ID: 1004177617

View in Genome Browser
Species Human (GRCh38)
Location 6:13353845-13353867
Sequence GGTCATCAGGAAAGCAGGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004177609_1004177617 19 Left 1004177609 6:13353803-13353825 CCCATTCAAGGAAGAGGAAGTAG No data
Right 1004177617 6:13353845-13353867 GGTCATCAGGAAAGCAGGTAAGG No data
1004177608_1004177617 20 Left 1004177608 6:13353802-13353824 CCCCATTCAAGGAAGAGGAAGTA No data
Right 1004177617 6:13353845-13353867 GGTCATCAGGAAAGCAGGTAAGG No data
1004177610_1004177617 18 Left 1004177610 6:13353804-13353826 CCATTCAAGGAAGAGGAAGTAGG No data
Right 1004177617 6:13353845-13353867 GGTCATCAGGAAAGCAGGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004177617 Original CRISPR GGTCATCAGGAAAGCAGGTA AGG Intergenic
No off target data available for this crispr