ID: 1004179096

View in Genome Browser
Species Human (GRCh38)
Location 6:13365461-13365483
Sequence GTGTGTGAGGTGCAGGTGCA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 504
Summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 454}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004179096 Original CRISPR GTGTGTGAGGTGCAGGTGCA CGG (reversed) Exonic
900098890 1:952640-952662 GAGTGGGCGGTGGAGGTGCATGG - Intronic
900768359 1:4520525-4520547 CTGTGTGTGGTGGAGGTGGAAGG - Intergenic
900793484 1:4694055-4694077 GGGTGTGCTGGGCAGGTGCAGGG - Intronic
900908392 1:5576827-5576849 GTTTCTGCGGTGCAGGTGCCTGG - Intergenic
900953653 1:5873765-5873787 GTGTGTGAGGTGTGCCTGCAGGG - Intronic
900953679 1:5873977-5873999 GTATGTGAGGTGTGTGTGCAGGG - Intronic
901037350 1:6344216-6344238 GGATGTGAGGGGCAGGTCCAAGG + Intronic
902402194 1:16164272-16164294 GTGTGTGAGCTCCAGGAGAAGGG + Intergenic
902535121 1:17115287-17115309 GTCTGTGAGGTGGAGGTGGGAGG - Intronic
902679561 1:18033547-18033569 GTGTGTGGGGTGCAGGGGTTGGG + Intergenic
902686001 1:18078087-18078109 GTTTAAGAAGTGCAGGTGCAGGG + Intergenic
902764765 1:18606898-18606920 AGGTGCCAGGTGCAGGTGCACGG - Intergenic
902848704 1:19134829-19134851 GGGTCGGGGGTGCAGGTGCAGGG - Intronic
903039958 1:20522088-20522110 CTTTGTGAGGTGAAGTTGCAGGG + Intergenic
903578184 1:24352093-24352115 GTGTGTGGGGTGCCTGTGAAGGG - Intronic
903668112 1:25020419-25020441 GAGTGTGAGTTCCAGGGGCAGGG - Intergenic
903668543 1:25022332-25022354 GTGGGCGAGGAGCAGGTGCCTGG + Intergenic
903772867 1:25775072-25775094 GTCTGGAAGGTGCAGGTGCCAGG + Intronic
904091130 1:27945792-27945814 GTCTGAGAGGTCCAAGTGCAGGG + Intronic
904703663 1:32374670-32374692 GTGAGTTTGGGGCAGGTGCAGGG - Intronic
905388563 1:37621520-37621542 GGGGGTGAGGGGCAGGGGCAAGG + Intronic
906035519 1:42748177-42748199 GTGAGTGCGGGGCAGGTGCAGGG - Intronic
906082301 1:43101355-43101377 CTGTGGCAGGTCCAGGTGCATGG + Intergenic
907797558 1:57732640-57732662 GTGTGTCAGGTTTAGCTGCAGGG + Intronic
908766043 1:67555476-67555498 GGGGGTGAGGTGCAGGAGCCAGG + Intergenic
911494593 1:98615695-98615717 GTGTGTCAGGTGCAGGGCTAGGG - Intergenic
911522090 1:98941414-98941436 GTGTGTGTTGTGGAGGTGGAAGG + Intronic
912092657 1:106100417-106100439 GTGTTGGAGGGGCAGGGGCAGGG - Intergenic
912212739 1:107572389-107572411 GTGTGTGCGGGGGAGGTGGATGG + Exonic
913308962 1:117466196-117466218 GTGTGTGTGTTGGAGGGGCAGGG - Intronic
913606990 1:120475858-120475880 GTGTGTGAGGGCCAGGAGCCAGG - Intergenic
913988352 1:143585749-143585771 GTGTGTGAGGGCCAGGAGCCAGG + Intergenic
914209443 1:145564286-145564308 GTGTGTGAGGGCCAGGAGCCAGG + Intergenic
914268363 1:146056654-146056676 GTGTGTGAGGGCCAGGAGCCAGG + Intergenic
914368732 1:147004207-147004229 GTGTGTGAGGGCCAGGAGCCAGG - Intergenic
914584202 1:149045980-149046002 GTGTGTGAGGGCCAGGAGCCAGG + Intronic
915567146 1:156721515-156721537 GTGTGTCAGGGGGAGTTGCATGG + Intergenic
915635771 1:157185520-157185542 GTGTGTGGTGAGCAGGTGGAAGG - Intergenic
916051885 1:161042174-161042196 GTGTCTGAGGGGCAGCTGGATGG - Exonic
917587359 1:176441083-176441105 GTGTAAGAGGTGAAGGTACATGG + Intergenic
917796709 1:178538099-178538121 GGGTGTGAGGGGGAGATGCAGGG + Intronic
917979280 1:180259424-180259446 CTGTGTCTGGTGGAGGTGCATGG + Intronic
920360693 1:205414061-205414083 GTGTGAGAGGTGCAGAAACAAGG + Intronic
920670716 1:208002042-208002064 ATGTGTGAGGTCTGGGTGCAAGG - Intergenic
920851082 1:209628103-209628125 GTGTGCAAGGAGCATGTGCAGGG - Exonic
920946398 1:210533214-210533236 GTGGGTGAGATGGAGGTGAATGG + Intronic
921729875 1:218566041-218566063 TTGGGTGAGGTCCAGGTGGAGGG - Intergenic
922213020 1:223500017-223500039 GGGTGTGAGGTGCAGGGCAAAGG + Intergenic
922325807 1:224527156-224527178 GTGTGTGGGGGACAGGTGCTTGG + Intronic
922353567 1:224755822-224755844 GAGTGTGAGCTGCAGGGTCAGGG - Intergenic
922788975 1:228299423-228299445 GTGTGTGAGCTGCAGATTCATGG + Exonic
923704928 1:236336373-236336395 GTGTGGGAGGTGCAGGAGTTGGG + Intergenic
924708933 1:246518766-246518788 GGGTGTGTGGCTCAGGTGCAGGG - Intergenic
1062864959 10:844351-844373 GTGTATGAGGTGGAGGTGTGAGG - Intronic
1063459304 10:6205022-6205044 GTGTGAGACGTGCAGGTTGATGG - Intronic
1064276959 10:13915318-13915340 ATGTGTTAAGTGCTGGTGCATGG + Intronic
1067061358 10:43079575-43079597 CTGTGGGAGGTTGAGGTGCAGGG - Intronic
1067224488 10:44366777-44366799 GCTTTGGAGGTGCAGGTGCAGGG + Intergenic
1067662017 10:48243336-48243358 GGGAGTGAGGTGCTGGTGAAGGG + Intronic
