ID: 1004177605

View in Genome Browser
Species Human (GRCh38)
Location 6:13353787-13353809
Sequence GAATGGGGAAACCAAGTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004177605_1004177614 14 Left 1004177605 6:13353787-13353809 CCTGTGACTTGGTTTCCCCATTC No data
Right 1004177614 6:13353824-13353846 AGGTGGGTACAGCATATATTAGG No data
1004177605_1004177613 -2 Left 1004177605 6:13353787-13353809 CCTGTGACTTGGTTTCCCCATTC No data
Right 1004177613 6:13353808-13353830 TCAAGGAAGAGGAAGTAGGTGGG No data
1004177605_1004177612 -3 Left 1004177605 6:13353787-13353809 CCTGTGACTTGGTTTCCCCATTC No data
Right 1004177612 6:13353807-13353829 TTCAAGGAAGAGGAAGTAGGTGG No data
1004177605_1004177611 -6 Left 1004177605 6:13353787-13353809 CCTGTGACTTGGTTTCCCCATTC No data
Right 1004177611 6:13353804-13353826 CCATTCAAGGAAGAGGAAGTAGG No data
1004177605_1004177616 30 Left 1004177605 6:13353787-13353809 CCTGTGACTTGGTTTCCCCATTC No data
Right 1004177616 6:13353840-13353862 TATTAGGTCATCAGGAAAGCAGG No data
1004177605_1004177615 22 Left 1004177605 6:13353787-13353809 CCTGTGACTTGGTTTCCCCATTC No data
Right 1004177615 6:13353832-13353854 ACAGCATATATTAGGTCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004177605 Original CRISPR GAATGGGGAAACCAAGTCAC AGG (reversed) Intergenic
No off target data available for this crispr