ID: 1004177615

View in Genome Browser
Species Human (GRCh38)
Location 6:13353832-13353854
Sequence ACAGCATATATTAGGTCATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004177608_1004177615 7 Left 1004177608 6:13353802-13353824 CCCCATTCAAGGAAGAGGAAGTA No data
Right 1004177615 6:13353832-13353854 ACAGCATATATTAGGTCATCAGG No data
1004177604_1004177615 23 Left 1004177604 6:13353786-13353808 CCCTGTGACTTGGTTTCCCCATT No data
Right 1004177615 6:13353832-13353854 ACAGCATATATTAGGTCATCAGG No data
1004177605_1004177615 22 Left 1004177605 6:13353787-13353809 CCTGTGACTTGGTTTCCCCATTC No data
Right 1004177615 6:13353832-13353854 ACAGCATATATTAGGTCATCAGG No data
1004177610_1004177615 5 Left 1004177610 6:13353804-13353826 CCATTCAAGGAAGAGGAAGTAGG No data
Right 1004177615 6:13353832-13353854 ACAGCATATATTAGGTCATCAGG No data
1004177609_1004177615 6 Left 1004177609 6:13353803-13353825 CCCATTCAAGGAAGAGGAAGTAG No data
Right 1004177615 6:13353832-13353854 ACAGCATATATTAGGTCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004177615 Original CRISPR ACAGCATATATTAGGTCATC AGG Intergenic
No off target data available for this crispr