ID: 1004181393

View in Genome Browser
Species Human (GRCh38)
Location 6:13383461-13383483
Sequence AAACTCAGCTTCACAGAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 1, 2: 6, 3: 56, 4: 333}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004181393_1004181396 26 Left 1004181393 6:13383461-13383483 CCTATCTCTGTGAAGCTGAGTTT 0: 1
1: 1
2: 6
3: 56
4: 333
Right 1004181396 6:13383510-13383532 CATACACTAGGAAAAAATCAAGG 0: 1
1: 0
2: 0
3: 15
4: 327
1004181393_1004181395 14 Left 1004181393 6:13383461-13383483 CCTATCTCTGTGAAGCTGAGTTT 0: 1
1: 1
2: 6
3: 56
4: 333
Right 1004181395 6:13383498-13383520 GATTAGAACAAACATACACTAGG 0: 1
1: 0
2: 3
3: 16
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004181393 Original CRISPR AAACTCAGCTTCACAGAGAT AGG (reversed) Intronic
902154190 1:14470639-14470661 AAACTCTGCTCAACAGAGAAAGG - Intergenic
902365991 1:15974910-15974932 AAACTCATCTTCGTAGAGAGAGG - Intronic
902450515 1:16493989-16494011 AAACTGAGGCTCAGAGAGATTGG + Intergenic
902642643 1:17776542-17776564 AGACTCAGCTTCACAGAGAGGGG - Intronic
903386814 1:22932416-22932438 AAACTGAGGCTCACAGAGATGGG + Intergenic
903521149 1:23950902-23950924 AAACTGAGATTCAAAGAGGTAGG - Intergenic
904344475 1:29859092-29859114 AAACTGGGATTCACAGAGGTTGG + Intergenic
904966767 1:34380232-34380254 AAACTCAGCATCTCAGACAGTGG - Intergenic
905250815 1:36647176-36647198 AAACTCCCCTTCCCAGAGTTCGG + Intergenic
905305938 1:37018193-37018215 AAACTCATCGTCTCAGTGATTGG + Intronic
908255267 1:62298104-62298126 AAAATCAGAATCACAGGGATAGG + Intronic
909122292 1:71618456-71618478 AAACCCTGCTTCACAAAGACAGG - Intronic
910533639 1:88270695-88270717 AAACTAAGCTTCTAGGAGATCGG - Intergenic
911191045 1:94948838-94948860 AAAATTAGCTTCACAGACACTGG + Intergenic
911792356 1:102033614-102033636 AAACCCTGCTTCACAAAGATAGG - Intergenic
913477082 1:119248184-119248206 CAATTCAGCATCACTGAGATGGG + Intergenic
915625643 1:157112545-157112567 ATACCCACCTTCTCAGAGATAGG - Intergenic
916504145 1:165412546-165412568 AATCTCTGCTTCACAGATAAGGG - Intronic
917274420 1:173316972-173316994 TATCCCAGATTCACAGAGATGGG - Intergenic
917469653 1:175315567-175315589 AAACTCAAATTCAAAGGGATTGG + Exonic
918017006 1:180644998-180645020 AAAACCTGCTTCACAAAGATAGG + Intronic
918750947 1:188268590-188268612 AAACCCTGCTTCACAAAAATAGG + Intergenic
919091322 1:192981557-192981579 AAACCCTGCTTCACAAAGATAGG - Intergenic
920924872 1:210331342-210331364 AGACCCTGCTTCACAAAGATAGG + Intronic
922671797 1:227514180-227514202 AAACCCTGCTTCACAAAGACAGG + Intergenic
922957087 1:229612056-229612078 ACACTTAGCTTCTCAGAGCTAGG + Intronic
923190614 1:231616835-231616857 ATCCTCAGCTTCAGAGAGGTTGG + Intronic
924569487 1:245225384-245225406 AGACTTAGATACACAGAGATTGG - Intronic
1063594393 10:7420640-7420662 AAACCCTGCTTCCCAAAGATAGG - Intergenic
1063684311 10:8221861-8221883 AATCTCAGCTTCTCAGCGATGGG - Intergenic
1064844744 10:19639235-19639257 AGACTCAGCTGTACACAGATGGG + Intronic
1065676301 10:28178059-28178081 AAACTCTGCTTCAGAGGGAAAGG - Intronic
1066225330 10:33377163-33377185 AAGCTCAGCTTCAAAGGGACTGG + Intergenic
1066608259 10:37205661-37205683 AAACACAGCTTCACATAGTCAGG - Intronic
1067288664 10:44925609-44925631 AAACTGAGACTCAGAGAGATTGG + Intronic
1068163331 10:53296745-53296767 AGACCCTGCTTCACAAAGATAGG + Intergenic
1070615233 10:77964555-77964577 AAACCCTGCTTCACAAGGATAGG - Intergenic
1071218546 10:83435516-83435538 CATCACAGCTTCACAGTGATTGG + Intergenic
1071269355 10:83992403-83992425 AAACACAGCAGCACAGAGATGGG + Intergenic
1071845902 10:89520810-89520832 GATCTCAGCTTAACTGAGATTGG + Intronic
