ID: 1004181599

View in Genome Browser
Species Human (GRCh38)
Location 6:13385285-13385307
Sequence CTCCATGGGGGCAGGTACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 274}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004181599_1004181608 30 Left 1004181599 6:13385285-13385307 CCCAGGTACCTGCCCCCATGGAG 0: 1
1: 0
2: 3
3: 23
4: 274
Right 1004181608 6:13385338-13385360 CTGTAACATAAAAGTACCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004181599 Original CRISPR CTCCATGGGGGCAGGTACCT GGG (reversed) Intronic
900409037 1:2504623-2504645 ATCCTTGGGGCCAGGGACCTGGG - Exonic
900518887 1:3096168-3096190 CCCCATGTGGGCAGGAACCTCGG + Intronic
900706802 1:4086078-4086100 CTCCCTGGGGGCAGGAGCCCAGG - Intergenic
901471513 1:9459954-9459976 CAGCAAGGGGGCAGGGACCTGGG - Intergenic
901526229 1:9824592-9824614 CTCCCCGGGGGCAGGTCCCGGGG - Intergenic
901807574 1:11748107-11748129 CTCCATAGAGGAAGGTTCCTTGG - Intronic
902236141 1:15058661-15058683 CTCTGTGAGGGCAGGTACCCTGG - Intronic
902447867 1:16478529-16478551 CTTCCTGGAGGCAGGTTCCTTGG - Intergenic
902467773 1:16628753-16628775 CTTCCTGGAGGCAGGTGCCTTGG - Intergenic
902506806 1:16943975-16943997 CTTCCTGGAGGCAGGTGCCTTGG + Intronic
902571611 1:17350790-17350812 CTCCGTGAGGTCAGGGACCTTGG - Intronic
902759564 1:18572349-18572371 CTCCATGAGGGCAGGGCCCAGGG + Intergenic
903340143 1:22648747-22648769 CCCCATGGGGGCAGGGACCATGG + Intergenic
903340639 1:22652252-22652274 CCCCATGGGGGCAGGGACCATGG + Intergenic
904771834 1:32885227-32885249 CTCCATGTGGACAGCTTCCTTGG - Intergenic
906245971 1:44274522-44274544 CACCATGGGGGCAGGGAGATGGG + Intronic
906692233 1:47800124-47800146 CTCCATGAGGGCAGGGAGTTCGG - Intronic
907719351 1:56957136-56957158 CTCTCTGAGGGCAGGGACCTTGG + Intronic
909034755 1:70584215-70584237 CTCCATGAGAGCAGCGACCTTGG - Intergenic
915399393 1:155611342-155611364 CTCCATAGGGGCAGGTAAACGGG + Intronic
915416506 1:155746922-155746944 CTCCATAGGGGCAGGTAAACGGG + Intergenic
916507702 1:165443114-165443136 TTCCATGGGGGCTGGAATCTTGG - Intronic
918597374 1:186307893-186307915 CTCCTTGGGGGCAGGCTTCTTGG - Exonic
918597428 1:186308100-186308122 CTCCTTGGGGGCAGGCTTCTTGG - Exonic
919396298 1:197053176-197053198 CTCCATGGGAGCAGGAGTCTTGG - Intronic
919901331 1:202046269-202046291 CCCCAGGGGGGCTGGTACCCTGG - Intergenic
920165399 1:204032123-204032145 GTCCATGGCAGCAGGTGCCTGGG + Intergenic
920370316 1:205474731-205474753 CTCCATGAGGGCAGGAACTTTGG + Intergenic
922764853 1:228151397-228151419 CACCATGTGGGCAGGCACTTGGG + Intronic
924584408 1:245349072-245349094 CTCCGTGAGAGCAGGGACCTTGG + Intronic
924686998 1:246303280-246303302 CTCCAGGGGTGCAGGAATCTTGG - Intronic
1064494851 10:15898595-15898617 CTCCTTGGGGGCAGGGACTATGG + Intergenic