1068629491 10:59284824-59284846 GTGTGTGAGGTGGGTGTGCATGG - Intronic
1070987360 10:80700258-80700280 GTGTGGCAGTTGCAGGTACAGGG + Intergenic
1071589836 10:86862362-86862384 GACTGTGAGCGGCAGGTGCAAGG + Intronic
1071946653 10:90653485-90653507 GTGTGTGAGGGGAAGCTGCAAGG - Intergenic
1072016139 10:91348643-91348665 GTGGGTCAGGAGCAGGGGCATGG + Intergenic
1072331503 10:94358208-94358230 GTGTGTGTGGTACAGGTAAAAGG - Exonic
1072396108 10:95043470-95043492 GTGTGTGCGGTGGTGGAGCAGGG + Intronic
1073440154 10:103547712-103547734 GTGCGTGGGGTGGAGGTGAAGGG + Intronic
1074088729 10:110227293-110227315 GTGTGGGAGGGGCGGGTGCGGGG + Intronic
1074344241 10:112666529-112666551 GTGTGCCAGGTACAGGTGCCAGG - Intronic
1074777055 10:116774502-116774524 GTGTGAGATGTGCAGTTGCTGGG - Intergenic
1076314174 10:129529155-129529177 GAGTGTGAGGGGCAGTGGCAGGG + Intronic
1076693599 10:132236439-132236461 GTGTGTGTGGGGCCCGTGCACGG - Intronic
1076775956 10:132698310-132698332 GTGAGTGTGGGGCAGGGGCACGG + Intronic
1076847502 10:133076453-133076475 GTGAGTGAGGTGCAGGGACAGGG - Intronic
1077006065 11:356822-356844 GTGTGTGGTGTGTATGTGCATGG - Intergenic
1077135487 11:996136-996158 GTCTGTGAGCTGCCGGAGCAGGG + Intronic
1077236481 11:1484330-1484352 GCGTGTGGGGTGCAGGAGAAAGG + Intronic
1077350477 11:2090927-2090949 GTGTGGGAAGACCAGGTGCAAGG - Intergenic
1078356619 11:10636901-10636923 GTGTAGCTGGTGCAGGTGCATGG + Intronic
1079073530 11:17368464-17368486 GTGTGTGGGTGGCATGTGCAGGG + Intronic
1080762576 11:35266301-35266323 GTGTGAGGGAAGCAGGTGCAGGG - Intronic
1081297223 11:41406693-41406715 GTGTGTGTGGTGAATGTGTAGGG - Intronic
1081572641 11:44301265-44301287 GTGTGTGTGCTGCAGGGTCAGGG + Intronic
1081602432 11:44504617-44504639 GTGTATGAGGTGTATGTGTAGGG - Intergenic
1081842283 11:46211413-46211435 TTGTGTGTGGTGGGGGTGCAGGG - Intergenic
1082800788 11:57413547-57413569 GTGTGGGAGAAGCAGGTGCATGG + Intronic
1083052964 11:59793254-59793276 GAGGGGGAGCTGCAGGTGCAGGG + Intronic
1083150654 11:60789965-60789987 GTGCGAGAGGTGCAGGTCAATGG - Intronic
1084322567 11:68381800-68381822 GGTTGGGAGGGGCAGGTGCAGGG - Intronic
1084329586 11:68422830-68422852 GTGGGGGAGGTGAAGGTACAGGG - Intronic
1084469723 11:69351892-69351914 GTGTGTGTGGTGTGTGTGCATGG + Intronic
1085443086 11:76580516-76580538 GTGGGAGAGGTGCAGGGGCCAGG + Intergenic
1085879395 11:80448114-80448136 GTATGTTTGGAGCAGGTGCAAGG - Intergenic
1086079536 11:82889110-82889132 CTTTGTGAGGTACAGGTGGAAGG + Intronic
1090396435 11:126422328-126422350 GTGTGTGTGTAGCAGGAGCAAGG + Intronic
1090806003 11:130202618-130202640 GTGTGAGATGTGCAGGGGCATGG + Intronic
1091411195 12:240677-240699 GTGAGGGAAGTGCAGGAGCAGGG + Intronic
1091667074 12:2426877-2426899 GTGTGAGAGGAGAAGCTGCAAGG + Intronic
1092287501 12:7137216-7137238 ATTTGTGAGGTGCAAGTGCCAGG + Intronic
1092652659 12:10651058-10651080 GTGTGTGAGGTGTGTATGCAGGG + Intronic
1092747226 12:11685030-11685052 GAGTGTGAGGACCAGGTGAAGGG + Intronic
1093643435 12:21554669-21554691 GTGTGTTAGGGAAAGGTGCAAGG + Intronic
1094203326 12:27815469-27815491 GTGGGTGATGTGCAGGTGTAGGG - Intergenic
1094447893 12:30552080-30552102 TCGTGTGAGATGCAGATGCAGGG + Intergenic
1094512806 12:31106308-31106330 GAGAGGGAGGGGCAGGTGCAAGG - Intergenic
1094834651 12:34316609-34316631 GTGTGTGTCGTGCCTGTGCAGGG - Intergenic
1097140208 12:56896283-56896305 GTGTGTGTGGTGCATGTGTGTGG - Intergenic
1097140235 12:56896537-56896559 GTGTGTGTGGTGCATGTGTTGGG - Intergenic
1097185127 12:57192659-57192681 CTGTGGGAGGGCCAGGTGCATGG - Intronic
1097190834 12:57218670-57218692 GTGTGTGAGCTGCAGCTGTGGGG + Intronic
1098159012 12:67630045-67630067 GAGAGAGAGGGGCAGGTGCAAGG + Intergenic
1099198222 12:79645023-79645045 GTGTGTGTGGTGGGGGTGGAGGG - Intronic
1100291967 12:93224233-93224255 GTGTGTGTGTTGCAGGGGCTGGG + Intergenic
1101875671 12:108595647-108595669 GTGTGTGTGGTGTATGTGTATGG - Intronic
1101967648 12:109292055-109292077 CGGGGTGAGGTGCAGGGGCAGGG + Intronic
1102223543 12:111211397-111211419 GCCTGGGAGGTGCAGGTGGAGGG + Intronic
1102435175 12:112917339-112917361 ATCTGTCAGGTGCAAGTGCAAGG + Intronic
1103318677 12:120077408-120077430 GTGTGTGTGGAGCAGCTGCTAGG + Intronic
1103446549 12:120998961-120998983 GAACGGGAGGTGCAGGTGCAGGG - Intronic
1103606865 12:122093298-122093320 GTGTGTGTGGTGTGGGTGCGTGG + Intronic
1103748326 12:123141446-123141468 GTGTTTGAGTTGCTGGTGCCAGG - Intronic
1104624070 12:130338354-130338376 GTGTGGGAGATGCAGGAGCCGGG + Intronic
