ID: 1004167445

View in Genome Browser
Species Human (GRCh38)
Location 6:13269479-13269501
Sequence ACACAGCTGGCCCTTGTCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 187}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004167439_1004167445 3 Left 1004167439 6:13269453-13269475 CCCCCTAATATTGTGAATTTCCA 0: 1
1: 0
2: 1
3: 15
4: 256
Right 1004167445 6:13269479-13269501 ACACAGCTGGCCCTTGTCAATGG 0: 1
1: 0
2: 0
3: 11
4: 187
1004167442_1004167445 0 Left 1004167442 6:13269456-13269478 CCTAATATTGTGAATTTCCAAAT 0: 1
1: 1
2: 1
3: 45
4: 492
Right 1004167445 6:13269479-13269501 ACACAGCTGGCCCTTGTCAATGG 0: 1
1: 0
2: 0
3: 11
4: 187
1004167438_1004167445 14 Left 1004167438 6:13269442-13269464 CCAAATTTAGACCCCCTAATATT 0: 1
1: 0
2: 1
3: 5
4: 111
Right 1004167445 6:13269479-13269501 ACACAGCTGGCCCTTGTCAATGG 0: 1
1: 0
2: 0
3: 11
4: 187
1004167440_1004167445 2 Left 1004167440 6:13269454-13269476 CCCCTAATATTGTGAATTTCCAA 0: 1
1: 0
2: 2
3: 26
4: 269
Right 1004167445 6:13269479-13269501 ACACAGCTGGCCCTTGTCAATGG 0: 1
1: 0
2: 0
3: 11
4: 187
1004167441_1004167445 1 Left 1004167441 6:13269455-13269477 CCCTAATATTGTGAATTTCCAAA 0: 1
1: 0
2: 3
3: 81
4: 1036
Right 1004167445 6:13269479-13269501 ACACAGCTGGCCCTTGTCAATGG 0: 1
1: 0
2: 0
3: 11
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004167445 Original CRISPR ACACAGCTGGCCCTTGTCAA TGG Intronic
901024589 1:6272477-6272499 ACAGAGCTGGCCCATCTCCAGGG - Intronic
901350690 1:8593259-8593281 ACACAGCTGACCCTTATCAGAGG - Intronic
901553911 1:10016758-10016780 ACCCAGATCACCCTTGTCAAAGG + Intergenic
901657223 1:10776422-10776444 CCACAGCTGCCTCTTGTCACAGG + Intronic
903601104 1:24541481-24541503 ACAAAGCTGCTCCTTTTCAAGGG + Intergenic
909745125 1:79085924-79085946 AAACATCTGTCTCTTGTCAAAGG - Intergenic
913220888 1:116659521-116659543 ACACAGCTATTCCTTGTAAAGGG - Intronic
914931835 1:151941926-151941948 ACACTGCTGTCCCTTATTAAAGG + Intergenic
915191629 1:154155468-154155490 AAACAGCTCGACTTTGTCAAGGG + Intronic
916120796 1:161526175-161526197 GCTCAGCCGGCCCTTGTCATTGG - Exonic
916130561 1:161607802-161607824 GCTCAGCCGGCCCTTGTCATTGG - Intronic
918119407 1:181524756-181524778 ACATGGCTGTTCCTTGTCAATGG - Intronic
919749894 1:201030944-201030966 ACACAGGTGGCATCTGTCAAAGG - Intergenic
919830166 1:201535384-201535406 ACACAGAGGGCCCTTCTTAAAGG + Intergenic
922350643 1:224732308-224732330 ACCCTGCTGGCCCTGGTCAATGG - Intronic
923290747 1:232543304-232543326 ATACAGCTGGCCCTTGAACACGG + Intronic
924633259 1:245762252-245762274 ACACAGCTGTCACCTGTCATGGG + Intronic
