ID: 1004174552

View in Genome Browser
Species Human (GRCh38)
Location 6:13328465-13328487
Sequence CCGCGCGCGCCCAGACGGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004174542_1004174552 16 Left 1004174542 6:13328426-13328448 CCTGCGGGAAGGAGGGAGGCGGC 0: 1
1: 0
2: 4
3: 43
4: 378
Right 1004174552 6:13328465-13328487 CCGCGCGCGCCCAGACGGCCCGG 0: 1
1: 0
2: 2
3: 12
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004174552 Original CRISPR CCGCGCGCGCCCAGACGGCC CGG Intronic
900166751 1:1247013-1247035 GCCCGGGCGCCCCGACGGCCAGG + Intergenic
901242897 1:7705063-7705085 CCGCGCACGCCCTCCCGGCCTGG - Intronic
904744523 1:32702784-32702806 CCGGGCGCGCCCACTTGGCCGGG + Exonic
915458091 1:156053751-156053773 CCCCGCCCGCCCGGCCGGCCCGG + Exonic
920528700 1:206686042-206686064 CGGCGCGCCCCAAGGCGGCCCGG - Intronic
922539492 1:226408151-226408173 GCGCGCGCCCCCTGCCGGCCGGG + Intergenic
1064208897 10:13347570-13347592 CCGCGCGGGCCCTGTCGACCCGG - Intronic
1066080824 10:31928911-31928933 CCGCGCCCGCCCAGCTCGCCCGG - Intergenic
1067227716 10:44386353-44386375 CCGCCCACTCCCCGACGGCCAGG - Intronic
1073325917 10:102643992-102644014 CCGCGCCCGGCCAGCCAGCCGGG + Intergenic
1074618344 10:115093038-115093060 GCGCGCGCGCCCACCCCGCCTGG - Intergenic
1077544971 11:3165243-3165265 CCCCGCGCGCCCGGCCGGCCCGG - Exonic
1077556029 11:3226487-3226509 CCGCACGTGCCCAGCAGGCCTGG - Intergenic
1077922992 11:6655522-6655544 GCGGGCGCGGCCAGACGGGCCGG + Intronic
1080836425 11:35944539-35944561 CCGCGCGCGACCAGGCGTCTGGG - Intronic
1089452518 11:118608009-118608031 CCGCCGGCACCCAGGCGGCCGGG + Intronic
1091000941 11:131910589-131910611 GCGCGCGGGCCCCGACCGCCGGG - Intronic
1091108472 11:132943913-132943935 GCGCGCGGGCCCGGACCGCCGGG + Intronic
1095432026 12:42144680-42144702 CCGCGCCCGCCCCGACGAACTGG + Exonic
1095947122 12:47759565-47759587 CCGCGCGCTCCCTGGTGGCCGGG + Intronic
1096435927 12:51591145-51591167 GCGCGCGCGCCCCTACTGCCGGG - Intronic
1102046573 12:109833352-109833374 CCGCCGGCGCCCAGCCGTCCCGG - Intronic
1102453259 12:113056780-113056802 CCGCGCGTGGACAGACTGCCCGG - Intronic
1103649659 12:122422712-122422734 CCGCGCCCGCCCGGCCGGCCCGG + Intergenic
1108643607 13:52406056-52406078 CGCCACGCGCCCGGACGGCCTGG - Exonic
1110706261 13:78603706-78603728 GCGCGCGCGCGCAGACGCACGGG - Intergenic
1112344267 13:98577064-98577086 GCGCGCGGGCCCAGGCCGCCCGG - Intronic
1112344298 13:98577167-98577189 CCGCGCCCGCCCCCACGGCCCGG + Intronic
1113378690 13:109785012-109785034 CCGCTCGCGCACCGACAGCCTGG - Exonic
1113417356 13:110138552-110138574 CCGCGCGCACACAGCCGGCCAGG + Intergenic
1113820364 13:113209012-113209034 GCGCGCGCGCCCCGAGGCCCTGG - Intronic
1113861570 13:113490699-113490721 CCGCGCCTGCGCAGAAGGCCGGG - Exonic
1114485157 14:23057641-23057663 CCGCGCGGGCCCGGCTGGCCGGG - Intergenic
1114664226 14:24368800-24368822 CCCCGGGCGTCCAGTCGGCCGGG - Intronic
