ID: 1004165740

View in Genome Browser
Species Human (GRCh38)
Location 6:13255248-13255270
Sequence GGAGAACAACACCAAGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004165734_1004165740 25 Left 1004165734 6:13255200-13255222 CCACACACTTTTAAACAACCAGA 0: 586
1: 1151
2: 1923
3: 1866
4: 1874
Right 1004165740 6:13255248-13255270 GGAGAACAACACCAAGGGGAAGG No data
1004165735_1004165740 7 Left 1004165735 6:13255218-13255240 CCAGATCTCATGAGAACTCATTC 0: 62
1: 719
2: 1991
3: 2653
4: 3031
Right 1004165740 6:13255248-13255270 GGAGAACAACACCAAGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004165740 Original CRISPR GGAGAACAACACCAAGGGGA AGG Intronic
No off target data available for this crispr