ID: 1004177614

View in Genome Browser
Species Human (GRCh38)
Location 6:13353824-13353846
Sequence AGGTGGGTACAGCATATATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004177608_1004177614 -1 Left 1004177608 6:13353802-13353824 CCCCATTCAAGGAAGAGGAAGTA No data
Right 1004177614 6:13353824-13353846 AGGTGGGTACAGCATATATTAGG No data
1004177604_1004177614 15 Left 1004177604 6:13353786-13353808 CCCTGTGACTTGGTTTCCCCATT No data
Right 1004177614 6:13353824-13353846 AGGTGGGTACAGCATATATTAGG No data
1004177610_1004177614 -3 Left 1004177610 6:13353804-13353826 CCATTCAAGGAAGAGGAAGTAGG No data
Right 1004177614 6:13353824-13353846 AGGTGGGTACAGCATATATTAGG No data
1004177605_1004177614 14 Left 1004177605 6:13353787-13353809 CCTGTGACTTGGTTTCCCCATTC No data
Right 1004177614 6:13353824-13353846 AGGTGGGTACAGCATATATTAGG No data
1004177609_1004177614 -2 Left 1004177609 6:13353803-13353825 CCCATTCAAGGAAGAGGAAGTAG No data
Right 1004177614 6:13353824-13353846 AGGTGGGTACAGCATATATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004177614 Original CRISPR AGGTGGGTACAGCATATATT AGG Intergenic
No off target data available for this crispr