1104624112 12:130338480-130338502 GTGTGGGAGATGCAGGAGCCGGG + Intronic
1104624139 12:130338564-130338586 GTGTGGGAGATGCAGGAGCCGGG + Intronic
1104624169 12:130338648-130338670 GTGTGGGAGATGCAGGAGCCGGG + Intronic
1104746322 12:131213159-131213181 GTTTTTGAGGTGCAGCCGCATGG - Intergenic
1104954215 12:132456610-132456632 GTCTGTGAGCCTCAGGTGCAGGG - Intergenic
1105752355 13:23433316-23433338 GTGGGTGAGGAGCGGCTGCAGGG - Intronic
1106229043 13:27807753-27807775 GTGTGAGAGTTGCAGTGGCATGG - Intergenic
1106463851 13:29995510-29995532 GTGTGTGAGGGGCAGGAGGTGGG + Intergenic
1107096620 13:36544535-36544557 GTGTGTATGGTGAATGTGCATGG + Intergenic
1107986636 13:45781880-45781902 GGGGGTGAGGTGCAGGAACAGGG + Exonic
1109464130 13:62706227-62706249 TCGTGTGTTGTGCAGGTGCATGG + Intergenic
1110363840 13:74659434-74659456 GAGTGTGAGCTGCACATGCAAGG - Intergenic
1110569049 13:76984970-76984992 TTGTGTGAGGTTCAGGTGGAAGG + Intergenic
1112352705 13:98649980-98650002 GTGTTTGAGATGCAGCGGCAGGG + Intergenic
1112439392 13:99415183-99415205 GTGGGTGGAGTGCATGTGCATGG - Intergenic
1112917755 13:104572206-104572228 GTGTGTGAGAGGCAGGTGCTGGG - Intergenic
1113610242 13:111639526-111639548 GTGTGGGAGGTGCAGGTTGGTGG - Intronic
1114682935 14:24502139-24502161 GTGTGTGAGAAGCAGGTTGATGG - Intronic
1116791961 14:49348723-49348745 GGGTGTGAGGTGCAAGGGGAGGG - Intergenic
1118764254 14:68899516-68899538 GTGTGTGAGGTGTGTGTGTATGG - Intronic
1119636508 14:76277816-76277838 GAGTGTGATGTGCCGGGGCAGGG + Intergenic
1120780444 14:88481477-88481499 GTTTGTGGGGTGCAGAAGCAGGG - Intronic
1121030509 14:90654674-90654696 GTGGGACAGGGGCAGGTGCAAGG + Intronic
1122101207 14:99411397-99411419 GTGTGTGAGGTGCCAATGGATGG + Intronic
1122268620 14:100558348-100558370 GGGTGGGAGGTGCGGGAGCAGGG - Intronic
1122350543 14:101087428-101087450 GTGTGTGTGTTGCAGGGGTAAGG + Intergenic
1122835478 14:104428661-104428683 GGGTGGGAGGGGCAGCTGCAGGG - Intergenic
1122979949 14:105186898-105186920 GTGTGTGGGGTGTATGTGTATGG + Intergenic
1123019555 14:105391287-105391309 GTGGGTGGGCTGCAGGAGCACGG + Intronic
1123055761 14:105568896-105568918 GTGTGTGAGGTGTGGGTGTGGGG - Intergenic
1123080118 14:105688415-105688437 GTGTGTGAGGTGTGGGTGTGGGG - Intergenic
1123080166 14:105688669-105688691 GTGTGTGAGGTGTGGGTGTGGGG - Intergenic
1202902678 14_GL000194v1_random:52503-52525 GTGTGTGAGCAGGAAGTGCAGGG - Intergenic
1202854869 14_GL000225v1_random:43825-43847 GCGTGGCAGGTGCAGATGCACGG + Intergenic
1202884086 14_KI270722v1_random:87848-87870 GTGTGTCAGGTGCAGATGACAGG - Intergenic
1124879807 15:33631496-33631518 TAGTGTGAGGTCCAGGTGGAAGG - Intronic
1127222263 15:56892088-56892110 GTGTGTGAGCTGGTGGTGGAGGG + Intronic
1127671736 15:61201260-61201282 TTGAGTGAGGAGCAGGTTCATGG - Intronic
1127682230 15:61309060-61309082 GTGTGTGGGGTGGAGGGGGAGGG + Intergenic
1127968280 15:63940065-63940087 GTGTGTGAGGGCCAGGCCCATGG - Intronic
1128358341 15:66943679-66943701 GTGTGTCAGGGGCAGGGGCAGGG + Intergenic
1128875757 15:71199895-71199917 GTGTGTGTGGTGCATGTGTGGGG + Intronic
1129270459 15:74416879-74416901 AGGTGTGGGGTGGAGGTGCAGGG - Intronic
1129502108 15:76049182-76049204 GTATGTGTGTTGCAGGTGGAAGG - Intronic
1130908652 15:88256597-88256619 GTGTGTGTTTTGCAGGTGCGTGG - Intronic
1131171990 15:90185171-90185193 GGGCGGGAGGTGCGGGTGCAAGG - Intronic
1131319726 15:91375796-91375818 GTGTGTGGGGTGGGGGGGCAGGG - Intergenic
1131543156 15:93291453-93291475 GTGTACGTGGTGCCGGTGCAGGG + Intergenic
1133287499 16:4697413-4697435 GAGTCTGTGGTGCAGGTGCAGGG + Exonic
1133936578 16:10274367-10274389 GTGTGTGAGATGCTGTTGCTGGG - Intergenic
1134901499 16:17942197-17942219 CTGTGTGAACTGCACGTGCAAGG - Intergenic
1136265596 16:29115710-29115732 GGGTGTGAGGTGAATGTGCGTGG + Intergenic
1137516092 16:49145858-49145880 CTGTGTGAGGAGCATCTGCAAGG - Intergenic
1138059442 16:53874637-53874659 AAGTGAGAGGTACAGGTGCAAGG + Intronic
1138225769 16:55292960-55292982 GTGTGGGAGGTGGAGGTGTGAGG + Intergenic
1139404514 16:66707422-66707444 GTATGTGAAGGGCAGGGGCAGGG + Intergenic
1139827109 16:69766116-69766138 CTGTCTGAGGGGCAGGTGTAGGG - Intronic
1140246139 16:73251809-73251831 GTGTGTGTGGTGTGTGTGCATGG - Intergenic
1140246143 16:73251871-73251893 GTGTGTGTGGTGTGTGTGCATGG - Intergenic
1140249797 16:73286197-73286219 GGGTGTGACGTGCAGGAGGAGGG - Intergenic
1140648208 16:77057309-77057331 GTGTCTGAGTCACAGGTGCAGGG + Intergenic
1140982567 16:80125101-80125123 GTGTGATCTGTGCAGGTGCATGG - Intergenic