1074745031 10:116523959-116523981 AAACTGAGGTTTAGAGAGATAGG + Intergenic
1075413292 10:122244695-122244717 AAACTCAGGCCCAGAGAGATTGG + Intronic
1078440926 11:11367103-11367125 TAACTCAGCTACACAGGGAGAGG + Intronic
1078826109 11:14931718-14931740 AAATCCTGCTTCACAAAGATAGG + Intronic
1079318386 11:19429486-19429508 AAACTGAGGTTCAGAGAGACTGG - Intronic
1079567628 11:21902136-21902158 AATTTCAGCTTCCCAGAGGTGGG + Intergenic
1079570121 11:21932646-21932668 AAACCCTGCTTCACAAAGATAGG - Intergenic
1080206791 11:29738625-29738647 AGTCTCAGCTACTCAGAGATGGG - Intergenic
1080468760 11:32524945-32524967 AAACTAAGGTTCAGAGAGTTGGG + Intergenic
1080665270 11:34330332-34330354 AAACTGAGGGTCAGAGAGATTGG - Intronic
1080786954 11:35484243-35484265 AAACTGAGATTCACAAAGATTGG + Intronic
1080897546 11:36459065-36459087 AAACACAGCTTCAAAGGGCTGGG - Intronic
1081088542 11:38831847-38831869 AAGGTCACCTTCACAGAAATTGG - Intergenic
1081665096 11:44911974-44911996 AAAGGGAGCTACACAGAGATAGG - Intronic
1082788838 11:57333217-57333239 AAACTGAGTTCCACAGAGACAGG + Intronic
1083083813 11:60121921-60121943 AAACCCTGCTTCATAAAGATAGG - Intergenic
1086896673 11:92321029-92321051 AAACTCAAATTCCTAGAGATAGG + Intergenic
1087335339 11:96837077-96837099 AAACTGAAGTTCACAGAGATTGG - Intergenic
1087588012 11:100147218-100147240 TAAGCCAGCTGCACAGAGATGGG - Intronic
1089100303 11:115957552-115957574 AAACTGAGGTCCACAGGGATGGG + Intergenic
1090142509 11:124279402-124279424 AAACTAAGCTTCATAGATAAAGG + Intergenic
1090158035 11:124462507-124462529 AAACTAATATTTACAGAGATTGG + Intergenic
1090364069 11:126191699-126191721 AAATTCAGCATCTCAGAGAAGGG - Intergenic
1091352492 11:134908210-134908232 AAACTGAGGCTCAGAGAGATTGG - Intergenic
1093163358 12:15776035-15776057 AAACTCACCTTCACATACAAAGG + Intronic
1094257637 12:28451868-28451890 AAACCCAGTCTCACACAGATAGG - Intronic
1095365754 12:41403117-41403139 AAACCCAGCTTCATAGCAATAGG + Intronic
1098287852 12:68926521-68926543 AAAAGCAGCTTGACACAGATGGG - Intronic
1098997000 12:77132441-77132463 AAACTCATCAACACAGCGATTGG - Intergenic
1099744776 12:86688591-86688613 AAACTCAGCTTCAAACACAAAGG - Intronic
1100008977 12:89930143-89930165 AAACTCAGCCACAAAGACATCGG - Intergenic
1100198351 12:92272502-92272524 CAGGTCAGCTTCCCAGAGATGGG - Intergenic
1100364727 12:93909535-93909557 AAACTGAGGTTCAGAGAGAGAGG - Intergenic
1102286846 12:111664676-111664698 AATATCAGCTTCACAGAGCGGGG - Intronic
1104669736 12:130672375-130672397 AAACACCGCTTCACAGCGGTAGG + Intronic
1106623352 13:31393034-31393056 ACACTTTGCTTCACAAAGATAGG + Intergenic
1106630277 13:31464981-31465003 AACCTCAACTTCATAGAGAATGG + Intergenic
1106869093 13:33999641-33999663 AAACTCAAATTCAGAGAGGTTGG + Intergenic
1107624624 13:42270691-42270713 AAAAGCAGCTTAACAGAGACAGG - Intergenic
1111158190 13:84356234-84356256 AAACTCTACCTCACTGAGATAGG + Intergenic
1111258668 13:85706283-85706305 TTACTCTGCTTCACAGAGGTAGG - Intergenic
1112028563 13:95436115-95436137 AAACACATCATCACAGAGTTAGG + Intronic
1112735561 13:102412658-102412680 AGACTCAGATTCACAAAGAATGG + Intergenic
1112865565 13:103892365-103892387 AAACCCAGTTTCACAAAGACAGG - Intergenic
1112897375 13:104316437-104316459 AACCTTAGCTTTACAGAGATAGG + Intergenic
1113245002 13:108385615-108385637 AAAGTCACCTTCGCAAAGATGGG - Intergenic
1113362533 13:109644688-109644710 AACCTCAGCCTCCCAGAGTTGGG - Intergenic
1113401436 13:109997657-109997679 AAACCCTGCTTCAGAAAGATAGG - Intergenic
1114661394 14:24347450-24347472 AATCTAACCTTCTCAGAGATGGG + Intergenic
1114756658 14:25267723-25267745 AAACTAAGCTTCACAAATAAAGG - Intergenic
