ID: 1004168221

View in Genome Browser
Species Human (GRCh38)
Location 6:13275344-13275366
Sequence GGTACCAAGACAACCCCATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 117}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004168221_1004168227 15 Left 1004168221 6:13275344-13275366 CCTAATGGGGTTGTCTTGGTACC 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1004168227 6:13275382-13275404 CATGAACCTGGGTTGGTCAATGG 0: 1
1: 0
2: 0
3: 13
4: 183
1004168221_1004168224 4 Left 1004168221 6:13275344-13275366 CCTAATGGGGTTGTCTTGGTACC 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1004168224 6:13275371-13275393 GCCTGAAAATTCATGAACCTGGG 0: 1
1: 0
2: 1
3: 11
4: 199
1004168221_1004168223 3 Left 1004168221 6:13275344-13275366 CCTAATGGGGTTGTCTTGGTACC 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1004168223 6:13275370-13275392 TGCCTGAAAATTCATGAACCTGG 0: 1
1: 0
2: 0
3: 12
4: 172
1004168221_1004168226 8 Left 1004168221 6:13275344-13275366 CCTAATGGGGTTGTCTTGGTACC 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1004168226 6:13275375-13275397 GAAAATTCATGAACCTGGGTTGG 0: 1
1: 0
2: 3
3: 19
4: 237
1004168221_1004168229 29 Left 1004168221 6:13275344-13275366 CCTAATGGGGTTGTCTTGGTACC 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1004168229 6:13275396-13275418 GGTCAATGGCTTTGAACTAAAGG 0: 1
1: 0
2: 2
3: 3
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004168221 Original CRISPR GGTACCAAGACAACCCCATT AGG (reversed) Intronic
906982337 1:50644884-50644906 GGAAGCAAGACAGCCCCAGTTGG - Intronic
907388429 1:54140766-54140788 GGTACAAAGATAAGCCCATAAGG + Intronic
908403528 1:63792328-63792350 GGTGCCGCGACAACCCTATTCGG + Intronic
908733297 1:67249009-67249031 GGTACCAAGTTCATCCCATTGGG - Intronic
910863263 1:91764169-91764191 GGTTTCAAGACAAAACCATTGGG - Intronic
911214433 1:95176902-95176924 GGTACCAAGACTACACAATGGGG - Intronic
911327752 1:96489130-96489152 GGCACCAAGACAAGACCAGTAGG - Intergenic
915961510 1:160270835-160270857 GGTGCCAAGACCATCCCATATGG - Intergenic
917697049 1:177535906-177535928 TCTACAAAGAGAACCCCATTAGG + Intergenic
920747289 1:208640942-208640964 GGTTCAAAGACAAACACATTAGG + Intergenic
922431569 1:225560091-225560113 ACTACCAGGACATCCCCATTGGG + Intronic
1063418422 10:5891024-5891046 GGTCCGAAGACAACCCTATGAGG + Intronic
1063804118 10:9618420-9618442 AATGCCAAGACAACTCCATTGGG + Intergenic
1065756627 10:28936557-28936579 GGTACCCAGACATCCCTGTTTGG + Intergenic
1067279852 10:44862943-44862965 GGTACAAAGACAAGCCCACCAGG + Intergenic
1068077380 10:52273547-52273569 GGTACCATAAGAACACCATTAGG - Intronic
1068360086 10:55966535-55966557 GGTAACAATGCTACCCCATTCGG + Intergenic
1069016012 10:63430074-63430096 GGTTCCAAGACAACTCAATGGGG + Intronic
1072862699 10:99023003-99023025 GGTACCAGCACAACCACAGTGGG + Intronic
1074802156 10:117011360-117011382 GGTACCAAGACCACTCAATGGGG - Intronic
1076137791 10:128056881-128056903 GGTGCCAAGACAAACCCTGTAGG + Intronic
1076754388 10:132561417-132561439 GGTACCGAGACAACCAGATATGG - Intronic
1077403742 11:2372595-2372617 GGTACCAAGACAATTCAATGGGG - Intergenic
1079712858 11:23708304-23708326 GGTACCAACACCACCACAGTGGG + Intergenic
1081872256 11:46388658-46388680 GGGTCCCTGACAACCCCATTTGG + Intergenic
1085874407 11:80388478-80388500 GGCACCAAGACATCTCCATGTGG + Intergenic
1086458788 11:86985256-86985278 GGTACCCAGAGAAGCCCATCTGG + Intergenic