1141178172 16:81734372-81734394 GAGTGTGAGGAGCAGGAGGAGGG + Intergenic
1141440374 16:84026017-84026039 GGGGCTGAGGTGCTGGTGCACGG - Intronic
1141558872 16:84853752-84853774 GTGAGTCAGGTGCCGGTCCAAGG + Intronic
1142066925 16:88068020-88068042 GTGTGTGATGAGGAGGTGCTTGG + Intronic
1142395879 16:89831251-89831273 GTCTGTGTGGTCCATGTGCAAGG + Intronic
1143143141 17:4754469-4754491 GTGTGTGTGGGGTAGGGGCAGGG - Intergenic
1143558274 17:7676125-7676147 GTGTAGGAGCTGCTGGTGCAGGG + Exonic
1144623688 17:16833731-16833753 GAGTGTGAGGAGCAGGTGGCTGG - Intergenic
1144882742 17:18438985-18439007 GAGTGTGAGGAGCAGGTGGCTGG + Intergenic
1145149491 17:20505401-20505423 GAGTGTGAGGAGCAGGTGGCTGG - Intergenic
1146457598 17:33019543-33019565 GTGTGTAGCGTGCACGTGCATGG + Intronic
1147262583 17:39217289-39217311 CTGTGTGAGGGGTAGGTGCTGGG - Intronic
1147578022 17:41613663-41613685 GAGTGTGAGGAGCAGGTGGCTGG - Intronic
1147887031 17:43691086-43691108 GTGTGTGAGGGGTGGGGGCAGGG + Intergenic
1148048277 17:44757354-44757376 GGGTGTGTGGTGAGGGTGCATGG + Intergenic
1148228367 17:45915553-45915575 GTGTGTGTGGTGCATGTGTGTGG + Intronic
1148587691 17:48792431-48792453 GTGTGGAAGGAGGAGGTGCAGGG + Intronic
1148674617 17:49438262-49438284 CTTTGTGAGGTGCTGGTGCAGGG + Intronic
1149415877 17:56459535-56459557 TAGTGTGAGGTGCAGTGGCATGG - Intronic
1149458692 17:56810150-56810172 GTGTGTGAGGTGGGGGTGTGAGG - Intronic
1149491065 17:57085469-57085491 GAGCCTGAGGTGCAGGTGCAGGG + Intronic
1150484952 17:65537169-65537191 GGGTGCGGGGAGCAGGTGCATGG - Intronic
1150636324 17:66915706-66915728 GTGTGTGAGGTGGAGGAGTTAGG - Intergenic
1151478511 17:74356696-74356718 GACGATGAGGTGCAGGTGCAGGG + Exonic
1151700476 17:75740159-75740181 GGGTGTGGGGTGCAGGCACAGGG + Intronic
1152076076 17:78160824-78160846 GTTTGGGAGGTCCAGGTGGACGG - Intronic
1152797176 17:82314206-82314228 GTGAGTGAGGGGCAGGTGTGAGG + Intergenic
1152851142 17:82636836-82636858 GTGTGAGACGTGCAGTTTCAGGG - Intronic
1152917776 17:83051064-83051086 GTGTGTGGGGTGCGGGAGCGAGG + Intronic
1153708730 18:7775312-7775334 GGGTGTGAGCTGCAGCTGCAAGG - Intronic
1154165066 18:12008647-12008669 GTGGGTGGGGTGCAGGAGGAAGG + Intronic
1155185528 18:23383626-23383648 GAGTGGGAGGTGCACGGGCAAGG + Intronic
1155875894 18:31088144-31088166 GTTTGAAAGGTTCAGGTGCATGG + Intronic
1156494657 18:37517914-37517936 GTGTGTGTGAGGCAGTTGCATGG + Intronic
1157868970 18:51211952-51211974 GTGTGTGTGTTGGAGGTGAAGGG + Intronic
1158445019 18:57511962-57511984 ATGAGTGAGGTGGAGGAGCAAGG + Intergenic
1158521901 18:58178077-58178099 GTGTGTGAGCTGATGGTCCACGG + Intronic
1158560901 18:58512805-58512827 GTGTGTGAGGTGCATGTATGAGG + Intronic
1160400386 18:78606581-78606603 GTGTGTGTGGTGCATGTGTGGGG - Intergenic
1160613652 18:80108377-80108399 CTAGGTGAGGTTCAGGTGCAGGG + Intergenic
1160719654 19:591594-591616 GTGTGGAGGGTGCAGGTGGAGGG + Intronic
1160821691 19:1062014-1062036 GTGTGGGAGGTAGAGGTGCAGGG - Intronic
1160824714 19:1074305-1074327 GGGTGTGAGGTGCTGGGACAAGG - Intronic
1160960630 19:1719130-1719152 GTGGGTGGGGGGCAGATGCAGGG - Intergenic
1161312446 19:3602405-3602427 GTGTGCGAGATGGAGGTGCCAGG + Intronic
1161352774 19:3803226-3803248 GGGTGTGAGGTGGAGGAGGACGG + Intergenic
1161519479 19:4715733-4715755 ATGTGGGAGGTGCAGGTGAAAGG + Intronic
1161984908 19:7647715-7647737 ATGTGTGAGGAGCCTGTGCAGGG - Exonic
1162056336 19:8066201-8066223 GTGTGAGAGGTTCAGGCCCAAGG + Exonic
1162139495 19:8577355-8577377 GTGATGGAGGTGCAGGTTCAGGG + Exonic
1162528902 19:11224051-11224073 GTGTGTGTGGGGCGGGGGCAGGG + Intronic
1163028869 19:14530186-14530208 GTGAGGGAGGTGCAGCTCCACGG + Intronic
1163815954 19:19464682-19464704 ATGTGTGTGCTGCAGGTACAGGG + Intronic
1164790572 19:30974242-30974264 GTGTGTAAGATGGAGGTGGAGGG - Intergenic
1165323869 19:35102793-35102815 GTGAGTGAGGGGCAGGTGGGAGG - Intergenic
1165417939 19:35706340-35706362 GTAGGTGCGGGGCAGGTGCATGG + Intronic
1165856051 19:38879717-38879739 GTGGGTCAGGGGCAGGAGCAGGG + Intronic
1165971650 19:39636882-39636904 CTGTGTGAGGTACAGGTGATTGG - Intergenic
1166403893 19:42505339-42505361 GTGTGTGGGGTGGAGGGGCAGGG + Intergenic
1168305858 19:55435123-55435145 GTGTGTGTGGTGTATGTGTATGG + Intronic
1168379076 19:55905113-55905135 CTGTGGAAGGTGCAGGTGCAAGG + Intronic
1168655604 19:58125420-58125442 TGGTGAGAGGTGCAGGGGCATGG - Intergenic
1202708880 1_KI270714v1_random:5602-5624 GTGTGTGAGGGCCAGGAGCCAGG - Intergenic
925200030 2:1959671-1959693 GTGTGTGAGGGGCAGAGGGATGG - Intronic