1121605248 14:95235855-95235877 ACGCGCTCGCCCAGACGTTCGGG + Intronic
1122625677 14:103084326-103084348 CCGGGAGCGCCCTGACGGCTAGG + Intergenic
1122768258 14:104085761-104085783 CCGCGCGCGCCATGCCGGACCGG - Exonic
1122975054 14:105167629-105167651 CCGCGCGCGCCCAGGCGGGGCGG - Intronic
1123021072 14:105398264-105398286 CCGCGCGCGCGGAGGTGGCCCGG + Intergenic
1127867297 15:63042964-63042986 GCGCCCGCGCCCAGAGCGCCGGG + Intronic
1132365036 15:101251267-101251289 CGCCGCGCGCCCCGCCGGCCTGG + Exonic
1133104751 16:3500221-3500243 TCGCGCACGCGCAGACGGCTCGG - Intergenic
1135047778 16:19168714-19168736 CCGCGCGCTCCCAGCCGGAGGGG - Intronic
1136172563 16:28497611-28497633 CCGCGGGCTCCCAGACAGCGAGG + Exonic
1137454773 16:48609961-48609983 CCGCGCCCGCCATGGCGGCCCGG - Exonic
1138561294 16:57802334-57802356 CCGCTCGCACCCAGCCCGCCCGG + Intronic
1138595301 16:58026363-58026385 CCGAGCGCGCCCGGACGGCCGGG + Exonic
1141116612 16:81315015-81315037 GCGCGCGCGCCCGCCCGGCCCGG - Exonic
1203081315 16_KI270728v1_random:1147431-1147453 TCGCGCGCGCCGGCACGGCCAGG + Intergenic
1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG + Exonic
1147150338 17:38510468-38510490 CCGGGGCCGCCCAGACGGCGAGG + Exonic
1148388630 17:47254196-47254218 CCGTGCGCGCCGCGGCGGCCGGG - Intronic
1150480222 17:65503648-65503670 CCGAGCCCACCCAGAGGGCCCGG + Intergenic
1150624846 17:66835187-66835209 CCCCGCGCGCCCAGCCGGCGAGG + Exonic
1151662506 17:75526111-75526133 CCCCCCGCACCCAGCCGGCCGGG - Intronic
1151890412 17:76947960-76947982 CCGCGCACGCCCTGCGGGCCTGG + Exonic
1152751729 17:82065480-82065502 CCGCACCCGGCCAGGCGGCCCGG + Exonic
1157610096 18:48950605-48950627 CCGCGCGCGCCCCGGCCTCCGGG - Exonic
1157794273 18:50560110-50560132 CCGCGGTCGCCCCGACAGCCCGG - Exonic
1159003364 18:62992227-62992249 CTGGGCGCGCCCAGGCGCCCTGG + Intergenic
1159586484 18:70288512-70288534 CCGCGCGAGCCCAGCGGACCTGG + Intergenic
1160725555 19:616488-616510 CCCCGCGGGCCCAGGCGGGCCGG + Exonic
1160765973 19:808266-808288 CCGCGCACCCCCACAAGGCCCGG - Intronic
1161158641 19:2749069-2749091 CCTCGCGCGCCCACGCTGCCGGG + Intergenic
1161703085 19:5805353-5805375 CACCGCGGGCCCAGGCGGCCCGG + Intergenic
1162776636 19:12983741-12983763 CCGCGCGCCCCCTGCTGGCCTGG - Intergenic
1162954347 19:14090112-14090134 CGGCGCGCGTCCAGCCGCCCCGG - Exonic
1162962597 19:14136701-14136723 CGGCGCGCGCCCAGACTCCTCGG + Exonic
1163124546 19:15237915-15237937 CCGCCCGCTCCCAGGAGGCCAGG - Exonic
1163153347 19:15427601-15427623 CCGCCCACGCCCAGCCGACCAGG - Intronic
1164804614 19:31107268-31107290 CTGTGCCTGCCCAGACGGCCAGG - Intergenic
1165751780 19:38264685-38264707 CATCGCGCGCCGAGAAGGCCGGG + Exonic
1166304204 19:41928420-41928442 CCCCGCGCCCCCAGCCGGCCAGG - Intronic
1166538876 19:43592895-43592917 CTGCGTGCGCACAGACGGCGAGG - Exonic
1168336472 19:55600206-55600228 CCGCGGGCGCGCAGGCGGGCGGG + Intronic
