ID: 1004177610

View in Genome Browser
Species Human (GRCh38)
Location 6:13353804-13353826
Sequence CCTACTTCCTCTTCCTTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004177610_1004177617 18 Left 1004177610 6:13353804-13353826 CCATTCAAGGAAGAGGAAGTAGG No data
Right 1004177617 6:13353845-13353867 GGTCATCAGGAAAGCAGGTAAGG No data
1004177610_1004177616 13 Left 1004177610 6:13353804-13353826 CCATTCAAGGAAGAGGAAGTAGG No data
Right 1004177616 6:13353840-13353862 TATTAGGTCATCAGGAAAGCAGG No data
1004177610_1004177614 -3 Left 1004177610 6:13353804-13353826 CCATTCAAGGAAGAGGAAGTAGG No data
Right 1004177614 6:13353824-13353846 AGGTGGGTACAGCATATATTAGG No data
1004177610_1004177615 5 Left 1004177610 6:13353804-13353826 CCATTCAAGGAAGAGGAAGTAGG No data
Right 1004177615 6:13353832-13353854 ACAGCATATATTAGGTCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004177610 Original CRISPR CCTACTTCCTCTTCCTTGAA TGG (reversed) Intergenic