1065889898 10:30111954-30111976 CTCTTTGGGGGCATCTACCTGGG - Intronic
1067850176 10:49749691-49749713 CTCCAAGGGTGCCGGGACCTGGG + Intronic
1067913546 10:50372086-50372108 CTCCATAAGGGAAGGTCCCTTGG + Intronic
1068053542 10:51982866-51982888 CTGCATGGAGGCAGGCACCCTGG - Intronic
1069335023 10:67338398-67338420 GATCATGGGGGCAGGTCCCTCGG - Intronic
1069868251 10:71517479-71517501 CGCCATGTGGGAAGGTAGCTGGG - Intronic
1070159449 10:73857079-73857101 CACCATGGGGGCAGGGATGTAGG + Intronic
1071245356 10:83755241-83755263 CATCATGGGGGCAGATCCCTTGG + Intergenic
1075078748 10:119368804-119368826 CTCCCTGGGCTCAGGTCCCTGGG - Intronic
1075080638 10:119381357-119381379 CTCCCTGAGGGCAGGACCCTGGG + Intronic
1076039487 10:127231955-127231977 CTCCATGTGTGCAGGGACCTTGG - Intronic
1076113206 10:127876765-127876787 CTCCATGGGGGCGGATACCCTGG + Intergenic
1076504883 10:130965071-130965093 CTTCAAAGGGGCAGGTAGCTGGG - Intergenic
1076526956 10:131117955-131117977 CTGCCTGGGGGCAGGTCCGTCGG + Intronic
1077113357 11:871718-871740 CTGCAGGGGCGCAGGGACCTGGG + Intronic
1077191776 11:1258714-1258736 CCCCATGTGGGCAGGAATCTGGG - Intronic
1077362168 11:2145574-2145596 CCCCCTGGGGGAAGGCACCTCGG - Intronic
1077649220 11:3954445-3954467 CTCCATAGTGGCAGGAACCATGG - Intronic
1078549039 11:12267967-12267989 CTCCATGAGGGCAGGGGTCTTGG + Intergenic
1078849778 11:15153138-15153160 TTCCATGAGGGCAGGAAACTAGG - Intronic
1079108417 11:17589119-17589141 CTGCATGGGTGCAGGTACAAAGG - Intronic
1080898498 11:36465969-36465991 CTCCATGAGAGCAGGCACCTTGG - Intergenic
1083186472 11:61020683-61020705 CACCAAGGGGGCAGGGAGCTGGG + Intergenic
1084101309 11:66951419-66951441 TTCCATGGTGGCAGGTGCCTGGG - Intronic
1084149933 11:67283311-67283333 CTCCAAGGAGGCTGGGACCTTGG - Intronic
1085688718 11:78648718-78648740 CCCCCTGGGGGCAGGCAGCTGGG - Intergenic
1086450495 11:86911119-86911141 CTACTTGGGGGCAGGTACTGAGG - Intronic
1091529242 12:1339094-1339116 CTACATGGGGGCAGGCACCCTGG - Intronic
1091529258 12:1339178-1339200 CTACATGGGGGCGGGCACCCTGG - Intronic
1091529274 12:1339262-1339284 CTACATGGGGGCAGGCACCCTGG - Intronic
1091529289 12:1339346-1339368 CTACATGGGGGCGGGCACCCTGG - Intronic
1091529306 12:1339430-1339452 CTACATGGGGGCGGGCACCCTGG - Intronic
1091529322 12:1339514-1339536 CTACATGGGGGCGGGCACCCGGG - Intronic
1091529344 12:1339608-1339630 CTACATGGGGGCAGGCACCCTGG - Intronic
1092968867 12:13672390-13672412 CTCCAGGGAGGCAGGCACCAGGG - Intronic
1096096165 12:48937217-48937239 CTCCATGGGGCCAGGTTTCCTGG - Exonic
1096959189 12:55560781-55560803 CTCCATGGGCGTAGGACCCTTGG - Intergenic
1097179081 12:57160643-57160665 CTCCGTGGGAGCAGGGACCTTGG + Intronic
1097657096 12:62378992-62379014 CTCCATGAAAGCAGGTACCAGGG - Intronic