1116140382 14:40985936-40985958 AAACCCTGCTTCACAAAAATGGG + Intergenic
1117078174 14:52125120-52125142 ACACTCAGCTTTACTGAGACTGG - Intergenic
1117411214 14:55452993-55453015 AAACTGAGTTGCACAGAGAATGG - Intronic
1117564580 14:56979891-56979913 AAACAAAGCTTCAGAGAGACAGG - Intergenic
1118526620 14:66651729-66651751 AAACCCTGCTTCACAAAGACAGG - Intronic
1119567570 14:75641537-75641559 AAACTGAGGTTCCCAGAGGTTGG - Intronic
1120043396 14:79778959-79778981 AGACTGAGGTTCACAGAGCTTGG - Intronic
1120149826 14:81020889-81020911 AAACCCTGCTTCACAAAGATAGG - Intronic
1121426541 14:93856333-93856355 ACACTCAGCTTTACAGAGGCAGG + Intergenic
1124440275 15:29680753-29680775 AAACTCTGCTTCACAAACACAGG + Intergenic
1124551638 15:30686317-30686339 AAACTCAGCTGCAGAGAGGCTGG - Intronic
1124679610 15:31719347-31719369 AAACTCAGCTGCAGAGAGGCTGG + Intronic
1125005403 15:34811162-34811184 CCACTCAGTTTCACAGAGAGGGG + Intergenic
1125095959 15:35851748-35851770 AAATACAGTTTCACAGTGATGGG + Intergenic
1127880346 15:63151816-63151838 AAACCCAGCTTCACAAGGATAGG - Exonic
1127930140 15:63590326-63590348 AAACTAAGCTTAACAAAGAAGGG - Intronic
1128851813 15:70966416-70966438 AAATTCAGCTTTTCAAAGATAGG - Intronic
1129153989 15:73706322-73706344 AAACTGAGGTCCACAGAGAAGGG + Intronic
1131631752 15:94184559-94184581 AAACCCTGCTTCACAAAGACAGG + Intergenic
1131844056 15:96470208-96470230 CAACTCAACATCACAGAGCTAGG + Intergenic
1131965216 15:97834944-97834966 AACCTCAGCTTCTCTGAGAAGGG + Intergenic
1132738764 16:1400480-1400502 ATACACAAATTCACAGAGATGGG + Intronic
1134248449 16:12557311-12557333 AAAGTCACCTTCAGAGAGATGGG + Intronic
1134747014 16:16596214-16596236 AAACTTAGATTCAAAGAGAAGGG - Intergenic
1135873959 16:26179765-26179787 AAAGTTAGCATCACAGATATTGG + Intergenic
1136931807 16:34424627-34424649 AAACTGAGCTTCATAGACAAAGG - Intergenic
1136972765 16:34987188-34987210 AAACTGAGCTTCATAGACAAAGG + Intergenic
1137794150 16:51200828-51200850 AAACTCAGAGTGACACAGATTGG - Intergenic
1137873125 16:51970050-51970072 CAACTCAGCTGCACAGAGAGGGG + Intergenic
1138425540 16:56929768-56929790 AAACCCTGCTTCACAGAGATGGG + Intergenic
1138487651 16:57357135-57357157 AAACTGAGGTTCAGAGAGAGAGG - Intergenic
1139112367 16:63906214-63906236 AAAATCAGGTTCACAAATATTGG + Intergenic
1140179967 16:72705802-72705824 AAAGTCAGCCTCAGTGAGATGGG + Intergenic
1140601045 16:76475264-76475286 AAACTCTGCTCCCCAAAGATAGG + Intronic
1140836395 16:78798078-78798100 AAGCTGAGGTTCAGAGAGATGGG + Intronic
1142267611 16:89071726-89071748 AAACTCAGCTTCAGTGAGGCCGG + Intergenic
1144374699 17:14627541-14627563 AAACTCATCATCTCAGTGATTGG - Intergenic
1145975738 17:28983171-28983193 AAACTGAGCTTCAGAGAGTTTGG - Intronic
1147644512 17:42025840-42025862 ACACTCAGCTTCACAGTGGCAGG + Intronic
1148842244 17:50506491-50506513 AAACTGAGCTCCAGAGAGAAGGG - Intergenic
1149192680 17:54082882-54082904 AAAATAAGCTACACAGAGAAGGG - Intergenic
1149409615 17:56392010-56392032 AATGTAAGCTCCACAGAGATGGG - Intronic
1149440340 17:56668629-56668651 AAACCCTGCTTTACAAAGATAGG - Intergenic
1150124199 17:62626270-62626292 AGCCTCAGCCTGACAGAGATGGG + Intergenic
1150204913 17:63396349-63396371 AAACTAAACTTCTAAGAGATAGG - Intronic
1151386089 17:73756354-73756376 AATCTCAGCTTCACCGATAGGGG - Intergenic
1151404882 17:73879809-73879831 ACCCTCAGCTTCTCAGAGACAGG - Intergenic
1152163770 17:78687304-78687326 AAACACTGCTTCACAAAGACAGG + Intronic
1154500576 18:14994761-14994783 AAACTGAAGTTCAAAGAGATGGG - Intergenic
1155112243 18:22727506-22727528 AAATTCTGCTTCACTAAGATAGG - Intergenic
1155218642 18:23664762-23664784 AAACTAAGATTCTGAGAGATTGG + Intergenic
