ID: 1004177609

View in Genome Browser
Species Human (GRCh38)
Location 6:13353803-13353825
Sequence CTACTTCCTCTTCCTTGAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004177609_1004177616 14 Left 1004177609 6:13353803-13353825 CCCATTCAAGGAAGAGGAAGTAG No data
Right 1004177616 6:13353840-13353862 TATTAGGTCATCAGGAAAGCAGG No data
1004177609_1004177617 19 Left 1004177609 6:13353803-13353825 CCCATTCAAGGAAGAGGAAGTAG No data
Right 1004177617 6:13353845-13353867 GGTCATCAGGAAAGCAGGTAAGG No data
1004177609_1004177615 6 Left 1004177609 6:13353803-13353825 CCCATTCAAGGAAGAGGAAGTAG No data
Right 1004177615 6:13353832-13353854 ACAGCATATATTAGGTCATCAGG No data
1004177609_1004177614 -2 Left 1004177609 6:13353803-13353825 CCCATTCAAGGAAGAGGAAGTAG No data
Right 1004177614 6:13353824-13353846 AGGTGGGTACAGCATATATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004177609 Original CRISPR CTACTTCCTCTTCCTTGAAT GGG (reversed) Intergenic
No off target data available for this crispr