1097939993 12:65293734-65293756 CTTCATGGTGGCAGGGACCATGG + Intronic
1102254463 12:111407531-111407553 CTCCACGAGGGCAGGTCCCGAGG - Intronic
1103265532 12:119627175-119627197 ATCCATGAGGTCAGGGACCTTGG - Intronic
1103368402 12:120399977-120399999 CTCCATGAGGACAGGGACCTTGG + Intergenic
1104404387 12:128505504-128505526 CTCCATGGGGGTGGGTACCAGGG - Intronic
1104858465 12:131912802-131912824 CTCCTTGGGGGTGGGAACCTGGG + Intronic
1105931384 13:25056093-25056115 CTCCCCGAGGGCAGGGACCTGGG - Intergenic
1108373589 13:49793377-49793399 CTCAATGAGAGCAGGTACTTTGG + Intergenic
1108543304 13:51465305-51465327 CCCCATGAGGGCAGGGACTTTGG - Intergenic
1111825187 13:93258649-93258671 CTCCATGGGGGTGGGTACAATGG + Intronic
1113279223 13:108770615-108770637 CTCTTTGGGGGCATGTACATAGG + Intronic
1118465170 14:66024177-66024199 CACCATGGGGACAGTCACCTTGG - Intergenic
1119287056 14:73463881-73463903 CTGCATGGTGGCAGCTACTTGGG + Intergenic
1120907168 14:89630636-89630658 ATCCATGGGGTCAGGACCCTGGG + Intronic
1122149740 14:99718449-99718471 CTCCAGGAGGGCAGGGACCGTGG + Intronic
1123930897 15:25171218-25171240 CTCCAGGAGGGCAGCTTCCTTGG + Intergenic
1123932192 15:25177321-25177343 CTCCAGGAGGGCAGCTTCCTTGG + Intergenic
1123934159 15:25186125-25186147 CTCCAGGAGGGCAGCTTCCTTGG + Intergenic
1123942620 15:25223928-25223950 CTCCAGGAGGGCAGCTTCCTTGG + Intergenic
1124063498 15:26318135-26318157 CACCATGAGGACAGGTATCTCGG + Intergenic
1124620806 15:31272821-31272843 CTCCACGGGTGCAGGTTCCTTGG - Intergenic
1126666436 15:51079397-51079419 CTCCTTGAGGGCAGGGACCAAGG + Intronic
1127952371 15:63821862-63821884 CTCCATGAAAGCAGGAACCTTGG - Intronic
1129262470 15:74376315-74376337 CACCATGGTGGCAGGCACCCAGG - Intergenic
1129264051 15:74384520-74384542 CTCCAGGAGGGCAGGGACCAGGG + Intergenic
1129807906 15:78480073-78480095 CTCCATGAGGACAGGAACTTTGG + Intronic
1129868423 15:78925897-78925919 CTCCAAGGGGGAAGGTAGGTGGG + Intronic
1131113561 15:89780175-89780197 AGCCATGGTGGCAGGCACCTAGG - Intergenic
1131310751 15:91287900-91287922 CTCCATGGGGGCTGGAGCCGTGG + Intronic
1131445843 15:92497370-92497392 CTGTATGGGGACAGGGACCTCGG + Intronic
1131643355 15:94315515-94315537 CTCCATCTGTGCAGGTACCGGGG + Exonic
1131919629 15:97310003-97310025 CTCCATGGGAACATGTGCCTGGG - Intergenic
1132466447 16:79540-79562 CTCCCTGGGGCAAGGTGCCTGGG - Exonic
1132644473 16:992449-992471 CTGCATGCGGGCAGGGGCCTGGG + Intergenic
1133875895 16:9734034-9734056 CTCCATGAGGGCAGGGACAGTGG + Intergenic
1134149922 16:11797373-11797395 CTGACTGGGGGCAGGGACCTGGG + Intergenic
1134626241 16:15724823-15724845 CTTCCTCGGGGCAGGTCCCTGGG - Exonic
1134657184 16:15955818-15955840 CTCCATAGGGGCAGGGATTTTGG + Intronic
1135185747 16:20314391-20314413 CTCTATGAGGGTAGGCACCTGGG + Intronic