925584068 2:5445209-5445231 GTGTGTGGGGTGTATGTGTATGG + Intergenic
926172091 2:10558853-10558875 GTGTGTGAGGTGCCTGTGGTGGG + Intergenic
926199077 2:10780461-10780483 GTGGGTGCGGTGCATGTGCAGGG - Intronic
927968955 2:27291978-27292000 GTGTGTGAGCTCAGGGTGCAGGG - Intronic
928171336 2:29006087-29006109 GTGTGTGGGGTGCATGTGTGTGG + Intronic
929788660 2:45009040-45009062 GTGTGCGAGGTGCTGCAGCAGGG - Exonic
929932450 2:46269462-46269484 GTGTGTGAGGTGGGGGTGGGTGG - Intergenic
932115397 2:69042267-69042289 GGGTGTGAGGTGTAGGTTGAAGG - Intronic
932212045 2:69939875-69939897 GTGTGCGAGGTGCAGGCGCTGGG - Exonic
932466585 2:71928044-71928066 GTGTTTGAGGTTCAGTTGGAGGG - Intergenic
932475498 2:72003370-72003392 GTGTGTGAGGGGCAGAGGCCAGG + Intergenic
932580207 2:72988458-72988480 GGGTGTGAGGTGCAGTTGTGGGG - Intronic
932620920 2:73264577-73264599 GTGTGTGGGGAGCTGGGGCAGGG + Intronic
932667580 2:73709326-73709348 TTTTGTAAGGTGCTGGTGCAGGG - Intergenic
932713879 2:74087794-74087816 GGGTGTGAGGGGCAGGAGCCAGG - Intronic
933040225 2:77455606-77455628 GTGAGAGAGGTGCAGGAGGAGGG - Intronic
934855532 2:97727088-97727110 GTTTGTGTGGTGGTGGTGCAGGG + Intronic
934946226 2:98543878-98543900 GTGTGTGAGCTGGAGGAGCTGGG + Exonic
937078430 2:119123891-119123913 GTGTATGAGTGGCTGGTGCATGG + Intergenic
937442436 2:121928129-121928151 GTGTGAGTGATGCAGCTGCATGG + Intergenic
937882632 2:126880168-126880190 ATGTGTGTGGGGCATGTGCATGG - Intergenic
938727738 2:134121681-134121703 GTGTGTGGGGTTCGGGTGGATGG + Intronic
939260779 2:139806100-139806122 GTGTGTGTGTTGCAGGGGTAGGG + Intergenic
941065791 2:160901106-160901128 GTGCATGTGGTGCATGTGCAAGG - Intergenic
943585110 2:189729708-189729730 GTGTGTGTGGTGCGGGTGGGGGG + Intronic
944447572 2:199806754-199806776 GTGTGTGGGGTGCAGGGGAGAGG - Intronic
945158646 2:206865403-206865425 ATGTGCAAGGTGCAGGAGCATGG + Intergenic
945259788 2:207832785-207832807 GTGGGGGAGGTGCAGGGGGAGGG - Intronic
947543117 2:230991912-230991934 CTGTGTGACGTGAAGGTGAAGGG + Intergenic
948330116 2:237157896-237157918 GTGAGTGAGGGGCTGGTGAATGG - Intergenic
948515112 2:238498780-238498802 GTGTGGGATGTGCAGGTCCGAGG + Intergenic
948516462 2:238506865-238506887 GTGTGTGAGATGAAGGTCCAGGG + Intergenic
948593708 2:239066569-239066591 GGGGGTGGGGGGCAGGTGCAAGG + Intronic
948793209 2:240389626-240389648 GTGTGTGAGCTGCTGGCCCAGGG + Intergenic
949059484 2:241948868-241948890 GTGTGTGAGGTGGGTGAGCAGGG + Intergenic
1168960018 20:1862542-1862564 TTGTGTGAGAAGCAGGAGCAAGG + Intergenic
1169194503 20:3675909-3675931 GTGTGTGTGGGGCAGGGGTAGGG - Intronic
1169287445 20:4321486-4321508 CTGTGGGGGGTGCAGGTTCATGG + Intergenic
1170356305 20:15495788-15495810 GTCTGTGAGGTAAAGGTACATGG + Intronic
1170934132 20:20795277-20795299 GTGTGTGAGAAGCAGGTTGAGGG + Intergenic
1171240550 20:23564108-23564130 GTATGGGATGTGCAGATGCATGG - Intergenic
1173444550 20:43106004-43106026 GGGGGTGAGGGGCAGGTGCCTGG + Intronic
1174218177 20:48933048-48933070 GTGTCAGAGGTGCTGGTGAATGG + Intronic
1175393914 20:58645583-58645605 TTGTGTGATGTGCAAGTGCAGGG - Intergenic
1175806047 20:61829936-61829958 GTGTGGGAAGTGCAGGTGGGTGG + Intronic
1175833602 20:61980027-61980049 GTTTGTTAGGTACAGGTGCTGGG + Intronic
1176093214 20:63328163-63328185 GTGTGGTAGGCACAGGTGCAGGG - Intronic
1176622042 21:9067270-9067292 GTGTGTGAGCAGGAAGTGCAGGG - Intergenic
1179459837 21:41526867-41526889 GTGTGTGAGATGCACGTGGAAGG + Intronic
1179587535 21:42383265-42383287 GGGAGAGAGGAGCAGGTGCATGG - Intronic
1179628561 21:42662486-42662508 GTGTGTGATGTGCATGTGCATGG - Intronic
1179628574 21:42662698-42662720 GTGTGTGATGTGCGTGTGCATGG - Intronic
1179628585 21:42662843-42662865 GTGTGTGATGTGCATGTGTGTGG - Intronic
1179628588 21:42662908-42662930 GTGTGTGATGTGCATGTGCATGG - Intronic
1179971078 21:44836884-44836906 GTGTGTGTGCTGCAGCTGCCAGG - Intergenic
1180405201 22:12545930-12545952 GTGGGTGCGGTGCAGCAGCATGG + Intergenic
1180964857 22:19782729-19782751 GTGTGTGAGGCTGATGTGCATGG + Intronic
1180988085 22:19917358-19917380 GCTTGTGAGGTCCAGGTGGAGGG + Intronic
1181167354 22:20990955-20990977 GAGTGTGAGCTGCAGGTACAGGG + Intronic
1181172329 22:21016689-21016711 TGGTGTGAGGTGCTGGGGCATGG + Intronic
1181341375 22:22182470-22182492 GTGAGTGAGCTGCAGGATCAGGG - Intergenic
1181804057 22:25364577-25364599 GGTTGGGAGGGGCAGGTGCAGGG + Intronic
1182163727 22:28150736-28150758 GTGTGGGAGGTGCCAGTGCCAGG + Intronic
1183310786 22:37108499-37108521 GGGAGTGAGGAGCAGGTGCCAGG - Intronic
