ID: 1004165435

View in Genome Browser
Species Human (GRCh38)
Location 6:13252691-13252713
Sequence TGTGAAAGAGTATCGGCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 27
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 25}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004165435 Original CRISPR TGTGAAAGAGTATCGGCCGC AGG Intronic
900829403 1:4955142-4955164 TGTGAAAGAGAAAGGGCCCCTGG - Intergenic
903712815 1:25338480-25338502 GGTAAGAGAGTAGCGGCCGCAGG + Intronic
909754397 1:79205252-79205274 TGTGTAAGAGTATGGGATGCAGG + Intergenic
1090234586 11:125138311-125138333 TTTGAAAGAGCATCCGCTGCAGG + Intergenic
1093034663 12:14321048-14321070 TGTGAAAGAGTACCCCCAGCAGG - Intergenic
1097656461 12:62369509-62369531 TGTGAAAAAGCATCGACAGCTGG - Intronic
1098826036 12:75298289-75298311 TGTGAAGGGGTATGGGCCTCTGG - Intronic
1108238437 13:48434567-48434589 TGAGAAAGAGTCTCGGCTGTAGG - Intronic
1114631162 14:24160542-24160564 TGGGACAGAGTATCCCCCGCAGG + Exonic
1115006224 14:28488826-28488848 TGTGAAATAGTAACAGCCTCAGG + Intergenic
1120839205 14:89068855-89068877 TGTGAAAGACTGTAGGCGGCCGG + Intergenic
1133324254 16:4933924-4933946 TGTGAATGATAAGCGGCCGCAGG - Intronic
1146009045 17:29179812-29179834 AGTGAAAGAGTGAAGGCCGCTGG + Intronic
925988139 2:9232257-9232279 TGTGTAAAAGGATCGGGCGCAGG - Intronic
939496891 2:142935744-142935766 TCTGAAGGAGTATGGGCCGGAGG + Intronic
1184945960 22:47804341-47804363 TGTGAAAGAGTAACTGTCCCAGG - Intergenic
953672787 3:44976601-44976623 AGTGAGAGAGCATCGGCCCCAGG + Intronic
961448965 3:126993826-126993848 GGTGAAAGAGTACAGGCGGCAGG - Intronic
1004165435 6:13252691-13252713 TGTGAAAGAGTATCGGCCGCAGG + Intronic
1006970401 6:38038143-38038165 TGTGAAAGACTAGAGGCCTCGGG - Intronic
1017910372 6:158787180-158787202 TGGTAAAGACTATCGGCCTCCGG - Exonic
1038751900 8:30303841-30303863 TGTGAAGGAGAATGCGCCGCGGG - Intergenic
1043401823 8:79891837-79891859 TGTGAAAGAGCAGCGGCTGCCGG - Intergenic
1048275717 8:133064439-133064461 AGTGAAAGAGTATCTGCCCTTGG - Intronic
1049621906 8:143602257-143602279 TGTGACAGAGGCTTGGCCGCTGG + Exonic
1052716536 9:32124745-32124767 TGTGAAAGAGTATTGTAGGCAGG - Intergenic
1199478222 X:148269672-148269694 TGTGAAAGAGTAGGGGCTGATGG + Intergenic