1156371955 18:36479152-36479174 AACCTCTGTTTTACAGAGATGGG + Intronic
1157149315 18:45199921-45199943 AGACTGCACTTCACAGAGATTGG - Intergenic
1157222031 18:45835279-45835301 AAGGTAAGCTTCTCAGAGATGGG + Intronic
1157315350 18:46583032-46583054 AGACTCTGTTACACAGAGATTGG + Intronic
1158509672 18:58079516-58079538 AAACTGAGCCTCAGAGAGGTTGG + Intronic
1158897269 18:61926773-61926795 ATACTCAGTATCACAGAGGTCGG - Intergenic
1159290771 18:66415718-66415740 AAACGCAGCCTCAGAGAAATTGG + Intergenic
1159792535 18:72800381-72800403 AAACCCTGCTTCACAAAGATAGG - Intronic
1159823611 18:73177419-73177441 ACACTCAGCCTCACAGAACTGGG + Intronic
1160033731 18:75283007-75283029 AAACTCCCTTTCACAAAGATGGG + Intronic
1160125575 18:76168718-76168740 ACACTCAGATTCGCTGAGATGGG - Intergenic
1161304977 19:3562283-3562305 AAACTGAGTTTCACAAAGACGGG + Intronic
925132748 2:1505055-1505077 AAACTCAGCTCCTCAGCGAAGGG + Intronic
926630491 2:15131420-15131442 GAACTCAGAGTCACAGAGCTAGG - Intergenic
926824699 2:16892887-16892909 AAACTCTGCTTCACAAACATAGG - Intergenic
928030987 2:27778987-27779009 AACCTCTACTTCCCAGAGATGGG - Intronic
928040359 2:27869835-27869857 AAACTCTGCTTCACAAAGATAGG + Intronic
928431884 2:31226954-31226976 AAACTCAGGTGCAGAGAGGTAGG - Intronic
929174662 2:38964156-38964178 AAACCCTGCTTCACAAAGATGGG + Intronic
929226751 2:39519015-39519037 AAACTCAGCTTCCCAAAGACAGG - Intergenic
930403121 2:50916789-50916811 AAACTTTGCTTCACAGAGCCAGG + Intronic
930849199 2:55939924-55939946 AAACTTAACTTCACGGAGACTGG + Intergenic
931173921 2:59833895-59833917 AAACTCACCTTCACATAAAGAGG + Intergenic
931614317 2:64140392-64140414 AAACTCCACTTCAGAGAAATGGG - Intronic
932974923 2:76587694-76587716 AAGGTAAGCTTCACAGAGTTTGG + Intergenic
933480484 2:82851186-82851208 AAACCCTGCTTCACAAAGACAGG + Intergenic
933719448 2:85388491-85388513 AGACTGAGTTTCACAGAGGTTGG + Intronic
936689924 2:114874410-114874432 AAACCCTGCTTCACCAAGATAGG - Intronic
936911167 2:117595481-117595503 AAACTAAGCTTCACAAATAAAGG - Intergenic
937165890 2:119816753-119816775 AAACACTGCTTCATAAAGATAGG + Intronic
937514237 2:122634986-122635008 AAATTCAGCTTCAAGGAAATTGG + Intergenic
938158384 2:128960423-128960445 ATACTCAACATCTCAGAGATTGG - Intergenic
938808939 2:134833946-134833968 AAACCCATCTTCAAAGACATTGG - Intergenic
939013241 2:136871952-136871974 AAACTCACCTTCATAGAAACAGG - Intronic
939237474 2:139515738-139515760 AAACTCAAGTTCACTTAGATTGG - Intergenic
939699919 2:145377668-145377690 AAACTCAATCTCACACAGATAGG - Intergenic
940565561 2:155356277-155356299 AGACTCACTCTCACAGAGATGGG + Intergenic
940598376 2:155824261-155824283 AAACTTAATTTCACTGAGATAGG + Intergenic
943237128 2:185337247-185337269 AAACACAGCTTTACAGGGATGGG - Intergenic
943741743 2:191417593-191417615 AAACTCATCTTTACACAGAAAGG + Intronic
943818692 2:192290459-192290481 AAACCCTGCTTCACAAAGATAGG + Intergenic
944321711 2:198352438-198352460 AAAATCAGTTTCACAAAGTTAGG + Intronic
947701568 2:232238819-232238841 ATACTCAGCTTCAGAAAGAAAGG + Intronic
948537317 2:238655813-238655835 ACCCTCAGCCTCACAGAGAATGG + Intergenic
948576896 2:238958043-238958065 AAACTAAGCTTCATAAAGAAAGG + Intergenic
1168835515 20:874643-874665 AGACTCAGGTTCAGTGAGATAGG - Intronic
1170544121 20:17418786-17418808 CAACTCTGCTGAACAGAGATGGG - Intronic
1172883761 20:38217958-38217980 TAACTCAGCCTCACAGAGCCGGG - Intronic
1174926356 20:54764090-54764112 AAACTCATCTTCTCAGTGATTGG + Intergenic
1175109464 20:56636640-56636662 AAATTCGGCTTCACAGACATAGG - Exonic
1175206262 20:57313908-57313930 TGACTCAGCTTCAAAGAGTTTGG - Intergenic