1184412857 22:44335640-44335662 GTGTGTGAGGTGTGAGTGGATGG + Intergenic
1184420459 22:44379902-44379924 GAGTGTGAGGTGCACATGTAGGG + Intergenic
1184777084 22:46628635-46628657 GTGTCTGAGGGGCAGGTGGAGGG + Intronic
1184847914 22:47100384-47100406 GGCTGTGGGGTGCAGGGGCAAGG + Intronic
1184858442 22:47159785-47159807 GTGTATGTGGTGCATGTGTAGGG - Intronic
1185074062 22:48673728-48673750 GGGTGGAAGGTGAAGGTGCATGG + Intronic
1185285424 22:49997777-49997799 GTGTGTGTGAGGCAGGGGCAGGG + Intronic
1185384273 22:50524665-50524687 CTTGCTGAGGTGCAGGTGCAGGG - Intronic
1185403174 22:50628854-50628876 GTGTGTGTGGTTGAGGTGTATGG + Intergenic
949589017 3:5473955-5473977 GTTTCTCAGGTGCATGTGCATGG + Intergenic
949853883 3:8442390-8442412 GTGTTTGAGATGCAGGCGCCAGG - Intergenic
950542095 3:13618813-13618835 GTGTGAGAAGGGCAGGTGCCTGG + Intronic
950726735 3:14921805-14921827 GTGTGAGAGGTGCAGGCTCAAGG + Intronic
952765983 3:36954814-36954836 GTGTGTGTGTTGCAGCTGCATGG - Intergenic
953317442 3:41942034-41942056 GTGGTTGAGGTGAAGGTGGAGGG - Intronic
953794719 3:45975828-45975850 GTGCGTGGGGAACAGGTGCAGGG + Intronic
954326001 3:49864371-49864393 GGCTGTCAGGTCCAGGTGCAAGG + Intronic
954448969 3:50561533-50561555 GTGTGTGAGATCCTTGTGCAAGG + Intronic
955837639 3:63074557-63074579 GTGTGGTAGGTACTGGTGCAAGG - Intergenic
957635117 3:82773450-82773472 GTCTGGGAAGTGCAAGTGCATGG - Intergenic
959412640 3:106044571-106044593 GTGTATGAGCTGAAGCTGCAAGG + Intergenic
961456058 3:127024530-127024552 GTGGGAGTGGTGCAGGTACAAGG + Intronic
961828007 3:129608551-129608573 GTGAGTGAGGAGGAGGGGCATGG - Intergenic
962218964 3:133547258-133547280 GTGTGTGTGGTGTAGGAGCAGGG - Intergenic
962325826 3:134431331-134431353 ATCTGGAAGGTGCAGGTGCAAGG + Intergenic
962602107 3:137000265-137000287 CTGTGTGAGGTACAGGTGTGGGG - Intronic
962939453 3:140112519-140112541 GTGTATAATGTCCAGGTGCACGG - Intronic
963124677 3:141804173-141804195 GTGTGCAAGCTGAAGGTGCAAGG - Intronic
966290781 3:178355561-178355583 GTGTGTGAGGTGGAGTTGAAGGG - Intergenic
966373122 3:179268887-179268909 CAGTGTGAGTTGCAGGAGCATGG + Intergenic
966912562 3:184567505-184567527 GTGTGTGTGTTGCGGGTGCATGG + Intronic
966940891 3:184746378-184746400 CTGAGTCAGGTGCAGCTGCAGGG + Intergenic
968194453 3:196695063-196695085 GTGTGTGGGGTGTGGGTGTATGG - Intronic
968487678 4:871694-871716 GTGGGTGGGGAGCAGGGGCAGGG + Intronic
968667817 4:1830754-1830776 CTGTTTGAGGCCCAGGTGCAGGG + Intronic
968897808 4:3414927-3414949 GTGTGTGAGGGGCATGTGAGGGG + Intronic
969215765 4:5721067-5721089 GTACGTGAGCTTCAGGTGCATGG + Intronic
969266415 4:6066895-6066917 GTGTGTGGGGTGCAGAAGCCTGG - Intronic
969268849 4:6085238-6085260 CTGTGTGAGGTGCCGGTGCGTGG - Intronic
969853191 4:9978022-9978044 GTGGGAGAGGCACAGGTGCACGG + Intronic
969959481 4:10929390-10929412 GTGTGGGTGGTGCAAGGGCAGGG + Intergenic
971114655 4:23630749-23630771 GTGTGTGTGGTGGTGGTGGACGG - Intergenic
971369291 4:26003007-26003029 CTGTGAGAGGTGGTGGTGCAGGG - Intergenic
974798234 4:66781000-66781022 GTGAGTGAGTTGGAGGTGAATGG - Intergenic
975847144 4:78536673-78536695 GTGTGTGAGATGCAGTTGAGAGG - Intronic
976497753 4:85750026-85750048 GTACGTGAGGGGCAGGTGGATGG - Intronic
977928931 4:102730932-102730954 GTGTGAGATGTGCAGTTTCAGGG - Intronic
980156226 4:129110378-129110400 ATGTGAGAGCTACAGGTGCAAGG - Intronic
980739323 4:136929366-136929388 GGCTGAGGGGTGCAGGTGCATGG + Intergenic
981617018 4:146652898-146652920 GGGTGTGAGGTGCAGGTCAAGGG + Intergenic
984303246 4:177951622-177951644 GTGTGTGAGTGGCAGGTGTTGGG - Intronic
984469915 4:180155260-180155282 GGGTGTGTTGTGCAGGTGAAGGG + Intergenic
984521678 4:180809784-180809806 ATGTGTGTGGTGGGGGTGCAGGG - Intergenic
984704376 4:182837017-182837039 GCGTGTCAGGAGCAGGAGCATGG - Intergenic
985171165 4:187151885-187151907 GTATGTGAGGTGCAGTTTCAGGG + Intergenic
985511834 5:317899-317921 CAGGGTGAGGGGCAGGTGCAAGG - Intronic
985672039 5:1211838-1211860 GTGTGGGGTGTGCAGGTGCATGG + Intronic
985672048 5:1212059-1212081 GTGTGGGGTGTGCAGGTGCATGG + Intronic
986448563 5:7844798-7844820 GTGTGTGTGGTAAAGGTGCTTGG + Intronic
986806143 5:11310745-11310767 GTGTGTGAGGTGAGAGTGCTTGG - Intronic
986806159 5:11310872-11310894 GCGTGTGAGGTGAGGGTGCATGG - Intronic
986806177 5:11310993-11311015 GTGTGTGGGGTGAGGGTGCATGG - Intronic
986806194 5:11311107-11311129 GCATGTGAGGTGAGGGTGCATGG - Intronic
986806219 5:11311269-11311291 GCATGTGAGGTGAGGGTGCATGG - Intronic
