ID: 1004181393

View in Genome Browser
Species Human (GRCh38)
Location 6:13383461-13383483
Sequence AAACTCAGCTTCACAGAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004181393_1004181395 14 Left 1004181393 6:13383461-13383483 CCTATCTCTGTGAAGCTGAGTTT No data
Right 1004181395 6:13383498-13383520 GATTAGAACAAACATACACTAGG 0: 1
1: 0
2: 3
3: 16
4: 260
1004181393_1004181396 26 Left 1004181393 6:13383461-13383483 CCTATCTCTGTGAAGCTGAGTTT No data
Right 1004181396 6:13383510-13383532 CATACACTAGGAAAAAATCAAGG 0: 1
1: 0
2: 0
3: 15
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004181393 Original CRISPR AAACTCAGCTTCACAGAGAT AGG (reversed) Intronic