1177067062 21:16452386-16452408 AAACTTAGCTTAACAAAGAAAGG - Intergenic
1177319509 21:19501892-19501914 AAACACAACTTCACAGAGACAGG - Intergenic
1177550579 21:22615621-22615643 AAGCTCAGCATCAAAGAGACAGG - Intergenic
1177687943 21:24464829-24464851 AAACTCATATACACAGAGTTTGG - Intergenic
1177725939 21:24967931-24967953 AAATCAAGATTCACAGAGATGGG - Intergenic
1177729601 21:25011378-25011400 AAGCTCACATTCACAGATATGGG + Intergenic
1178806268 21:35842119-35842141 AGACTCAGTTTCACAGGGCTGGG - Intronic
1179105328 21:38395257-38395279 CAACTCAGGCTCACTGAGATGGG + Intronic
1179188098 21:39100355-39100377 AAACCCTGCTTCACAAAGATAGG - Intergenic
1179961138 21:44767491-44767513 AACCTCATCTACACAGAGACTGG + Intergenic
1181991155 22:26837988-26838010 AAACTGAGGTTCAGAGAGGTTGG + Intergenic
1183171092 22:36188787-36188809 AAACTGAGGCTCAGAGAGATGGG + Intergenic
1183494307 22:38133710-38133732 AAGCACAGCTTGACAGAGAATGG - Intronic
1184513906 22:44948720-44948742 AAACCCGGCTTCACAAAGACAGG + Intronic
1184724083 22:46332958-46332980 AAACTCAGCTGCCCAGATACTGG + Intronic
1184801025 22:46759553-46759575 AAAAAAAGTTTCACAGAGATGGG + Intergenic
1184838420 22:47037717-47037739 AAACTCAGCCACAAAGAGAACGG - Intronic
1184984506 22:48120367-48120389 ATAGTCAGATTCACAGAGGTTGG - Intergenic
949390188 3:3553386-3553408 AAACTCAACTTCAAAGGTATGGG + Intergenic
949460472 3:4287572-4287594 AAACACAGCTTCACAAAGATAGG + Intronic
949491967 3:4597951-4597973 AGACTCAGATTCAGAGAGCTAGG + Intronic
950758430 3:15197996-15198018 AAACCCTGCTTCATAAAGATAGG + Intergenic
951901222 3:27659443-27659465 AGACTCAGAATCACAGAGGTGGG + Intergenic
952611914 3:35220257-35220279 AATCTCTGCATTACAGAGATAGG + Intergenic
953304588 3:41815956-41815978 AAACTGAGCTACACAGAGCATGG + Intronic
953795626 3:45983686-45983708 AAACTCAGATTTGCAGAGACTGG + Intronic
954470074 3:50686266-50686288 AAACTCTGCTGCACAAAAATAGG + Intronic
954906170 3:54064859-54064881 AAACTGAGGTTCAGAGAGGTTGG - Intergenic
955681157 3:61503656-61503678 AAACTAAGCTTCATAGACAAAGG - Intergenic
956733526 3:72218081-72218103 AAAATCAACTCCACAGAGAATGG + Intergenic
957311175 3:78520742-78520764 AAACTCAGCTCAACAAATATAGG - Intergenic
957393524 3:79610963-79610985 AAACAAAGCTGCACAGTGATTGG + Intronic
957586052 3:82133341-82133363 AAACTCAGCTTTTAAGCGATTGG + Intergenic
958075430 3:88670480-88670502 AAACTGAGCCACAGAGAGATGGG - Intergenic
961788221 3:129360143-129360165 CCACTCAGCTCCACGGAGATCGG + Intergenic
961865878 3:129953142-129953164 TAACTCTGCTTCTCAGAGATGGG - Intergenic
962556689 3:136559763-136559785 AAACTCAGCCTCTCAAAGATAGG - Intronic
962895181 3:139707548-139707570 AAACTCAGCTTCCCAATGATAGG - Intergenic
963356308 3:144212581-144212603 AAACCCTGCTTCACAAAGATAGG + Intergenic
963357146 3:144223078-144223100 AAACTCAACTATACAGTGATGGG + Intergenic
965015876 3:163156008-163156030 ATACTCAGCATCTCAGCGATTGG - Intergenic
965263524 3:166512378-166512400 AAACTCAGCTTCACAAGCAAAGG + Intergenic
965736760 3:171828892-171828914 CAAATCAACTTCACATAGATGGG + Intergenic
965865604 3:173200921-173200943 AAACTCACCTGCACAAATATTGG - Intergenic
965994163 3:174859045-174859067 ACACCAAGCTTCACAGAGTTTGG - Intronic
966207716 3:177421910-177421932 GAAGTGAGCTTCACAGAGAAGGG - Intergenic
966800441 3:183758673-183758695 GAGATCAGCTTCACAGGGATGGG + Intronic
967079288 3:186034120-186034142 AAACTCAGCATCAGTGATATTGG + Intergenic
967463298 3:189773080-189773102 TCACTTAGCTTCACAGAGAAAGG - Intronic
969502080 4:7559320-7559342 CAATCCAGCTTCACAGAGCTGGG - Intronic
970500220 4:16669358-16669380 CATCTCAGCTCCACAGAGACAGG + Intronic
971619574 4:28838606-28838628 AAACCCAACTTCACACAGATAGG - Intergenic