1063200825 10:3784639-3784661 CCACAGCTGGAGCTTGTCATGGG - Intronic
1069592157 10:69648819-69648841 AAACAGCTGGCCCTGGTCCTGGG - Intergenic
1069708361 10:70473418-70473440 AGACAGCTGGCCCCTGTCTGAGG - Intergenic
1071668879 10:87588698-87588720 ATACAGCTCTCCCTTTTCAAAGG - Intergenic
1072781545 10:98255125-98255147 ACACAGCTGGGCCTTGGCCCCGG + Intronic
1074533319 10:114311572-114311594 TCACAGCTGGCTCGTGGCAAAGG - Intronic
1075671709 10:124267698-124267720 CCAGAGCTGGGCCTTGTCACTGG + Intergenic
1076368059 10:129934970-129934992 ACACAGTAGGCCCTTGTTCAAGG - Intronic
1076500280 10:130931165-130931187 ACACAGCTGACCCCAGTCCAGGG + Intergenic
1076751309 10:132544807-132544829 ACACCGCCGGCCGTTCTCAAAGG - Intronic
1077041980 11:528872-528894 ACACAGCCGGCACTTGGCACCGG - Intergenic
1077513356 11:2984280-2984302 CCACACCTGGCCTTTGTTAAAGG - Intronic
1079508550 11:21183271-21183293 ACTAAGCTGGCCCTTGAAAAAGG - Intronic
1079866373 11:25740530-25740552 AGTCAGCTGGCCTTTGACAATGG - Intergenic
1079915934 11:26368514-26368536 ACACATATGGCACTGGTCAAAGG - Intronic
1081390946 11:42527930-42527952 ACAGTGCTGGACCTTGTCTAAGG - Intergenic
1083782592 11:64925912-64925934 ACACCGCTGCCCCTGCTCAAAGG + Exonic
1088310541 11:108455861-108455883 CCACAGCTGGCCCATGTCTTTGG - Intronic
1091331098 11:134731449-134731471 CCCCAGCTGGCCCTTTTCCATGG + Intergenic
1091425951 12:389471-389493 ACGCAGCTCGCCCTTGGTAAGGG + Intronic
1094605210 12:31943702-31943724 AGACAGGTGGCCCTTGTAAAAGG + Intergenic
1096204443 12:49708975-49708997 ACACAGCTGTTGCTTGTCACAGG + Intronic
1099605851 12:84800431-84800453 ACAGAACTGGCCCTTGATAAAGG + Intergenic
1100044771 12:90366338-90366360 ACACAGCTGGCCCATGGACAGGG + Intergenic
1100920959 12:99486558-99486580 CCACAGCTGGTTCCTGTCAAGGG - Intronic
1103479384 12:121241347-121241369 ACACAGCTGGCCCTCAAGAAAGG + Intronic
1103707153 12:122882395-122882417 GCTTAGCTGGCCCTTCTCAAAGG + Intronic
1104912287 12:132245054-132245076 CCACAGCTGTGCCTTGTCAGGGG + Intronic
1108323665 13:49309307-49309329 ACACACCTGGGCCTAGCCAAGGG + Exonic
1108696404 13:52906272-52906294 ACACAGCTGGCTCCTGCCAGGGG + Intergenic
1110565478 13:76953414-76953436 ACACAGCTCTCCCCTGTGAAAGG - Intronic
1112195205 13:97219062-97219084 ACACTGATGGCTCTTGTCCACGG - Intergenic
1112362965 13:98733600-98733622 ACACAGCTTGGCCTTGCTAATGG + Intronic
1119853654 14:77883816-77883838 TCACAGCTGGCTCTTGTTTAGGG + Intronic
1120104867 14:80481991-80482013 GTACAGCTGTACCTTGTCAAGGG + Intronic
1122564885 14:102646230-102646252 ACACAGCTGGTGCTTATTAATGG - Intronic
