ID: 1004176680

View in Genome Browser
Species Human (GRCh38)
Location 6:13346200-13346222
Sequence ATGCAGAGACGGCCTGAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004176680_1004176685 18 Left 1004176680 6:13346200-13346222 CCTATCTCAGGCCGTCTCTGCAT No data
Right 1004176685 6:13346241-13346263 CATTTCCCCGCTCTGTAAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004176680 Original CRISPR ATGCAGAGACGGCCTGAGAT AGG (reversed) Intergenic
No off target data available for this crispr