973962420 4:56124935-56124957 ACACTCAGCATCACAGAAAAAGG - Intergenic
974138069 4:57845075-57845097 AATTTCAGACTCACAGAGATGGG - Intergenic
974345231 4:60670777-60670799 AAACTCAGCCTCAGAGAAATTGG - Intergenic
975189316 4:71441360-71441382 AAACTGAGCTCCACAGAGTTAGG + Intronic
975417449 4:74121401-74121423 AAACCCTACTTCACAAAGATAGG - Intronic
975625355 4:76340567-76340589 AAACACTGCTTCACAAAGATAGG - Intronic
975972530 4:80058790-80058812 AAGATCAGCTTCACTGAGTTTGG + Intronic
976122718 4:81800583-81800605 AAACCCTGCTTCACAAAGATAGG + Intronic
976180400 4:82393539-82393561 AAACCCTGCTTCACAAAGATAGG - Intergenic
976801710 4:88999801-88999823 AAACACGGCTTGACAGAGTTAGG + Intronic
977084263 4:92574571-92574593 AAACTCAGCTTCAAAAATAAAGG - Intronic
977260382 4:94790192-94790214 ACTTTCAGCTGCACAGAGATTGG + Intronic
978222463 4:106293262-106293284 AAACCCTGCTTCACAAAGATAGG - Intronic
979829230 4:125280146-125280168 AAACCCTTCTTCACAAAGATAGG - Intergenic
980991343 4:139741006-139741028 AAACCCAGCTTCCCACAGACAGG - Intronic
982039799 4:151385513-151385535 AAACCCTGCTTCACAAAGATAGG + Intergenic
982078065 4:151758592-151758614 AGAAACAGCATCACAGAGATGGG + Intronic
982394609 4:154902984-154903006 GAACTCAACATCACAAAGATAGG - Intergenic
982625949 4:157766493-157766515 AAACTCATCTCCTCAGTGATGGG + Intergenic
983124895 4:163938701-163938723 AATCACAGTTTCACAGAGCTGGG + Intronic
983677640 4:170314707-170314729 AAACTCAGCTTCACAAAGATAGG - Intergenic
984315415 4:178123664-178123686 AAACTCAGGTACATAGAGAAAGG + Intergenic
985477933 5:90360-90382 AATGTCAGCTTCCCAGAGATGGG + Intergenic
985753417 5:1697339-1697361 AAACTCTGCTTCACAAAGACAGG + Intergenic
986350178 5:6870326-6870348 CAACCCTGCTTCACAAAGATAGG + Intergenic
986872853 5:12070588-12070610 AGGCTCAGCTTCACACAGCTTGG - Intergenic
987055620 5:14188343-14188365 AAACTGAGGTACAGAGAGATTGG + Intronic
987993180 5:25241930-25241952 AAACCCTGCTTCACAAAGATAGG + Intergenic
988044513 5:25932774-25932796 ATACTCATCATCTCAGAGATTGG - Intergenic
988136110 5:27173872-27173894 AAACCCTGCTTCACAAAGATTGG - Intergenic
988604909 5:32670615-32670637 GAACCCAGAGTCACAGAGATGGG + Intergenic
988827968 5:34959018-34959040 AAAATCAGCCTCACATGGATAGG + Intergenic
993100859 5:83538223-83538245 ATATTCATCTACACAGAGATCGG + Exonic
993164792 5:84338636-84338658 AAACTCAACATCACTGGGATGGG + Intronic
993971750 5:94428492-94428514 AAACTAAGCTTCACAAACAAAGG - Intronic
995463903 5:112431097-112431119 AAACCCTGCTTCACAAAGATAGG + Intergenic
995511004 5:112909204-112909226 AAACTAAGGCTCAGAGAGATTGG - Intronic
995861355 5:116644222-116644244 AAACCCTGCTTCACAAAGATAGG + Intergenic
996699031 5:126430561-126430583 AAAGGCAGATTCATAGAGATAGG - Intronic
997864545 5:137449479-137449501 AGAGGCAGCATCACAGAGATGGG + Intronic
997900374 5:137758015-137758037 AAACCCTGCTTCACAAATATAGG + Intergenic
998512429 5:142724668-142724690 AGAGTCAGCTACACAGAGACAGG - Intergenic
999193773 5:149768103-149768125 AAACCCTGCTTCACAGGGATAGG + Intronic
999505177 5:152187107-152187129 AAAGTCTGCTTCACAGTCATGGG + Intergenic
1000183351 5:158834678-158834700 AAACTCAGCTTCACAGTGGCTGG - Intronic
1000253290 5:159515002-159515024 AAACTGAGCCTCAGAGAGTTAGG - Intergenic
1001286159 5:170425543-170425565 AGACTCAGCTTTGCAGAGTTGGG - Intronic
1001894462 5:175366505-175366527 AAACCCTGCTTCGCAAAGATAGG - Intergenic
1004181393 6:13383461-13383483 AAACTCAGCTTCACAGAGATAGG - Intronic
1004599281 6:17132154-17132176 AAACCCTGCTGCACAAAGATGGG - Intergenic
1004884736 6:20040614-20040636 TAACTAAGGTTCAGAGAGATTGG + Intergenic