1124067536 15:26359309-26359331 ACACAGCTAGAGCTTGTTAAAGG - Intergenic
1129654678 15:77516212-77516234 ACACGGCTGGCCATGGTGAATGG + Intergenic
1132575661 16:662611-662633 ACCCAGCTGGCTCTTGTCATCGG + Intronic
1137346480 16:47666507-47666529 ACAGAGTTGGCCCTGGTGAATGG - Intronic
1137786699 16:51143604-51143626 AAACAGCTGACCCTTTCCAACGG - Intronic
1139696149 16:68676398-68676420 ACAGAGCTGGCTCTTGCCCAGGG - Exonic
1140565285 16:76035053-76035075 AGACAGGTGGCCCTTGTAAAAGG + Intergenic
1141223271 16:82091339-82091361 ACACAGCTGGCCCCTCTGCATGG - Intronic
1143437466 17:6939877-6939899 AGACAGGTGGCCCTTATAAAAGG + Intronic
1145242074 17:21245895-21245917 CCACAGCTGGGCCTTGGCCAGGG - Intronic
1145796862 17:27660618-27660640 AACCAGCTGGCCCTGGTCCAAGG - Intergenic
1149556726 17:57578687-57578709 ACACTGCTGGCCCCTGAGAATGG - Intronic
1150072686 17:62165456-62165478 ACACACCTGGCCCTTTCCAGTGG + Intergenic
1151995038 17:77603115-77603137 ACACAGCTTTTCCTTGTGAAGGG + Intergenic
1152145290 17:78564668-78564690 GCACAACTGGCTCTTGACAAGGG - Intronic
1153918160 18:9764531-9764553 TCACAGCAGCCCTTTGTCAAGGG - Intronic
1155281828 18:24248057-24248079 ATACAGCTGGCCTTTGCTAAAGG + Intronic
1156670652 18:39465441-39465463 ATACAGCTGGCCCTTGTATCTGG + Intergenic
1162361738 19:10224486-10224508 ATACAGCTTGACCTTGGCAATGG + Exonic
1163251340 19:16128020-16128042 TCACAGCTGGCCCTCGACTATGG + Exonic
1163692687 19:18745921-18745943 ACACCGCCGGCCCCTGTCAGTGG + Exonic
1164180103 19:22810883-22810905 GCACAGCTGGCACTAGTGAAAGG - Intergenic
1168288618 19:55346556-55346578 ACGCAGCTGGTACTTGTCCAGGG - Exonic
924981145 2:222695-222717 ACACAGCTGGACCTTCCAAAGGG + Intronic
926055511 2:9771696-9771718 CCAGAGCTGGCCCTTCTCACTGG - Intergenic
927153831 2:20210684-20210706 AAAGAGCTGCCCCTTATCAAAGG + Intronic
931655371 2:64506195-64506217 ACACAGCATGACCTTGTCCAAGG - Intergenic
937098326 2:119249902-119249924 ACACAGCGAGCTCTTGTTAAGGG - Intronic
939105990 2:137949410-137949432 AAACAGCTAGCTCTTGTCACAGG - Intergenic
939381996 2:141448011-141448033 CCACAGCTGCCCCTTGCCCAAGG + Intronic
939600290 2:144180664-144180686 AGCCACCTGGCCCTTATCAAAGG - Intronic
939733183 2:145810649-145810671 GGACAGCAGGCTCTTGTCAATGG - Intergenic
940377150 2:152969444-152969466 AGACAGGTGGCCCTTGTAAAAGG + Intergenic
941160671 2:162030975-162030997 ACACAGCTGTGCCTTGGAAACGG + Intronic
942142768 2:172994410-172994432 ACACACCTGGCTCATGTCAGAGG + Intronic
942604695 2:177678326-177678348 ATACAGCTGGCTCTTGACATAGG - Intronic
946658789 2:221977436-221977458 AGACAGCAGGCCCTTTTCCAAGG + Intergenic