1136569344 16:31087565-31087587 CTCCCTGGTGGCAGACACCTGGG - Exonic
1137444789 16:48525134-48525156 CTCCACGAGGGCAGGAACCTTGG + Intergenic
1140257819 16:73351780-73351802 TTCCAGGGGGGCAGGTCCATGGG + Intergenic
1140845952 16:78888349-78888371 CTGCCTCTGGGCAGGTACCTGGG - Intronic
1141144103 16:81516698-81516720 CTCCCTGGGGGCTGGGACCAGGG + Intronic
1141383174 16:83594472-83594494 CTCCACGAAGGCAGGGACCTTGG - Intronic
1142311940 16:89319321-89319343 GTCCATTGGGGAAGGTGCCTGGG - Intronic
1142433543 16:90043337-90043359 CCCCAGGGGGGCAGCTACGTCGG - Exonic
1144418278 17:15072050-15072072 CTCCATGAGGGCAGGGACCTGGG + Intergenic
1144577336 17:16437317-16437339 CTGCTTTTGGGCAGGTACCTGGG + Intergenic
1145974692 17:28977393-28977415 TGCCATGGGGGCAGGGTCCTTGG - Intronic
1147498294 17:40938209-40938231 CTCCAGAGGGGCAGACACCTTGG + Intergenic
1147955901 17:44134325-44134347 CTCCCCGAGGGCAGGTACATGGG - Intergenic
1148079733 17:44961011-44961033 CTCCATGGAGGCTGGCACCCAGG - Intronic
1148572907 17:48684841-48684863 CTCCAGTGGCCCAGGTACCTGGG - Intergenic
1148868093 17:50639568-50639590 CTCCATTGGGGCAGGATCCCTGG + Intronic
1150324913 17:64249074-64249096 AGGTATGGGGGCAGGTACCTGGG - Intronic
1150781185 17:68123498-68123520 GTACATGGGGCCAGGTACCGTGG - Intergenic
1151890289 17:76947458-76947480 CTCCATGGGGACAGGGCCCCAGG - Intronic
1153080751 18:1221749-1221771 CTCCCTGAGGGCAGGAACCATGG + Intergenic
1154389693 18:13925664-13925686 CTCCTCAGGGGCAGGCACCTGGG + Intergenic
1155439926 18:25851656-25851678 CTCCTTGAGGGCAGGGACCATGG + Intergenic
1155991966 18:32287368-32287390 CTTCATGGTTGCAGGGACCTGGG - Exonic
1158357999 18:56641587-56641609 GTCCATGTAGGCAGGTTCCTAGG - Intronic
1160504225 18:79418061-79418083 CCCCATGGTGGCAGGGACCAAGG - Intronic
1160878910 19:1310810-1310832 CTCCGTCGGGTCAGGTACCAGGG + Intergenic
1161638671 19:5405831-5405853 CTCCAAGGGGGCATGTGGCTGGG + Intergenic
1162790281 19:13059270-13059292 CTCCCTGTGGGCAGGTGGCTGGG + Intronic
1163238253 19:16042499-16042521 CTCCACGAGTGCAGGTACCCAGG + Intergenic
1164252826 19:23497918-23497940 CTACATGGGGGCAGGCACTGTGG + Intergenic
1164581547 19:29438428-29438450 CTCCCTGTGGGCAGGTCCCCAGG - Intergenic
1165471978 19:36009241-36009263 CCCCAAAGGGGCAGGAACCTGGG + Exonic
1167041779 19:47027108-47027130 CTGCATGGGGGCAAGCACCATGG - Intronic
1167157835 19:47750265-47750287 CTCTTTGGGGGCAGGGACTTTGG - Exonic
1167510218 19:49891789-49891811 CTCCATGGAGGCAGGGATGTGGG + Intronic
1168093082 19:54098556-54098578 CTCCATGGTGGCATGCACTTTGG + Intronic
1168406808 19:56114758-56114780 CTCCCTGAGGGCAGGTGCCAGGG + Intronic
925337068 2:3106438-3106460 CTCCCTGGAGGCAGGTTCCAGGG + Intergenic
925549425 2:5055285-5055307 CTTCTCGGGGGCAGATACCTAGG - Intergenic
925992942 2:9268674-9268696 CACCCTGGGGGCACGGACCTGGG + Intronic