986806239 5:11311386-11311408 GCATGTGAGGTGAGGGTGCATGG - Intronic
986806289 5:11311694-11311716 GAGTGTGTGGTGAGGGTGCATGG - Intronic
986806295 5:11311718-11311740 GCATGTGAGGTGAGGGTGCATGG - Intronic
986806301 5:11311764-11311786 GTGTGTGAGGTGAGGGTGCATGG - Intronic
986806314 5:11311840-11311862 GTGTGTGGGGTGAGGGTGTATGG - Intronic
986806350 5:11312014-11312036 GTGTGTGGGGTGAAGGTGTATGG - Intronic
988643838 5:33071973-33071995 GTGTTTGGGGTGGGGGTGCAAGG + Intergenic
989537542 5:42581930-42581952 GGGTGCTGGGTGCAGGTGCAGGG - Intronic
990381095 5:55222628-55222650 CTGTGTGACGTGCAGGCCCAGGG - Intronic
992947956 5:81828071-81828093 GTGTTGGAGGTGGAGCTGCATGG + Intergenic
994153571 5:96476830-96476852 GACTGTGAAGTGCATGTGCAGGG - Intergenic
994604944 5:101955144-101955166 GAGTGTGTGGTTCAGGTGTATGG - Intergenic
995591061 5:113699941-113699963 CTGTGGGAGAAGCAGGTGCAGGG - Intergenic
997375813 5:133396518-133396540 ATGTGTGAGATCCAGCTGCAGGG - Intronic
999195359 5:149778048-149778070 GTGTGTGAGATGCTGCTACATGG - Intronic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
999532914 5:152482004-152482026 GTGTGTGTGGGGCAGGGGAAGGG - Intergenic
999679088 5:154038806-154038828 GGGTGCGAGGTTCAGGGGCAGGG - Intronic
1003991501 6:11491172-11491194 GTGTGTGATGTGTATGTGTATGG + Intergenic
1004169244 6:13283278-13283300 GTGAGTGAGGGGCAGGGGCAGGG - Intronic
1004179096 6:13365461-13365483 GTGTGTGAGGTGCAGGTGCACGG - Exonic
1005243601 6:23856973-23856995 GTTTGTGAGATGCTGGTGTAAGG + Intergenic
1007204243 6:40135606-40135628 GTATGCTAGGTGGAGGTGCATGG + Intergenic
1008661180 6:53669865-53669887 GTGTGAATGGTGCAGGTGTATGG + Intergenic
1011211754 6:84963150-84963172 GTGTGAGATGTGCAGTTTCAGGG + Intergenic
1011212418 6:84968387-84968409 GTGTGAGATGTGCAGTTTCAGGG + Intergenic
1011344161 6:86350730-86350752 GTGTGTGTGGTGCGGGTGGTGGG - Intergenic
1011772689 6:90692357-90692379 GTGTTTGTGGTTCAGGGGCAAGG + Intergenic
1012375565 6:98557935-98557957 GTGTGAGAGGTGCAGGCCCCGGG + Intergenic
1012551873 6:100470414-100470436 GTGTGTGTGATGTTGGTGCAGGG + Intergenic
1013630292 6:111979912-111979934 GTGTGTGAGGAGGAGGGACATGG + Intergenic
1013759762 6:113503578-113503600 GTGTGTGAGTTGAAGGGGGAGGG + Intergenic
1014443669 6:121501906-121501928 GTGTGTGTGGTGGGGGGGCATGG + Intergenic
1016363727 6:143293921-143293943 GAGAGTGAGGTGGAGGTGGAGGG - Intronic
1016735694 6:147477561-147477583 GTGTGTGAGGTGGTGGGGCTAGG + Intergenic
1016862947 6:148739729-148739751 GTGTGGGAGGTGGAGGTGGGTGG - Intergenic
1017301619 6:152867593-152867615 GTATGTGAGGTGAGGGTGGATGG - Intergenic
1017433886 6:154397631-154397653 GTGTGTGAGATGCATGCACAGGG + Exonic
1017643011 6:156512649-156512671 GTGTGTGAGCTGCAGGAATAAGG - Intergenic
1017931792 6:158961827-158961849 GTGTGTGTTGTGGAGGTGGAGGG + Intergenic
1018619426 6:165715659-165715681 GTGTGTGAGGGGCTAGTGCATGG + Intronic
1018690441 6:166339983-166340005 CTGTGGGAGGAGCAGGTTCAGGG - Intronic
1019449943 7:1092312-1092334 GTCGGTGTGCTGCAGGTGCACGG - Exonic
1019487290 7:1295233-1295255 GTGTGTGTGGTGTGGGTGCAGGG + Intergenic
1019487356 7:1295543-1295565 GTGTGTGTGGTGTGGGTGCAGGG + Intergenic
1019704210 7:2489856-2489878 GTGTGAGAGGTGCTGGCACAAGG + Intergenic
1020214514 7:6179623-6179645 GTGTGTGAGGTGTATGTGGGGGG - Intronic
1021568297 7:22036656-22036678 GTGTGTGTGGTGGAGGGTCAGGG - Intergenic
1022493647 7:30839562-30839584 CTGTGAGTGGTGCAGGTGCTGGG + Intronic
1022532810 7:31077450-31077472 GTGTGTGTGGTGCATGTGTGTGG + Intronic
1024324957 7:48102222-48102244 GTGTGAGGGTGGCAGGTGCAGGG + Intronic
1025222250 7:57123229-57123251 GAGTGTGAGGTGGAGGAGCCAGG + Intronic
1025266740 7:57466511-57466533 GAGTGTGAGGTGGAGGAGCCAGG - Intronic
1025633033 7:63294910-63294932 GAGTGTGAGGTGGAGGAGCCAGG + Intergenic
1025649664 7:63453273-63453295 GAGTGTGAGGTGCAGGAGCCAGG - Intergenic
1025743119 7:64217206-64217228 GAGTGTGAGGTGGAGGAGCCAGG - Intronic
1026939094 7:74276675-74276697 GTGGGGGAGGTGCACGTGTATGG - Intergenic
1029405342 7:100371597-100371619 GTGTGTGGGGAGCAGGGGCAGGG - Intronic
1030007520 7:105133582-105133604 GGGTGTGAGGTGTCGGTGCCAGG - Intronic
1030901538 7:115130833-115130855 GTATGTGAGGTGCAGAAGCTAGG + Intergenic
1032723674 7:134571323-134571345 GTGTGTGAGGTTAATGTCCATGG + Intronic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1033047638 7:137977107-137977129 TGGTGGGAGGTGCAGGGGCAGGG - Intronic
1033454795 7:141492973-141492995 GTGTGTGTGTTGCAGTTGTAGGG + Intergenic