947819899 2:233062258-233062280 ACAAAGCAAGCCCTGGTCAAAGG - Intronic
947949998 2:234138920-234138942 TCATAGCTGCACCTTGTCAATGG + Intergenic
948480511 2:238247336-238247358 ACACTGCTGGCTCTTGGCAGAGG - Intronic
1169167396 20:3435959-3435981 CCTCAGCTGGTCCTTGGCAAGGG - Intergenic
1169429790 20:5526183-5526205 ACACACATGGGCCTTGACAATGG - Intergenic
1170007140 20:11681525-11681547 GCACAGCTGGCCCAGGACAAAGG - Intergenic
1170462060 20:16586651-16586673 ACCCAGCAGGCGCTTGCCAACGG - Intergenic
1171259542 20:23719671-23719693 CCTCAGCTGGGCTTTGTCAATGG + Intergenic
1171268607 20:23795138-23795160 CCTCAGCTGGGCTTTGTCAATGG + Intergenic
1172271540 20:33658145-33658167 ACACAGCTTCCCCGTGTCACAGG - Intronic
1172977741 20:38919358-38919380 ACACAGCTGGCTCCTGGCATGGG - Exonic
1173109570 20:40174114-40174136 GGACAGCTGGCCCTTCTCAGCGG + Intergenic
1175342703 20:58244481-58244503 ACACACCAGGCCCTTCCCAATGG + Intergenic
1179049052 21:37873085-37873107 AAACAGCTAGGCTTTGTCAAGGG - Intronic
1179224539 21:39442278-39442300 AAACCGCTGGCCCTTCTCACTGG - Intronic
1179629504 21:42667819-42667841 ACCCACTTGGCCCTTCTCAAGGG + Intronic
1180604557 22:17047364-17047386 AGTCAGCTGGTCCTTGTCATGGG - Intergenic
1180822419 22:18839745-18839767 ACACAGCTATTCCTTGTAAAGGG - Intergenic
1181042715 22:20199967-20199989 TCAAAGCTGCCCCTTGTCCAGGG + Intergenic
1181190552 22:21136302-21136324 ACACAGCTATTCCTTGTAAAGGG + Intergenic
1181208653 22:21274205-21274227 ACACAGCTATTCCTTGTAAAGGG - Intergenic
1181622514 22:24100726-24100748 GCACAGCAGGCCCTGGTCAAAGG + Intronic
1182477260 22:30583024-30583046 ACACAGCTGGCCCTGGGGGAAGG - Intronic
1183014115 22:34971909-34971931 ACACAGCTGGCTCATGGCAGAGG - Intergenic
1183659021 22:39207440-39207462 ACACACCTGCCCCTTGGCCATGG - Intergenic
1183830576 22:40416564-40416586 ACACAGCTGCCCCTGCTCACAGG + Intronic
1184253294 22:43273069-43273091 ACACAGCTGGTGCTTAGCAAAGG - Intronic
1203218281 22_KI270731v1_random:21206-21228 ACACAGCTATTCCTTGTAAAGGG + Intergenic
1203272554 22_KI270734v1_random:65629-65651 ACACAGCTATTCCTTGTAAAGGG - Intergenic
951313991 3:21165807-21165829 CCACAGATGGGTCTTGTCAACGG - Intergenic
952107003 3:30082324-30082346 ACACACCTGGCACTTGTGTATGG + Intergenic
954314786 3:49795276-49795298 CCACAGCTGGCCCTGCTCAAAGG + Exonic
956875433 3:73458151-73458173 CCAAATGTGGCCCTTGTCAATGG + Intronic
957984682 3:87558645-87558667 ACACAGCCGGCCTTTCTCTAAGG - Intergenic
959093518 3:101929046-101929068 ACACAGCTGGCACTTGGCCTGGG - Intergenic
963035257 3:141020205-141020227 ACACAGCTGGCCAATGGCAGAGG + Intergenic