926094844 2:10074424-10074446 CTGCATGGGGGCAGGAGCCCAGG - Intronic
928098840 2:28423107-28423129 CACCATGGGGGCAGGTACCAAGG + Intergenic
928220083 2:29396191-29396213 CTCCATGGTGGCAAGTATCCTGG + Intronic
928971189 2:37031134-37031156 CTCCATGGGGACAGGGCTCTGGG + Intronic
930028447 2:47044017-47044039 CTCCCTGGGGACAGCTCCCTGGG - Intronic
931603913 2:64032594-64032616 GTCCATGGGGGCAGGAAGCTTGG - Intergenic
931697004 2:64878832-64878854 CTCCATGGGGTCAAGGCCCTGGG + Intergenic
932348022 2:71008199-71008221 CTCCATGAGGGCAGGGACTTTGG + Intergenic
933276982 2:80294431-80294453 CTCCATGGGGTCAGGTTACGTGG - Intronic
934515066 2:94981249-94981271 CTCAGTGGGGCCAGGTACCATGG + Intergenic
937224648 2:120361268-120361290 CTCCATGGGGTCAGCATCCTCGG - Intergenic
937288785 2:120769381-120769403 CTCCATGGGTGCCGGGGCCTGGG + Intronic
938650650 2:133379589-133379611 CTCCATGTGGACAGGAACCATGG + Intronic
943324372 2:186480338-186480360 CTTCATGGGAGCAGGAACCTTGG - Intergenic
943564841 2:189505249-189505271 CTCCAGAAGGGCAGGTGCCTTGG - Intergenic
945378609 2:209111267-209111289 CTGCAAGGGGGCAGATCCCTAGG - Intergenic
948039546 2:234888740-234888762 CTCCATGGGCGTAGGACCCTCGG - Intergenic
948235803 2:236389315-236389337 CTCCATGGGCGTAGGACCCTCGG + Intronic
948746178 2:240095758-240095780 CGCCCTGGGTGCAGGAACCTTGG + Intergenic
948873368 2:240815092-240815114 CACCATGGGTGCAGGTCCTTGGG - Intronic
1171312934 20:24160274-24160296 CTCCAGGTGGGCAGTTCCCTTGG + Intergenic
1171956372 20:31466921-31466943 CTCCTTGAGGGCAGGGACCATGG - Intronic
1173090325 20:39964513-39964535 CTCCATGTGTCCAGGTATCTGGG + Intergenic
1174146067 20:48453521-48453543 GTCCATGGGGGCAGGAACTGGGG + Intergenic
1174165498 20:48580994-48581016 TGCCATGAGGGCAGGGACCTTGG + Intergenic
1174170604 20:48615963-48615985 CTCCATGAGGGCAGGAGCCATGG - Intergenic
1176346717 21:5755139-5755161 CTCCTTAGGGACAGTTACCTTGG + Intergenic
1176353531 21:5875723-5875745 CTCCTTAGGGACAGTTACCTTGG + Intergenic
1176498110 21:7569316-7569338 CTCCTTAGGGACAGTTACCTTGG - Intergenic
1176541038 21:8153209-8153231 CTCCTTAGGGACAGTTACCTTGG + Intergenic
1176559989 21:8336254-8336276 CTCCTTAGGGACAGTTACCTTGG + Intergenic
1177666711 21:24169150-24169172 CTCCATGAGGCCAGGAACTTAGG - Intergenic
1178350102 21:31866790-31866812 CTCCATGAGGGCTGGGACTTTGG - Intergenic
1178515846 21:33246424-33246446 CTCCAGGAGGGCAGGGACTTTGG - Intronic
1179269728 21:39841405-39841427 CTGTATGGGGGCAGCTTCCTGGG - Intergenic
1179279882 21:39925220-39925242 CTCCAAGGAGGCATGTAGCTGGG - Intronic
1181527127 22:23496385-23496407 CTCCATGAGGGCAGGGACGATGG - Intergenic
1181621411 22:24094046-24094068 CCACCTGGGGGCAGGTGCCTTGG + Intronic
1182919010 22:34062373-34062395 TTCCTTGAGGGCAGGGACCTTGG + Intergenic