1034221086 7:149446792-149446814 GTGGGTGAGGAGCAGGTGGGAGG - Intronic
1035601778 8:901491-901513 GAGTGTGAGGGGCAGAGGCAGGG + Intergenic
1035662368 8:1357877-1357899 GTCAGTTAGATGCAGGTGCAGGG - Intergenic
1037186032 8:16064711-16064733 GTCTGTATGGGGCAGGTGCAGGG + Intergenic
1037805567 8:22056427-22056449 GGGTAGGAGGTGCAGGTGCCTGG + Intronic
1037884004 8:22586792-22586814 GTGTGGGAGGTACAGAGGCATGG + Intronic
1039647788 8:39306089-39306111 GTGTGTGAGCTGTGGGAGCATGG - Intergenic
1039690024 8:39852878-39852900 GTGTGAGACGTGCAGTTTCAGGG + Intergenic
1040661800 8:49583089-49583111 GGGAGAGAGGTGCAGGTGTAAGG + Intergenic
1040677543 8:49768465-49768487 GTGTGTGAGGTGTATGTGTGTGG - Intergenic
1041617716 8:59927736-59927758 GTGTATGGGGTGCAGGTGGCGGG + Intergenic
1042328815 8:67556470-67556492 GTGTGTGACCTGCAGGTACTTGG + Intronic
1042656389 8:71102384-71102406 GTGTCTGAGGAGCGGGGGCAGGG + Intergenic
1043058389 8:75469110-75469132 AGGTCTGAGGTGCAGGTGGAAGG + Intronic
1043192813 8:77248186-77248208 GTGTGTGTGGTGTGTGTGCATGG - Intergenic
1043375226 8:79641589-79641611 GTGTGTGAGAGGGAGGAGCAGGG - Intronic
1047523590 8:125614514-125614536 GTGTGTGAGGGTCAGGTGTGAGG + Intergenic
1047955556 8:129972746-129972768 GTGTGTGGTGTGCATGTGCGTGG - Intronic
1048293058 8:133195095-133195117 GTGTGCGTGGTGCTTGTGCATGG + Intronic
1048294366 8:133203359-133203381 GTGTGTGATGGGCGGGTGGAGGG + Intronic
1049171811 8:141166252-141166274 GTGGGTGACATGCAGGTGCGAGG - Exonic
1049214663 8:141402176-141402198 GTGTGGGTGGAGCAGGTGAAGGG + Intronic
1049448248 8:142641519-142641541 GGGTCTGATGTGCAGCTGCAGGG - Intergenic
1049790112 8:144468542-144468564 GTGCAGGAGGTGCAGCTGCAGGG + Exonic
1050359928 9:4820237-4820259 GTGTGGGAGGTGAATGGGCAAGG + Intronic
1052522833 9:29571648-29571670 GTGTGTTTTGTGCAGATGCATGG + Intergenic
1054753830 9:68936799-68936821 GTGTGGGAGATGCCAGTGCAGGG - Intronic
1054810932 9:69433302-69433324 GTGTGTGAGGTAAGGGTGGAGGG - Intronic
1054825801 9:69572395-69572417 GTGAGGGAGATGCAGGGGCATGG - Intronic
1054852592 9:69864000-69864022 CTGTGTGAGAAGCAGGTCCATGG + Intronic
1055788639 9:79898211-79898233 TGGTGGGAGGTGCAGGTGGATGG - Intergenic
1056714781 9:89020292-89020314 GGGTGAGAGGTGAAGGTGGAGGG + Intronic
1057022613 9:91711929-91711951 GTGTGTGTGGTGTATGTGTATGG + Intronic
1057022626 9:91712034-91712056 GTGTGTGTGGTGTATGTGTATGG + Intronic
1057631162 9:96720013-96720035 GCGTGTCAGGGGCAGGTGCTTGG + Intergenic
1057850405 9:98562589-98562611 GTGTGTGTGGGGGTGGTGCAGGG + Intronic
1057945884 9:99327716-99327738 GTGTGTGTGGTGCAAGACCAGGG + Intergenic
1059868043 9:118538592-118538614 ATGTATGACGTGCAGGTGGAGGG - Intergenic
1060238626 9:121884505-121884527 GTGTGGGAGGTGGTGGTCCAGGG + Intronic
1060296351 9:122346175-122346197 GTATGTGAGGTGCTTATGCATGG + Intergenic
1060376547 9:123119640-123119662 GTGTTGGAGAGGCAGGTGCATGG - Intronic
1061372983 9:130208214-130208236 GTGTGTGAGGTGGGGGTGGGGGG + Intronic
1061855137 9:133437876-133437898 GTGTGTGTCGGGCAGCTGCAGGG + Exonic
1061944668 9:133901942-133901964 GTGTGGTAGGAGGAGGTGCATGG - Intronic
1062511148 9:136906926-136906948 CTGTGAGAGGTGCAGCTGCCAGG + Intronic
1062644921 9:137543024-137543046 GTGTGTGTGGCTCAGGTTCACGG - Intronic
1185700387 X:2227088-2227110 CTGGCTGGGGTGCAGGTGCAGGG - Intronic
1186112089 X:6269200-6269222 GTGTGTGAGGGGAAGGTGAGCGG - Intergenic
1187280972 X:17858596-17858618 GTGTGTGAGGAGCTGTTGCTGGG - Intronic
1188243352 X:27814193-27814215 GGGTGTGAGGGGCAGGGGGAGGG - Intronic
1189252335 X:39611038-39611060 GTGTGGGACGGGCAGGTGGAAGG + Intergenic
1189307299 X:39996510-39996532 GTTTGTGAGATGGAGGTGGATGG - Intergenic
1192244570 X:69361832-69361854 GGGTGTGAGGAGCAGGGGAAGGG + Intergenic
1199973798 X:152879618-152879640 GGGCGTGAGGAGGAGGTGCAGGG + Intergenic
1199976742 X:152898688-152898710 GCCTGTGAGGTGCATGTGCTGGG + Intergenic
1200044046 X:153391151-153391173 GTGTGTGTGGTGTGTGTGCATGG - Intergenic
1200044081 X:153391510-153391532 GTGTGTGTGGTGTGTGTGCATGG - Intergenic
1200044084 X:153391541-153391563 GTGTGTGTGGTGTGTGTGCATGG - Intergenic
1200044114 X:153391870-153391892 GTGTGTGTGGTGTGTGTGCATGG - Intergenic
1200235300 X:154465132-154465154 GAGTGCGTGGTGCGGGTGCAGGG + Exonic
1200258820 X:154600731-154600753 GTGTGTGTGGTGGCGGGGCAAGG + Intergenic
1200785640 Y:7258072-7258094 GTGTGAGAAGTGCAGTTTCAGGG + Intergenic
1201158563 Y:11152727-11152749 GTGTGTGAGCAGGAAGTGCAGGG - Intergenic
1201612876 Y:15862517-15862539 GTTTGTCTGGTGCAGGTACAGGG + Intergenic