926152604 2:10433134-10433156 CCGCTCGAGCCCGGAGGGCCTGG - Intergenic
927606437 2:24491069-24491091 CAGCGCGCCCCCAGCCCGCCGGG - Intergenic
929452826 2:42048165-42048187 CCGCGCGGGGCCGGCCGGCCGGG + Exonic
934031845 2:88055534-88055556 CCTCGCGCGCCCAGCCCGCCGGG - Intronic
938073039 2:128318401-128318423 CCGCGCGCCGCCCGACGACCTGG - Exonic
939629675 2:144516935-144516957 CCGCTCGCGCCCGGCCCGCCGGG - Intronic
942023897 2:171894257-171894279 GCGCGCGCGCCCTGACAGCTCGG - Intronic
942045853 2:172099111-172099133 CCGCGCCCGCCTAGATGGCCAGG - Intergenic
948351858 2:237347461-237347483 CCATGCCCACCCAGACGGCCAGG - Intronic
949079898 2:242088521-242088543 CCGCGCGCGCCCAGAGTGCCGGG - Intergenic
1169383337 20:5127301-5127323 ACGCGCGCGCCGCGAAGGCCGGG - Intronic
1169673835 20:8132612-8132634 CCGCGCTCGCCCGGGCCGCCCGG + Exonic
1170026168 20:11891291-11891313 CCGCGGGCGTCCGCACGGCCAGG - Intronic
1172146666 20:32762470-32762492 CCGAGCGCCCCCCGACGGACGGG + Exonic
1172684874 20:36746005-36746027 CCGCGCGCCCCCCGCGGGCCGGG + Intronic
1172954675 20:38748040-38748062 CCGGGCGCGCACCGTCGGCCGGG - Intergenic
1172954680 20:38748058-38748080 CCGGGCGCGCACCGTCGGCCGGG - Intergenic
1173834898 20:46118631-46118653 CCAAGCGTGCCTAGACGGCCTGG + Intronic
1176143708 20:63556119-63556141 CCACCAGCGCCCAGTCGGCCAGG - Exonic
1176311792 21:5154531-5154553 CCACGCGCCCCCAGCCCGCCCGG + Intronic
1179845258 21:44107504-44107526 CCACGCGCCCCCAGCCCGCCCGG - Intronic
1180748853 22:18110885-18110907 CCGCGCGCCCGCAGCCCGCCTGG - Intronic
1182586309 22:31346052-31346074 GCGCGCGCCCCCAGCGGGCCCGG - Exonic
1183856077 22:40636242-40636264 CCGCGCCCGCCCGCCCGGCCCGG + Intronic
1184673436 22:46027679-46027701 CCTCGCGGGCCCAGCTGGCCGGG - Intergenic
954031760 3:47824943-47824965 CCGCGCGCCCCCTGCGGGCCGGG - Intronic
956678217 3:71754448-71754470 CGGCGCACGGCCAGCCGGCCAGG - Exonic
961389152 3:126542182-126542204 GCGCGCGCTCCCCGACGCCCGGG + Exonic
962164837 3:133038315-133038337 CCGCGCGCGCCCCTCCGACCAGG - Intergenic
963732660 3:148987716-148987738 CCCCGCTCGCCCGGCCGGCCCGG + Intergenic
968008837 3:195260155-195260177 CCGCGCGCACCTCGCCGGCCGGG + Intronic
968577571 4:1375016-1375038 CAGCGAGAGCCCAGACTGCCCGG - Intronic
969045924 4:4336669-4336691 CCGCGCCCGGCCAGACAGCAGGG + Intergenic
969912215 4:10457226-10457248 CCCCGCGCGCCCCCACGACCCGG + Intronic
970394844 4:15655398-15655420 GCGCGCGCGCCCGGTCGGCTTGG + Exonic
977809989 4:101347187-101347209 CCACGCGCGCACACACGGCCAGG + Exonic
978741759 4:112145437-112145459 CGGAGCGCGCCCCGCCGGCCTGG - Exonic
980990505 4:139735084-139735106 CAGCGCTCGCCCAGACGCGCGGG - Intronic
984928418 4:184826166-184826188 CCACGCGCGCCCAGACAGGAGGG - Intronic
985472301 5:53680-53702 CCGCGCGGGGCCACACAGCCGGG - Intergenic
985654508 5:1122969-1122991 CCCCGCGCCCCCAGGCAGCCAGG - Intergenic
