ID: 1004175524

View in Genome Browser
Species Human (GRCh38)
Location 6:13336619-13336641
Sequence CTGGTCTTGTGGCAGAAACT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004175518_1004175524 0 Left 1004175518 6:13336596-13336618 CCCCCAGATGAGGTTAGATTTTG No data
Right 1004175524 6:13336619-13336641 CTGGTCTTGTGGCAGAAACTCGG No data
1004175519_1004175524 -1 Left 1004175519 6:13336597-13336619 CCCCAGATGAGGTTAGATTTTGC No data
Right 1004175524 6:13336619-13336641 CTGGTCTTGTGGCAGAAACTCGG No data
1004175517_1004175524 1 Left 1004175517 6:13336595-13336617 CCCCCCAGATGAGGTTAGATTTT No data
Right 1004175524 6:13336619-13336641 CTGGTCTTGTGGCAGAAACTCGG No data
1004175521_1004175524 -3 Left 1004175521 6:13336599-13336621 CCAGATGAGGTTAGATTTTGCTG No data
Right 1004175524 6:13336619-13336641 CTGGTCTTGTGGCAGAAACTCGG No data
1004175520_1004175524 -2 Left 1004175520 6:13336598-13336620 CCCAGATGAGGTTAGATTTTGCT No data
Right 1004175524 6:13336619-13336641 CTGGTCTTGTGGCAGAAACTCGG No data
1004175515_1004175524 16 Left 1004175515 6:13336580-13336602 CCTATATTGCTAATTCCCCCCAG No data
Right 1004175524 6:13336619-13336641 CTGGTCTTGTGGCAGAAACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004175524 Original CRISPR CTGGTCTTGTGGCAGAAACT CGG Intergenic
No off target data available for this crispr