1183340204 22:37276011-37276033 CTCCATGGTGGCAGTCAGCTGGG + Intergenic
1183398742 22:37588672-37588694 GTCCATGCGGGCGGGTACCTGGG + Intergenic
1185060820 22:48605873-48605895 GTCCATGAGGGCAGGTTCCGGGG + Intronic
1185089933 22:48760662-48760684 TTCCATGGGTGCATGTACCGTGG + Intronic
1185129735 22:49032217-49032239 CTCCATGGGAGAAGATGCCTGGG + Intergenic
1185198111 22:49485025-49485047 CTCCGTGAGGGCAGGTTTCTCGG - Intronic
1203245978 22_KI270733v1_random:69628-69650 CTCCTTAGGGACAGTTACCTTGG + Intergenic
949164122 3:917037-917059 CTCCATGAGGACAGGAGCCTTGG - Intergenic
949343918 3:3058987-3059009 CTCCTTGAGGGCAGGGACTTTGG + Intergenic
949463623 3:4320894-4320916 CTCCATGGGGGCAGCTTCTAAGG + Intronic
950710468 3:14810178-14810200 CTCCATGAGGGCAAGAATCTGGG + Intergenic
951639549 3:24821333-24821355 CTGCATTGGGGCAGGAACATGGG - Intergenic
954798606 3:53174362-53174384 CTCCATGGGGACAAGCTCCTTGG - Intronic
956990291 3:74754862-74754884 CTCCATGAGGGCAGGGACCAAGG + Intergenic
959560232 3:107771211-107771233 CTCCATGGGGGCTGGCATTTTGG + Intronic
959778393 3:110199202-110199224 CTCCAGCGGGGCAGGTCCCATGG + Intergenic
961619833 3:128215301-128215323 TTCCCTGGGGGAAGGAACCTGGG + Intronic
961667212 3:128499988-128500010 CTCCCTGAGGGAAGGTACCATGG - Intergenic
962800087 3:138882924-138882946 CTCCATGGTCCCAGCTACCTGGG - Intergenic
963063408 3:141242859-141242881 CTCCATGAGGGCAGGAATTTGGG + Intronic
967284234 3:187853222-187853244 CTCCTGGAGGGCAGGGACCTTGG - Intergenic
967309052 3:188089004-188089026 CTCCCTGGGTGCAGGGAACTGGG + Intergenic
968971997 4:3800708-3800730 CTCCCTGTGGGCAGGGACATCGG - Intergenic
970445034 4:16116284-16116306 CTCCATGGCAGCAGGAACTTGGG + Intergenic
970831068 4:20340521-20340543 CTCTATGAGGGCAGGTATCATGG - Intronic
972507333 4:39732368-39732390 CTCCAAGTGGGCAGGGACTTAGG + Intronic
978877443 4:113658646-113658668 CTCCATGAGGGCAGGGATATTGG + Intronic
980824424 4:138056844-138056866 CTCCAGGTGGGCAGGGACCGTGG - Intergenic
981585999 4:146303049-146303071 CTCCATGAGGGCTGTGACCTTGG - Intronic
983716604 4:170788640-170788662 CTCCATGGGCGTAGGACCCTCGG + Intergenic
984575721 4:181446076-181446098 CTCCATGAGGGCAGGAATCATGG - Intergenic
990316851 5:54590838-54590860 CTCCATGAGGGCAGGAAGCATGG + Intergenic
991298598 5:65105781-65105803 CTCCAAGGGGAGAGGTACTTTGG + Intergenic
991612265 5:68461881-68461903 CTCCATGAGGACAGGGACCATGG - Intergenic
992617510 5:78559001-78559023 CCTCATGGAGGCAGGTACCCAGG - Intronic
995574278 5:113513413-113513435 CTCCATGAAGGTAGGAACCTTGG + Intergenic
997616737 5:135251732-135251754 CTCCAGGAGGGCAGGAACCATGG - Intronic
997895006 5:137708590-137708612 CCCCATGAGGACAGGGACCTTGG - Intronic
998167750 5:139854167-139854189 CACCATGGAGGCAGCTAGCTGGG - Intronic