1088425629 11:109698257-109698279 GATACCAAGGAAACCCCATTAGG + Intergenic
1088683174 11:112262452-112262474 GGTAACAAGACAACTCAATGGGG + Intronic
1093134941 12:15439041-15439063 TGTACAAAGAGAACCCCATCAGG + Intronic
1096235929 12:49926386-49926408 GGAACCAAAACAATTCCATTTGG + Intergenic
1110587676 13:77213644-77213666 GATACCTGGACAACCCCATAAGG + Intronic
1113730301 13:112636878-112636900 AGGACCCAGACAACCCCATGAGG - Intergenic
1115660444 14:35489212-35489234 GTTACCAAGACAACTCAATGGGG - Intergenic
1115871150 14:37804199-37804221 GGTGCCAATAAAACCCTATTAGG + Intronic
1116254287 14:42530946-42530968 AGTACCAAGACAACTCAATGTGG - Intergenic
1116725150 14:48553870-48553892 CGTACCAACACTACCACATTGGG - Intergenic
1119581440 14:75785633-75785655 AGTGCCAAGACAATCCCATGGGG - Intronic
1120738651 14:88083273-88083295 GGTACTAAGAGGAACCCATTAGG - Intergenic
1122476992 14:102017172-102017194 GGAGCCAAAACCACCCCATTAGG - Exonic
1122563001 14:102630431-102630453 GGGACTAAGACAACCCCTTTAGG + Intronic
1122757046 14:103989911-103989933 GGTACCAAGAAATGCCCATAAGG - Intronic
1146106203 17:30039567-30039589 GGTACCAAGATACCCCAAGTTGG + Intronic
1148052632 17:44776646-44776668 GGTACCAAGTGCCCCCCATTGGG - Intronic
1150506957 17:65708860-65708882 GGCACCACGACCACCCCACTGGG - Intronic
1151196416 17:72434987-72435009 GGTCCCAAGAGTACCCTATTGGG - Intergenic
1158257148 18:55564251-55564273 GGTACCTCTACAACCTCATTTGG - Intronic
1160440440 18:78885712-78885734 TGTACAAAGATAACCCCATCAGG + Intergenic
1161849181 19:6730161-6730183 GGTTCCCGGACAAGCCCATTTGG - Exonic
1161954888 19:7488222-7488244 GGTTCCAACAAAACCCCAGTTGG - Intronic
1165247191 19:34504578-34504600 GGTACCATGACAATCCCAAGTGG + Exonic
925170808 2:1749291-1749313 GGCCCCAAGCCCACCCCATTAGG - Intergenic
928223817 2:29429936-29429958 GGTACCAAGACAATTCCATGGGG + Intronic
929042199 2:37755976-37755998 GGTACCAAGACAATTCAATGTGG - Intergenic
929943536 2:46353009-46353031 AATCCCAAGACAACCCTATTTGG - Intronic
930744838 2:54871395-54871417 GAAACCAAGATAAACCCATTTGG - Intronic
932273573 2:70434076-70434098 GGTACCAAGACAAGCCAATGGGG - Intergenic
936820029 2:116509259-116509281 TGTACCAAGGGAACCCCATCAGG - Intergenic
938157041 2:128950616-128950638 GGTACCAACACAAGCCCATCTGG + Intergenic
939443198 2:142275921-142275943 GGTACCAGCACAACCACAGTGGG - Intergenic
940202752 2:151169046-151169068 GGTATCAAGATAACTCCAATGGG - Intergenic
940693836 2:156954625-156954647 TGTACAAAGAGAACCCCTTTAGG + Intergenic
944418466 2:199502824-199502846 GGTGCCAAGACAACTCAATGGGG + Intergenic
948440789 2:237986777-237986799 GGTACCAAGAAAACACCATGGGG - Intronic
948829033 2:240588572-240588594 GGGACCAAGAGAAGCCCAGTGGG + Intronic
1169164639 20:3411873-3411895 GGTACCAAGACAATTCAATGGGG - Intergenic
1170175424 20:13463798-13463820 GATACCAACACATACCCATTAGG + Intronic
1172315098 20:33947710-33947732 GGTCCCAAGACACCCTCTTTAGG + Intergenic
1178945236 21:36941505-36941527 GGTGCCAAGACAACTCAATAAGG + Intronic
1184494700 22:44831729-44831751 GGTACCAAGACAACTGAATGGGG - Intronic
954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG + Intronic
957040562 3:75332597-75332619 GGTACCAAGGCTGACCCATTAGG + Intergenic
959581139 3:107983767-107983789 GCTACCAAGTCAGCCTCATTTGG - Intergenic
967667814 3:192195038-192195060 GGCTCCAAGACAACCACAATGGG - Intronic
972232577 4:37092922-37092944 GGTTCCAAGTCAAAGCCATTTGG - Intergenic
972462658 4:39319698-39319720 TGTTCCAAGACCACCCCAGTAGG + Intronic