967088079 3:186111868-186111890 ACAGAGCTGGCCAAAGTCAAAGG + Intronic
968939812 4:3631904-3631926 ACACTGCTGGCCAGTGACAAAGG + Intergenic
973826428 4:54711497-54711519 ACACAGTTCTCCCTTTTCAAGGG + Intronic
974354611 4:60796332-60796354 ACAGAGCTGGCCAATGACAAAGG - Intergenic
975443669 4:74439165-74439187 AGACAGGTGGCTCTTGTAAAAGG + Intergenic
975852885 4:78590685-78590707 ACACAGTTGGCATTTGTAAAGGG + Intronic
984009028 4:174348209-174348231 ACACAGCTGCCCCTTATCCCAGG + Intergenic
984657377 4:182333076-182333098 ACATATCTGGCCCTTGGAAATGG - Intronic
984717531 4:182939734-182939756 ACAGAGCTGGCTCTTGACCAAGG - Intergenic
984930959 4:184846754-184846776 TCACAGCTGGTCATTGTTAATGG - Intergenic
985104713 4:186489263-186489285 ACACAGCTGGTCCATGGCAAAGG + Intronic
986263832 5:6175331-6175353 ACCCAGCTGGCCTTAGCCAAAGG + Intergenic
993304474 5:86257788-86257810 ACACAGCTGAACCATATCAATGG + Intergenic
995297388 5:110537546-110537568 AGACAGGTAGCCCTTGTAAAAGG - Intronic
996899029 5:128522212-128522234 ACAGATCTGGCCCTTGTCCTGGG - Intronic
997641306 5:135450610-135450632 ACAAAGCTGGCCATTGTGAGTGG - Intronic
999398887 5:151249300-151249322 AGACAGGTGGCCCTTGTAAGAGG + Intronic
1000270096 5:159676379-159676401 ACTCAGCTGACACTTGTCCATGG + Intergenic
1002136946 5:177113440-177113462 ACACAGCAGGCACTCATCAATGG + Intergenic
1004167445 6:13269479-13269501 ACACAGCTGGCCCTTGTCAATGG + Intronic
1013346179 6:109262798-109262820 CCACAGCGGGCCCTTGATAATGG - Intergenic
1013836311 6:114340876-114340898 AAACAGCTGGTGCTTCTCAAAGG - Intronic
1016692557 6:146954801-146954823 ACGCAGCTGGCGTTGGTCAATGG + Intergenic
1016847391 6:148581753-148581775 ACACAACTGGAGCTTGTCAGAGG - Intergenic
1017608273 6:156156396-156156418 ACACAGCTGCCACTCCTCAAAGG + Intergenic
1019610181 7:1932590-1932612 ACACAGAGGTCACTTGTCAAAGG - Intronic
1019892923 7:3961033-3961055 ACAGAGCTTTCTCTTGTCAAAGG - Intronic
1022955575 7:35377151-35377173 ACACAGCGGGCCCTTGAGCATGG + Intergenic
1023826547 7:44013879-44013901 ACAGAGCTGAACCATGTCAAGGG + Intergenic
1024477562 7:49829705-49829727 ACACAGCTTGCCCTCCTCACTGG - Intronic
1026090125 7:67292749-67292771 ACAGAGCTGAACCATGTCAAGGG + Intergenic
1026184305 7:68070107-68070129 ACACAGCACCTCCTTGTCAAAGG + Intergenic
1027119716 7:75508067-75508089 ACAGAGCTGAACCATGTCAAGGG + Intergenic
1027272109 7:76527544-76527566 ACAGAGCTGAACCATGTCAAGGG - Intergenic
1027641870 7:80745102-80745124 ACAGAGCTGGCCCAGGTCCATGG + Exonic
1029717781 7:102341960-102341982 ACAGAGCTGAACCATGTCAAGGG - Intergenic
1029754834 7:102567283-102567305 ACAGAGCTGAACCATGTCAAGGG + Intronic