1005220418 6:23581180-23581202 TAACTCAGCTTCAGAGACAGAGG + Intergenic
1005368754 6:25107741-25107763 AAACTCACCATCACACAGAATGG + Intergenic
1005635224 6:27746774-27746796 AAACTCAGAATCAGAGAGAATGG + Intergenic
1007247943 6:40475830-40475852 AAACTGAGCTTCAGAGAGGATGG + Intronic
1008019448 6:46559280-46559302 AAAATCAGCTTCTCAGAGGAGGG + Intronic
1009310691 6:62148860-62148882 AAATTCAGATTCACTGAGCTAGG + Intronic
1010451421 6:76008142-76008164 AATCCCAGCTTCACAGAAAAGGG + Intronic
1010478129 6:76315075-76315097 AAACTAAGGTCCAGAGAGATTGG + Intergenic
1013036079 6:106384590-106384612 AAACCCTGCTTCACAAAGATAGG + Intergenic
1013785233 6:113772153-113772175 AAACTCTGCTTTACAGAGTCAGG + Intergenic
1013815442 6:114092224-114092246 AAGCTCAGCTTCCTAGAGGTAGG - Intronic
1014909204 6:127069132-127069154 AAATTCAGCTTCACAAATGTAGG + Intergenic
1015521081 6:134131895-134131917 AAACTCAGGCTCACAGAGAGTGG + Intergenic
1016417749 6:143850936-143850958 AAACCCAGCATCACAGGGTTGGG + Intronic
1016909960 6:149189035-149189057 AAACTAAGCTTCACAAACAAAGG - Intergenic
1016942016 6:149490376-149490398 AAAGTCACATTCACAGATATTGG - Intergenic
1017097329 6:150816199-150816221 AAACCCTGCTTCACAAAGATAGG + Intronic
1017108553 6:150910905-150910927 AAAGTCAGCTTTAGAGAAATTGG + Intronic
1017133172 6:151125375-151125397 AAACTGAAGTTCAAAGAGATGGG - Intergenic
1017768661 6:157627733-157627755 AAACTGAGGCTTACAGAGATGGG - Intronic
1018596551 6:165487254-165487276 AAACCCTGCTTCACAAAGACAGG - Intronic
1018664527 6:166122927-166122949 AAACCCTGCTTCACAAAGACAGG + Intergenic
1021405723 7:20264954-20264976 AGAATGAGCTTCAGAGAGATAGG - Intergenic
1021959076 7:25854329-25854351 AAACTCAGTTTCCCAGCGAGTGG - Intergenic
1022036468 7:26539227-26539249 AAATACAGCTTCAAAGAGAGAGG + Intergenic
1022257330 7:28672535-28672557 AAACTCTGATTGACAGAGACTGG + Intronic
1022733605 7:33055538-33055560 AAATTCAGCTTGACTGAAATAGG + Intronic
1023593029 7:41798753-41798775 AAACACAGCTTCAAAGTGGTGGG - Intergenic
1023653650 7:42397387-42397409 AAATCCAGCCTCACACAGATAGG - Intergenic
1024305317 7:47923897-47923919 AAAATCAGCTTCACAGATGCTGG + Intronic
1025723718 7:64038538-64038560 AAACTCAGCCTCACAGAGAAGGG + Intronic
1025752868 7:64308137-64308159 ATACTCAACTGCACAGAGAAGGG + Intronic
1027530726 7:79328571-79328593 AAATTCAGCTCCACAGACACTGG + Intronic
1028030793 7:85909384-85909406 AAACTAAGCTTCACAAACAAAGG + Intergenic
1028250774 7:88538047-88538069 AAACTAAGCTTCACAAATAAAGG - Intergenic
1029642471 7:101829756-101829778 AAACTCAGCCCCGCAGAGAAGGG + Intronic
1030117719 7:106074805-106074827 AAACTCATCATCTCAGTGATTGG + Intergenic
1030326601 7:108226210-108226232 GAAATCACCTTCACAGAAATAGG + Exonic
1031749937 7:125558619-125558641 ATACTCATCATCACAGAAATAGG + Intergenic
1032373202 7:131381481-131381503 AAAGTCATTTTCACAGTGATGGG - Intronic
1032688738 7:134261273-134261295 AAAATCAACTTCACATATATGGG - Intronic
1033922508 7:146411732-146411754 AAAGTCAGTTTTAAAGAGATTGG + Intronic
1037065644 8:14573881-14573903 GAACTCACCTTCTCAGAGTTAGG - Intronic
1038893665 8:31756292-31756314 ATAATCAGTTTCACAGAGATGGG - Intronic
1039302407 8:36223487-36223509 AAACTCATCTTCTCAGTAATTGG + Intergenic
1039735767 8:40330879-40330901 AAGCTCAGCTCCACGCAGATTGG + Intergenic
1040419459 8:47225243-47225265 AAAGTTAGCTTCAGAGAGAAGGG + Intergenic
1040927902 8:52704179-52704201 AAACTGAGATTCAGAGAAATTGG - Intronic
1043005833 8:74817403-74817425 TAACTCAAATTCACAAAGATAGG - Intronic
1043050992 8:75385339-75385361 AAACCCTGCTTCACAAGGATAGG - Intergenic
1043331790 8:79125741-79125763 AATGTAAGCTTCTCAGAGATAGG + Intergenic
