157860718 18:51138058-51138080 CTAGTTTCCTAAAGCTCCCGGGG - Intergenic
1158110537 18:53935802-53935824 CCAGTTTTCCACAGCAACACTGG + Intergenic
1160568616 18:79801655-79801677 GAAGGTTTCTGAAGCTACACTGG - Intergenic
1164423370 19:28117507-28117529 CTAATTCTGTACAGCTACACTGG + Intergenic
1166217615 19:41345968-41345990 TTAGTCTTCTAAAGCTTCTCAGG - Intronic
1166592402 19:44011646-44011668 CTAGTGTTCTAAAGCACCAAAGG - Exonic
1166853732 19:45772120-45772142 CTGGTCCTCTAAATCTACACAGG + Intronic
927910762 2:26897840-26897862 ATAGTTGTCCAAAGCTACTCAGG + Intronic
929291436 2:40196487-40196509 CTTCGTTTCTAAAGCTTCACAGG - Intronic
931137466 2:59419903-59419925 CTAGCTTTGTAAAGCTATTCTGG + Intergenic
932962567 2:76431318-76431340 CTAGTTTTCAAAAGCTGCCCAGG + Intergenic
939010666 2:136842257-136842279 ATAGGTGTCAAAAGCTACACAGG + Intronic
939865102 2:147463922-147463944 CTATATTTCTAAAGGTACAGAGG - Intergenic
940839218 2:158559683-158559705 CTTGTTTTCTGAAGGTACTCTGG - Intronic
943374375 2:187056651-187056673 CTTCTTTTCTTAAGCTACATGGG + Intergenic
945174711 2:207031033-207031055 CTAGTGTTCTAAAGCACTACAGG + Intergenic
945774074 2:214082648-214082670 CTAGTTTTTTAAAGCTTTCCAGG - Intronic
948174139 2:235929780-235929802 CTAGTTCTAAAAAGCTCCACAGG + Intronic
1177766505 21:25463766-25463788 CTAGATTTCTGAATCTACACTGG - Intergenic
1180849048 22:19002800-19002822 CTACTATTCTAAAGCTTCAACGG - Intergenic
949196778 3:1319338-1319360 TTACTTTTCTAAAGCTAAAGAGG - Intronic
949262960 3:2123639-2123661 GTAGTTTTCTAGCGCTACACTGG + Intronic
952277946 3:31895521-31895543 GTAGTTTTTTAAAGCTCCTCAGG + Intronic
952279993 3:31913554-31913576 CTAGTTTTATAAACCTAAATAGG + Intronic
952577934 3:34797158-34797180 CTTGTTTTCCAAAGCATCACTGG + Intergenic
956821070 3:72954693-72954715 CAGGTTTTCTAATGCCACACTGG + Intronic
958438741 3:94130147-94130169 ATAGTTTGCCAAGGCTACACTGG + Intergenic
959134951 3:102406276-102406298 CTAGGTTTCTAAACCTAGAAGGG + Intronic
959463045 3:106650566-106650588 CTTTTTTTTTAAAGCTACACTGG + Intergenic
962205094 3:133427833-133427855 CCAGTTTTCTTAATCTCCACTGG - Intronic
964605994 3:158560830-158560852 CTAATTTTGCAAAGCTATACAGG + Intergenic
970007419 4:11425027-11425049 TTAATTTTCTAAAGGTACAAAGG - Intronic
970268088 4:14312003-14312025 CTCATTTTCTAAAGCTAAAATGG + Intergenic
971574099 4:28251999-28252021 CTTTTTTTCTCAAGCTAGACAGG + Intergenic
972133965 4:35868466-35868488 CATGTTTTGTAAAGCTTCACAGG - Intergenic
974010764 4:56605178-56605200 CTAGCTTTCTAAGGGTACAGTGG + Intergenic
975756378 4:77575726-77575748 CTAGCTTTTTAATGCTACAGAGG + Intronic
978489702 4:109299942-109299964 ATAGTTCCCTGAAGCTACACAGG + Intronic
978955857 4:114612427-114612449 CTATTTTTCCAAAGCTTCCCAGG + Intronic
979047358 4:115885363-115885385 CTTATCTTCTAAAGCTACAAGGG - Intergenic
982962593 4:161859346-161859368 GTGGTTTTCTAAAGCTAACCTGG - Intronic
983016716 4:162622451-162622473 CATGTTTTCAAAATCTACACAGG + Intergenic
983380359 4:166983551-166983573 CTAGTGTTCTATAGCTGCATGGG + Intronic
983743956 4:171170759-171170781 CTAGTTTCCTAAAACTACCAAGG + Intergenic
