ID: 1004172887

View in Genome Browser
Species Human (GRCh38)
Location 6:13312218-13312240
Sequence CAGTAATACACCAACCAGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004172885_1004172887 -3 Left 1004172885 6:13312198-13312220 CCTGACATGAAGTACATTCTCAG 0: 1
1: 0
2: 3
3: 126
4: 534
Right 1004172887 6:13312218-13312240 CAGTAATACACCAACCAGACGGG 0: 1
1: 0
2: 0
3: 6
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004172887 Original CRISPR CAGTAATACACCAACCAGAC GGG Intronic
901172078 1:7266525-7266547 CAGTAATGCACAAAACAGATAGG + Intronic
905784234 1:40740331-40740353 CAGTAATGAACCAGACAGACAGG + Intronic
913181519 1:116326840-116326862 CCAAAATACACCAAGCAGACAGG + Intergenic
917056283 1:170985424-170985446 CAGAAATACACCAATCACACAGG - Intronic
919831418 1:201542915-201542937 CAGTAATACACAAGCCAAAAAGG - Intergenic
920204622 1:204282581-204282603 CAATAATTCATCAACCAGAAAGG - Intronic
923723253 1:236484932-236484954 AAGTAATAAACCAACAAGACAGG - Intergenic
1067151050 10:43734924-43734946 GAGTAATACCAAAACCAGACTGG + Intergenic
1068077408 10:52273858-52273880 CAGTAATAAACAAAACAGATGGG + Intronic
1068318028 10:55373089-55373111 CAGCAACAAACCTACCAGACAGG + Intronic
1069492283 10:68871291-68871313 CACTGATACACCAAGAAGACAGG - Intronic
1073857940 10:107698859-107698881 CAATAATCCACTAAACAGACAGG - Intergenic
1075088317 10:119428817-119428839 CAGTACAGCACCAACCAGGCAGG - Intronic
1086398608 11:86442579-86442601 CCCTAATACACCAAGCAGAAAGG - Intronic
1090326969 11:125896298-125896320 CAGGAATAAACGAACCATACAGG + Exonic
1091039768 11:132266103-132266125 CAGTAATACACCTGCCTGCCTGG + Intronic
1093762531 12:22925985-22926007 CAGTAATACAAAAACCAAAAAGG - Intergenic
1094484858 12:30916626-30916648 TAGGAATTCACCAAGCAGACAGG + Intergenic
1099958475 12:89374122-89374144 CATTAATAAAACAACCAGATGGG - Intergenic
1100074593 12:90764629-90764651 CAGTTATAGAACAACCACACAGG - Intergenic
1102350893 12:112191245-112191267 CAGTTAGATACCAACCAGAATGG + Intronic
1103034943 12:117648970-117648992 TAGTAAGACAGCAAACAGACAGG - Intronic
1103361896 12:120359480-120359502 CAGGAGGACAGCAACCAGACTGG + Intronic
1106451543 13:29886970-29886992 CAATAATACGCCAACAACACTGG + Intergenic
1108293554 13:48988226-48988248 CAGTATTAGATCAACGAGACAGG + Intronic
1109636032 13:65118896-65118918 CAATAATACAGGAGCCAGACTGG + Intergenic
1117652252 14:57919184-57919206 CAGTATTACACACATCAGACTGG + Intronic
1120699901 14:87687611-87687633 CAGGAATAAACCATGCAGACAGG - Intergenic
1126231490 15:46331785-46331807 CAATAATACAACAACCAAAATGG + Intergenic
1126348833 15:47723543-47723565 CAGTAATACACTTTCCATACTGG - Intronic
1130243157 15:82217115-82217137 CCGTAATATACCCATCAGACTGG + Intronic
1131323586 15:91421260-91421282 CAGTAAGACACCAGCCAGGGTGG - Intergenic
1132656024 16:1042106-1042128 CAGTAATGGACCAAGCAGATGGG - Intergenic
1132708625 16:1256897-1256919 CAGTTCTACATCATCCAGACCGG + Exonic
1143793737 17:9319559-9319581 CAGTCATATCCCATCCAGACTGG + Intronic
1158092709 18:53733692-53733714 CAGTAATATACCAACAAAATGGG + Intergenic
1160247949 18:77175410-77175432 CACTAATAGACCAACAAAACTGG - Intergenic
1160391381 18:78536159-78536181 CATGAAGACACCAGCCAGACTGG - Intergenic
1160952184 19:1672925-1672947 CAGAAACACACCAACCACACAGG - Intergenic
925543501 2:4991756-4991778 AAGAAATACACAAACCAAACAGG - Intergenic
927383156 2:22501933-22501955 CAGTAATCCACCAGCCAAAGAGG - Intergenic
928464961 2:31514978-31515000 AAGTAATACACTAACCTGGCTGG - Intergenic
933868613 2:86546201-86546223 CAGAAATACAAAAACCAGTCAGG + Intronic
938554266 2:132409827-132409849 CAACCACACACCAACCAGACTGG - Intergenic
941509922 2:166394569-166394591 CAGAAATACAACAACAACACTGG - Intergenic
943844574 2:192628301-192628323 CACTAATACACAAAGCAGAGTGG + Intergenic
944817582 2:203393984-203394006 CTGTAAAATACAAACCAGACTGG - Intronic