1001035108 5:168291864-168291886 GGGTGCGCGCCCAGCCGGCCGGG - Intronic
1001395933 5:171419698-171419720 CGGCGGGCGCCCAGACGGAGCGG + Exonic
1002888251 6:1313695-1313717 TCGCGCGCGCCCAGCCGCGCCGG - Exonic
1004174552 6:13328465-13328487 CCGCGCGCGCCCAGACGGCCCGG + Intronic
1007702235 6:43771944-43771966 CCGCGCGCACCCGGCCGGGCGGG - Intronic
1011983835 6:93418598-93418620 CGGCGCGCGACCCGAGGGCCGGG - Intronic
1013170747 6:107634735-107634757 CCGCCCGCGCCCGGGGGGCCCGG - Exonic
1018708319 6:166478935-166478957 CCGCTCAGGCCCACACGGCCAGG + Intronic
1019693844 7:2433488-2433510 CCTCGCGCGCCGAGGCGGGCAGG - Exonic
1022098719 7:27156798-27156820 CCGCCCGCGCCCGGCGGGCCTGG + Intronic
1022107297 7:27205550-27205572 CCCCGCGGGCCCAGGCCGCCTGG - Intergenic
1022715028 7:32891493-32891515 CCGCGGGCTCCCAGCCTGCCCGG + Intronic
1024043827 7:45574474-45574496 CCGCCCGCGCCCCGGCGCCCCGG + Intronic
1024579752 7:50792721-50792743 GCGCGCGCGCCCGGGCGTCCGGG - Intronic
1028796291 7:94907758-94907780 CCGCGGCCGCCGAAACGGCCCGG + Intronic
1032092085 7:128916042-128916064 CAGGGCGCGCCCCGCCGGCCTGG - Intergenic
1034223042 7:149460307-149460329 CCGCGCGCCCCGAGCAGGCCGGG - Intronic
1034426936 7:151018899-151018921 CCGCGCGCCCCCAGCGCGCCAGG + Exonic
1034979816 7:155468373-155468395 CAGCGCGCGCCCGGACCGCGCGG - Intergenic
1035169571 7:157010049-157010071 CCGCCCGCGCCCAGGAAGCCCGG + Exonic
1035537934 8:406786-406808 CCGCGCGCGTCCAGAGTGCCGGG - Intronic
1035751917 8:2002314-2002336 CCGCGCGCGCCCGTCCGACCAGG + Exonic
1038644332 8:29350291-29350313 CCTCGCGCGCCCAGCCGCCTCGG - Exonic
1041068172 8:54101966-54101988 CCGCGCGCGCCCGCGCGTCCAGG + Exonic
1041449878 8:57994907-57994929 CTGCGCGCGGCCAGGCGGCGCGG + Intronic
1043502980 8:80874402-80874424 GCGCGCGGGCGCAGCCGGCCGGG - Intronic
1044569404 8:93700575-93700597 CAGCGCGCGCCCAGGCGCCTTGG + Exonic
1045510022 8:102806726-102806748 CCGCGGGCGCCCACCCAGCCCGG - Intergenic
1048484295 8:134832519-134832541 GCGCGCGCGCCCAGAGCGCTGGG + Intergenic
1049718267 8:144103855-144103877 CCGGGCGCGCCCAGAGCGTCGGG + Exonic
1049762667 8:144338152-144338174 CCGCGCGGGGCCGGGCGGCCGGG - Intergenic
1057054416 9:91949897-91949919 CGGCGGCCGCCCAGACGGCCGGG + Exonic
1057489600 9:95510971-95510993 AGGCGCGCGCCCAGCCGGCGCGG + Intronic
1057773027 9:97984039-97984061 CCGCGCGCCCCGGGCCGGCCGGG + Intronic
1057773083 9:97984199-97984221 CCGCGCCCGCCCAGGCCTCCAGG - Intronic
1058053282 9:100427233-100427255 CGGCGCGCCCCCGGCCGGCCAGG - Intronic
1059414746 9:114155844-114155866 CCGCGCGCTCTAAGCCGGCCTGG + Exonic
1061208212 9:129176456-129176478 CCCGGCGCGCCCCGGCGGCCAGG + Exonic
1061727814 9:132590766-132590788 TCGCGGGCGCCAAGGCGGCCCGG + Intergenic
1062584176 9:137241580-137241602 CCCCGCGCGCCCTGGCCGCCGGG - Intronic
1185508314 X:644651-644673 CCCCGCGCGCCCGGACTCCCGGG + Exonic
1186466310 X:9786563-9786585 CCGCGCGCGGCCCGAGCGCCTGG + Exonic