1029772784 7:102666363-102666385 ACAGAGCTGAACCATGTCAAGGG + Intronic
1030209649 7:106983407-106983429 ACTGAGCTGGCCTTTGCCAAGGG + Intergenic
1035215166 7:157360420-157360442 ACATAGCCAGCCCTTATCAATGG + Intronic
1035479383 7:159169821-159169843 ACACACCTGGGCTTTGTCAGTGG + Intergenic
1037588456 8:20294386-20294408 CCGCAGCTGGCCCTGCTCAAAGG - Intronic
1039733200 8:40301940-40301962 TCACAGCTTGCCTTTGACAAGGG - Intergenic
1040351800 8:46576398-46576420 ACACAGCTGGCAGTTGTTAGTGG + Intergenic
1040457851 8:47617653-47617675 ACACAGTAGGCACTTGACAAAGG - Intronic
1040765086 8:50899963-50899985 ACACAGCTGACCCTTGAATAAGG + Intergenic
1043726075 8:83611941-83611963 ACTCTGCTGGCCCTGGTAAAAGG + Intergenic
1045036189 8:98178262-98178284 ATACAGTAGGCCCTTGGCAAGGG + Intergenic
1045327110 8:101125791-101125813 ACACAGCTAGCAGTTGGCAAAGG - Intergenic
1046683682 8:117200390-117200412 ACACAGCTAGTACATGTCAATGG - Intergenic
1047278884 8:123427556-123427578 CCACGCCTGGCCTTTGTCAAAGG + Intronic
1048049072 8:130800155-130800177 ACACAGCTGGCAGATGGCAAAGG - Intronic
1048960888 8:139575851-139575873 ACACAGCCAAACCTTGTCAAGGG - Intergenic
1049387163 8:142348771-142348793 ACAGAGCTGGCCCGTGTGCATGG + Intronic
1050016116 9:1236238-1236260 TCACAGCTGTCCCTTTTCTAGGG + Intergenic
1051838287 9:21365221-21365243 ACACAGCTGGCCATTCTTCATGG - Intergenic
1054450948 9:65403406-65403428 ACACTGCTGGCCAGTGACAAAGG - Intergenic
1058384618 9:104419529-104419551 ACACAGCTAGGCCATATCAATGG + Intergenic
1059388348 9:113982826-113982848 AGACAGCTGGCCTTTCTCTAAGG - Intronic
1060221383 9:121765814-121765836 GCAGAGCTGGCCCTAGACAATGG - Intronic
1061512366 9:131068997-131069019 ACCCAGCTGGCACCTGTCACAGG - Exonic
1061878494 9:133556784-133556806 TCACAGCTGGCCCCTGACACAGG - Intronic
1062296824 9:135835054-135835076 ACTCTGAGGGCCCTTGTCAAGGG + Intronic
1062706212 9:137944914-137944936 AGACAGGTGGCCTTTGTAAAAGG + Intronic
1189215405 X:39318879-39318901 ACACAGCTGGCTTGTGTCAAAGG + Intergenic
1192113263 X:68386851-68386873 ACACAGCTGACCCTTAGCAAGGG - Intronic
1192364393 X:70458908-70458930 AAACAACTGGCTCTTGGCAAAGG + Intronic
1194477606 X:94378320-94378342 AGACTTCTGTCCCTTGTCAATGG - Intergenic
1195611587 X:106872950-106872972 ACACAGCAAGGCCTTGTCTAAGG + Intronic
1197281730 X:124544732-124544754 CCACAGCTGCCCCATTTCAATGG - Intronic
1197794037 X:130281920-130281942 AGACAAGTGGCCCTTGTAAAAGG - Intergenic
1198982042 X:142409001-142409023 ACAGTGCTGGCCCTTGCCCAAGG - Intergenic
1199846675 X:151696512-151696534 ACACACCTAGCCTTGGTCAAAGG - Intronic