1169024171 20:2353439-2353461 CAGTAACGCAGCCACCAGACGGG + Intergenic
1170924443 20:20710504-20710526 CAGTAATAAACAAAGCAAACTGG + Intronic
1182564819 22:31189961-31189983 CAGGGATGCACCATCCAGACTGG - Intronic
1184689831 22:46112496-46112518 CAGGAAACCACCAACCAGAGAGG - Intronic
951624876 3:24648469-24648491 CAGGAATACACAAATCAGAGAGG + Intergenic
955046733 3:55368000-55368022 CAGTCAAACACCAAGGAGACTGG + Intergenic
955476714 3:59343887-59343909 CATCTATGCACCAACCAGACTGG + Intergenic
955548897 3:60061375-60061397 CAGTAAGACGCAAACCAGAGAGG - Intronic
958987398 3:100798073-100798095 CAGTACTACACCAAACAAAAAGG + Intronic
959002107 3:100976491-100976513 GAGGAATACACAAACCAAACAGG - Intronic
960346811 3:116543027-116543049 CAGGAATACACTAACCAGGGAGG + Intronic
964697263 3:159523727-159523749 CAGTAATCCTCCAACCAGTAGGG + Intronic
969403845 4:6975716-6975738 CTGAAATAAACTAACCAGACAGG + Intronic
970346054 4:15153140-15153162 CAGTAATAAACCATGTAGACTGG + Intergenic
972235406 4:37127377-37127399 TAATAAAACACTAACCAGACTGG + Intergenic
974979305 4:68934719-68934741 CAGGCATACACCATCAAGACTGG - Intronic
976083260 4:81379959-81379981 CAGTGATACATTAACCAAACAGG + Intergenic
976987255 4:91317256-91317278 CAGCAATACATTAGCCAGACTGG + Intronic
978052758 4:104222797-104222819 CAGAAGTATACCAACCAGGCCGG - Intergenic
986966912 5:13284577-13284599 CCCTCATACACCAACCACACAGG - Intergenic
987319650 5:16756649-16756671 CAGTAGAACACCAGCCGGACAGG - Intronic
987762184 5:22179876-22179898 CATTAATTCACCAAACAGAGTGG + Intronic
988280918 5:29146337-29146359 AAGTAAGACACTATCCAGACAGG - Intergenic
988481432 5:31634672-31634694 CATTAAGACACCAGCAAGACAGG - Intergenic
990842423 5:60097798-60097820 CAATAATACACAAATCAGAAAGG + Intronic
991213969 5:64140154-64140176 CAATAATAGAAAAACCAGACAGG + Intergenic
991896969 5:71413338-71413360 CATTAATTCACCAAACAGAGTGG + Intergenic
992408232 5:76479757-76479779 CTGAAACACACCAACAAGACAGG + Intronic
998066126 5:139160508-139160530 CAGCTATACACCAGCAAGACAGG - Intronic
1002255443 5:177954897-177954919 CAATATTACACCTACCAGAATGG + Intergenic
1004172887 6:13312218-13312240 CAGTAATACACCAACCAGACGGG + Intronic
1004925213 6:20409853-20409875 CTGTAATCCACAAACCAGAAAGG + Intronic
1005034776 6:21545463-21545485 CAGAAATACAAAAACCAGGCGGG + Intergenic
1006596645 6:35198160-35198182 CAATTATACATCAACCAAACTGG + Intergenic
1009392644 6:63163509-63163531 CAGAAATACAAAAACCAGTCAGG - Intergenic
1009852429 6:69214531-69214553 GACTAAAACAACAACCAGACTGG + Intronic
1023070725 7:36430261-36430283 CAGTAATACAACAATCACAGAGG + Intronic
1026905825 7:74062161-74062183 CAGGGATCCACCAACCAGCCGGG + Intronic
1029836162 7:103313371-103313393 ATGTAATACACTCACCAGACTGG + Intronic
1030281199 7:107777384-107777406 CAGGAATTCACGAACCAGCCTGG + Intronic
1031191534 7:118558293-118558315 CAGTATTAGACCACCCAGCCAGG - Intergenic
1036584505 8:10110874-10110896 CTGTATTCCACCAATCAGACAGG + Intronic
1043754935 8:83991278-83991300 CAGGAATACACGAACCAGGGAGG + Intergenic
1051317489 9:15857563-15857585 CAGTAATACACCACCATGACCGG + Intronic
1052212533 9:25923258-25923280 CAGTAATAGAACATCCAGACAGG + Intergenic
1052638862 9:31138038-31138060 CAGTCATACACCACCAAGCCTGG + Intergenic
1055045746 9:71922232-71922254 CATTAAAACACCAACCAGCCAGG - Intronic
1187105450 X:16236852-16236874 CAATAATACACCAACCTGGGGGG - Intergenic
1190433226 X:50398019-50398041 AAGGAATATACCAAGCAGACTGG + Intronic
1191010971 X:55758687-55758709 CAGTAATACTCCAAACTTACAGG - Intronic
1192753693 X:74022827-74022849 CTGTCTTACACCAACCAGAATGG + Intergenic
1195761962 X:108256095-108256117 GAGGAATACACAAACCACACGGG + Intronic
1196512154 X:116524290-116524312 CAGTAAGACACCAGCCAGGATGG - Intergenic
1200103169 X:153698424-153698446 GAGAAATACACGGACCAGACAGG + Intergenic