983841841 4:172466786-172466808 CTAGTTATCTAAAGTCTCACAGG - Intronic
984183173 4:176510179-176510201 CTCTTTTTCTAAAACTAAACAGG - Intergenic
988191376 5:27940199-27940221 CTAGGTTTCTGTATCTACACTGG - Intergenic
988891809 5:35625649-35625671 TTAGTTTTCTAAAGAGCCACTGG - Intronic
989210917 5:38858185-38858207 CTAGTGTTCTACAGCACCACAGG - Intronic
994717931 5:103346401-103346423 CTAGTTTACTAGAGCCTCACCGG - Intergenic
996134035 5:119817147-119817169 CTGGTCTTCTAAAGCTTCACAGG - Intergenic
996844648 5:127885849-127885871 ATGGTATTCTAAAGATACACTGG + Intergenic
997623652 5:135317382-135317404 CTTGTTTTCTGAAGAAACACAGG - Intronic
1002453696 5:179333404-179333426 GTACTTTTCAAAAGCTACACAGG - Intronic
1004162499 6:13227313-13227335 CTAGTTTTCTAAAGCTACACAGG - Intronic
1007861809 6:44918045-44918067 CTAATTTTCTAGAGATACATTGG - Intronic
1010395736 6:75390110-75390132 CTACTTCTCTAAAGGAACACTGG + Intronic
1013832263 6:114288052-114288074 CTGACTTTCTTAAGCTACACAGG - Intronic
1015217444 6:130766667-130766689 CTAGTTCTCTAAAAAAACACTGG - Intergenic
1017659283 6:156658093-156658115 GTGCTTTTCTAAAACTACACAGG + Intergenic
1018014615 6:159700907-159700929 CTAATTTTCTTAAGCTTCCCTGG + Intronic
1018272116 6:162091612-162091634 CTGGTTTTCTAAAAGTATACAGG + Intronic
1020890367 7:13870611-13870633 TTAGTTGTATAAAGCTTCACGGG - Intergenic
1021168967 7:17374707-17374729 CTTGTTTTTTAAAGCTTCCCAGG + Intergenic
1023287552 7:38634587-38634609 TTAGGTTTCTAAAGATACATTGG - Intergenic
1023494510 7:40780159-40780181 GTAGTTCTCTAAAGCCACTCTGG + Intronic
1026062956 7:67042690-67042712 CTAATATTTTAAACCTACACTGG - Intronic
1026715391 7:72784800-72784822 CTAATATTTTAAACCTACACTGG + Intronic
1030660583 7:112214647-112214669 AAAGTTTTCTAGAGCTAAACAGG + Intronic
1031649377 7:124267754-124267776 TTAGTTTTCTAAATCCACAACGG + Intergenic
1031752115 7:125589046-125589068 CTAGTTTTCTCAAGCTAAATGGG - Intergenic
1032259999 7:130327935-130327957 CTAGCTTTCCAAATCTAGACGGG - Intergenic
1034453567 7:151151268-151151290 CTAGTTTGCTCAGGCTTCACTGG + Intronic
1038354190 8:26811500-26811522 CTAGCTTTCTAAAGACAAACTGG + Intronic
1038891197 8:31726527-31726549 ATATTTTTATAAAGCTCCACTGG + Intronic
1039683972 8:39776216-39776238 TTTGTTTTCTAAAGCCACTCTGG + Intronic
1045371170 8:101524582-101524604 ATAGTTTTCTAAATATTCACAGG - Intronic
1046062272 8:109153804-109153826 CTTATTTTTTAAAGCTTCACAGG - Intergenic
1051310384 9:15764813-15764835 CTATTTTTAAAAAGCTCCACAGG - Intronic
1056590771 9:87964237-87964259 CTAGCTTTCTGAAGATCCACAGG - Intergenic
1060714658 9:125912901-125912923 CTAACTTTCTAGAGTTACACTGG - Intronic
1060899402 9:127244460-127244482 CTATGTTTTTAAAGCTACCCTGG - Intronic
1187583705 X:20636958-20636980 CTAGGTTTGTAAAGCTGCACAGG + Intergenic
1191807520 X:65150702-65150724 TTAGTTTTGTAAAACCACACAGG + Intergenic
1191943613 X:66505202-66505224 CTATTTTACCAAAGCTAAACTGG - Intergenic
1194959801 X:100222259-100222281 CTAGTATTCTATAGCTCTACAGG + Intergenic
1197340803 X:125264580-125264602 CTAGTATACTAAAGTTACTCTGG + Intergenic
1199277690 X:145965041-145965063 CTACTCTGCTACAGCTACACTGG - Intergenic