973617671 4:52695554-52695576 CCTACCAAGAGAACCCCATAAGG + Intergenic
974456284 4:62132634-62132656 GGTACCAAGACTACACAATAGGG + Intergenic
975717923 4:77223289-77223311 GGTACCAAGATGACACCATAGGG - Intronic
976107681 4:81636631-81636653 GGTACCAAAACAATTCCATGGGG + Intronic
980010317 4:127588087-127588109 GGTACAAAGGAAACCCCATCAGG + Intergenic
980723531 4:136727790-136727812 GGTACCAGCACAACCACAGTGGG - Intergenic
981627469 4:146775629-146775651 TCTACAAAGAGAACCCCATTGGG - Intronic
983078933 4:163361190-163361212 GGTACCAAGAGAATTCCATAGGG - Intergenic
985858647 5:2451275-2451297 GGAACCCAGCCAAGCCCATTGGG - Intergenic
992378540 5:76214297-76214319 GGCACCAAGAGTACCCCATAAGG - Intronic
997399395 5:133590970-133590992 GTTACCTAAACACCCCCATTAGG + Intronic
999615498 5:153418477-153418499 GTTATCAAGTCAGCCCCATTGGG - Intergenic
1000241263 5:159410532-159410554 GGTACAAGGACAACTCAATTGGG - Intergenic
1001265031 5:170268087-170268109 GGTACCCAGGCAACACCAGTAGG + Intronic
1004168221 6:13275344-13275366 GGTACCAAGACAACCCCATTAGG - Intronic
1009996075 6:70896360-70896382 GATCCCAAGACAACCCTGTTTGG - Intronic
1010452196 6:76015498-76015520 GCTAGCAAGACATGCCCATTTGG + Intronic
1010528640 6:76938469-76938491 GATGCCAAGACAACACAATTGGG + Intergenic
1013320520 6:108983514-108983536 GGTACCAAGACCACTCAATAAGG - Intergenic
1020214028 7:6175401-6175423 GGTACCAAGACAATTTCAGTGGG - Intronic
1022661587 7:32372368-32372390 GGTACCAAGACAATTCAATGGGG + Intergenic
1030408320 7:109143142-109143164 GGTACCAAGACCACCACAGGGGG - Intergenic
1034752282 7:153581661-153581683 GGTGCCAAGACTACTCCATGAGG + Intergenic
1035646022 8:1221475-1221497 TGTACCAAGGGAACCCCATCAGG - Intergenic
1037207369 8:16339389-16339411 GGTGCCAAGAAAACCCCTCTAGG - Intronic
1040621942 8:49101312-49101334 GGTACCAAGATACCCCAAATTGG + Intergenic
1045070314 8:98497176-98497198 GGTACCAAGATAACTCAATGAGG + Intronic
1046262724 8:111790881-111790903 GGTACCAGGTCAGCTCCATTTGG - Intergenic
1046709600 8:117495421-117495443 TGTACAAAGGGAACCCCATTAGG - Intergenic
1048589586 8:135808892-135808914 GGTACAAAGACAAGACCACTGGG + Intergenic
1050342322 9:4653235-4653257 GGTACCAAGACAATTCAATGAGG + Intronic
1052621369 9:30914068-30914090 TGGACCAAGACTAGCCCATTAGG - Intergenic
1053521722 9:38786951-38786973 GGTACCAAGACAAAACAATGGGG + Intergenic
1054193888 9:62010940-62010962 GGTACCAAGACAAAACAATGGGG + Intergenic
1054644519 9:67577751-67577773 GGTACCAAGACAAAACAATGGGG - Intergenic
1056534048 9:87512469-87512491 CGTGCCAAGAAAAGCCCATTAGG + Intronic
1057119860 9:92561554-92561576 TGTACAAAGAAAACCACATTTGG + Intronic
1057380287 9:94561220-94561242 GGCTCCAAGACAAGCGCATTAGG - Intronic
1059622045 9:116016807-116016829 GGCACCAAGAGAACACAATTGGG - Intergenic
1186154207 X:6708720-6708742 GGTCCCAAGACAACCCTCTGAGG + Intergenic
1187910586 X:24107599-24107621 GGTGCCAAGACAATTCCATGGGG - Intergenic
1189862263 X:45285633-45285655 GGTGCCAAGACAATTCAATTGGG - Intergenic
1189873201 X:45405533-45405555 CCTACAAAGAGAACCCCATTAGG + Intergenic
1190849633 X:54226019-54226041 GGTACCAAGACAACTCAATGGGG + Intronic
1193305796 X:79949776-79949798 GGTACCAACTCAACCACAGTGGG + Intergenic
1193799555 X:85918177-85918199 GGTACAAAGGGAACCCCATCAGG + Intronic
1194393436 X:93349142-93349164 GATACCAATACATACCCATTAGG + Intergenic
1194989188 X:100526958-100526980 GGTACCAAGACTACACAATGGGG + Intergenic
1195136211 X:101909424-101909446 GGTACCAACACCACCACAGTGGG + Intronic