1043369801 8:79577491-79577513 AAATTCAGACTTACAGAGATAGG + Intergenic
1044031757 8:87247045-87247067 AAACTCTGCTTCACAAAGGTAGG + Intronic
1045006906 8:97924191-97924213 ACATTCAGCTACACAGATATGGG - Intronic
1046654834 8:116881948-116881970 AAACTCAGCCTTAGAGAGGTTGG - Intergenic
1047253894 8:123201322-123201344 GCCCTCAGCTTCACAGGGATTGG - Intronic
1047336712 8:123943045-123943067 AAACTGAGCCACAGAGAGATTGG - Intronic
1047556852 8:125941376-125941398 AGACTCAGCTTCAAGGTGATGGG + Intergenic
1049069678 8:140346928-140346950 TGACTCAGCTTCACAGCGAGGGG - Intronic
1049152417 8:141043738-141043760 TAACTCAGCATCACAGAGCTGGG + Intergenic
1050057080 9:1667005-1667027 AAACCCTGCTTCACAAAGATAGG - Intergenic
1050569439 9:6922018-6922040 AAAATCCCCTTCACAGAGCTTGG - Intronic
1052252013 9:26409624-26409646 AATCTCAGCTGCACAGAGCCAGG - Intergenic
1052258532 9:26488239-26488261 AAAATCACCTTCACAGACAAAGG - Intergenic
1053572390 9:39322562-39322584 AAACTGACGTTCAAAGAGATTGG - Intergenic
1053796970 9:41735409-41735431 AACCTCAGCTTCCCATAGCTGGG + Intergenic
1054093951 9:60881274-60881296 AAACTGACGTTCAAAGAGATTGG - Intergenic
1054115425 9:61157194-61157216 AAACTGACGTTCAAAGAGATTGG - Intergenic
1054124755 9:61296449-61296471 AAACTGACGTTCAAAGAGATTGG + Intergenic
1054592331 9:67025348-67025370 AAACTGACGTTCAAAGAGATTGG + Intergenic
1054915856 9:70494693-70494715 AATCTCAGCTTGGCAGAGGTAGG + Intergenic
1055222491 9:73953630-73953652 AAACTAAGCTTCACAAACAAAGG + Intergenic
1056104051 9:83329354-83329376 AAACTCATCTTAAGAAAGATTGG + Intronic
1056804855 9:89720730-89720752 GGAGTCAGATTCACAGAGATGGG - Intergenic
1057775835 9:98008617-98008639 AAACTTTGCTTCACAAAGATAGG - Intronic
1058229481 9:102408214-102408236 AAACTCTGCTTCACAAAGATCGG - Intergenic
1058646207 9:107133757-107133779 AAATCCAACTTCACACAGATAGG + Intergenic
1059746494 9:117206629-117206651 AAGCCCAGCTTTACAGAGCTTGG + Intronic
1060694586 9:125696954-125696976 AACCTCAACTCCACAGAGATAGG + Intronic
1061217821 9:129231885-129231907 AAACTGAGGCTCACAGAGGTGGG + Intergenic
1061776231 9:132966745-132966767 AAACTCAGCATCACTAAGGTGGG + Intronic
1186541972 X:10410110-10410132 AAATCCAGCTTCCCAGACATGGG - Intergenic
1186980257 X:14950981-14951003 AAACTGAGGCTCACAGAGGTCGG + Intergenic
1188065688 X:25656668-25656690 AAACCCTGCTTCACAATGATAGG + Intergenic
1188593754 X:31871464-31871486 AAACTGAGGCTCACAGAGAGAGG + Intronic
1189092717 X:38104126-38104148 AAACTCAGCTTCAGACAAATAGG + Intronic
1189275515 X:39782407-39782429 AAACTCAGCTCCATAGCGCTGGG + Intergenic
1192594254 X:72389586-72389608 AAACTGAGCTTCTGAGAGACTGG + Intronic
1194193022 X:90860230-90860252 ACACTCTGTTTCACAGAGATAGG + Intergenic
1194603651 X:95955559-95955581 AAAGTAAACTTCACAGAGAAGGG + Intergenic
1196523079 X:116696331-116696353 AACCTCATCTTCATATAGATGGG + Intergenic
1198329359 X:135607529-135607551 AAACTGAGCATCAGAGGGATAGG + Intergenic
1198892325 X:141411649-141411671 AGACAAAGATTCACAGAGATGGG + Intergenic
1199097388 X:143758807-143758829 AAACTCAGGTCCTCAGGGATGGG + Intergenic
1199206104 X:145149990-145150012 AAACTAAGCTTCACAAATAAAGG + Intergenic
1199494750 X:148440765-148440787 AAACTATGCTTCACACAGCTAGG - Intergenic
1200539642 Y:4442680-4442702 ACACTCTGTTTCACAGAGATAGG + Intergenic
1200887870 Y:8288329-8288351 GAACACACATTCACAGAGATGGG - Intergenic
1200935525 Y:8734971-8734993 AACCTCATCTACACAGAGAGAGG - Intergenic
1201584281 Y:15543720-15543742 AAACTAAGACTCAGAGAGATTGG - Intergenic
1201757877 Y:17507215-17507237 AAACTCTGCTTCAGAAAGACAGG - Intergenic
1201843677 Y:18398767-18398789 AAACTCTGCTTCAGAAAGACAGG + Intergenic