999762491 5:154713194-154713216 CTCCCTAGGGGCAGAAACCTTGG + Intronic
1000183551 5:158836877-158836899 ATCAATAGGGGCAGCTACCTTGG - Intronic
1000779092 5:165457103-165457125 TTCCATGAGGGCAGGGACTTTGG + Intergenic
1001804240 5:174569908-174569930 CTCCTTGAGGGCAGGAACTTTGG - Intergenic
1002099647 5:176851015-176851037 CCCCATGGGGGCATGGACGTGGG + Intronic
1002100770 5:176856498-176856520 CTCCCTGGGGGCAGGAGCCCAGG - Intronic
1002614180 5:180440299-180440321 GTCGATGGGGACAGTTACCTTGG + Intergenic
1004181599 6:13385285-13385307 CTCCATGGGGGCAGGTACCTGGG - Intronic
1004534547 6:16487653-16487675 CTCCTTGGGTGCAGGGTCCTGGG - Intronic
1004806042 6:19205079-19205101 CTGCAGGGAGGCAGGTACCCTGG - Intergenic
1006292119 6:33146313-33146335 CTCCAGGGGGACAGGATCCTTGG - Intergenic
1007341140 6:41192225-41192247 CTCCTTGGGGGCAGGAACCTGGG - Exonic
1007803171 6:44415502-44415524 CTCCCTGGTGTCAGGGACCTGGG + Intronic
1008001988 6:46370393-46370415 TTCCATAGGGGCAGCTTCCTGGG - Intronic
1008532735 6:52479139-52479161 ATCATTGGGGGCAAGTACCTTGG + Exonic
1010028292 6:71245265-71245287 CTCCATGAGGGCAGGGATCATGG + Intergenic
1012551476 6:100467697-100467719 CTCCATGAGGGCAGCATCCTGGG - Intergenic
1013697799 6:112724718-112724740 CTCCAAGGGGACAAGTCCCTTGG - Intergenic
1016466671 6:144332261-144332283 CTCCATATGGGCAGGGACCAAGG + Intronic
1019510847 7:1416596-1416618 CTCCATGAGGACAGGGTCCTGGG - Intergenic
1019748384 7:2713324-2713346 CTCCATGTGTGCAGGCCCCTGGG - Exonic
1021194802 7:17663206-17663228 CTCCATGGGAACAGGAACCTGGG - Intergenic
1022143534 7:27514378-27514400 CTCCATGAGGGCAGGGACTGTGG - Intergenic
1022422456 7:30236851-30236873 CTCCATGGTGTCAGGGACCCAGG + Intergenic
1024743759 7:52383807-52383829 CTCCAAAGGGGCAGGGCCCTGGG + Intergenic
1028368606 7:90064361-90064383 CTAGATGTGGGCAGGTAGCTAGG + Intergenic
1032833612 7:135653065-135653087 CACAATGGAGGCAGGTACCAGGG - Intergenic
1033284089 7:140026063-140026085 CTCCATGTGTGGTGGTACCTGGG - Intronic
1034931708 7:155168386-155168408 CTTCAAGGGGGCAGGGACCACGG - Intergenic
1035752900 8:2008410-2008432 CTCCTGGGGGGCAGGTCCCATGG + Intergenic
1035827394 8:2659587-2659609 CTCTCTGGGGGCAGGTCCATTGG + Intergenic
1036682841 8:10888041-10888063 GTCCATGGTGGCCTGTACCTTGG - Intergenic
1036711120 8:11079115-11079137 CTCCCTGGGAGCAGGTGGCTAGG - Intronic
1037879292 8:22565350-22565372 AACCCTGGGGGCTGGTACCTTGG - Exonic
1039289406 8:36077623-36077645 CTGCACGGAGGCAGGCACCTTGG + Intergenic
1039562599 8:38524941-38524963 CTCCATGGGGGCAAGCGCCAAGG + Intronic
1040377715 8:46842580-46842602 CTCCATGTGGGTAGGTCCCAAGG - Intergenic
1045836482 8:106527288-106527310 CTCCATGAGAGCAGGTACCATGG - Intronic
1049274251 8:141711733-141711755 CTCCATGAGGACAGGGGCCTCGG + Intergenic
1049366030 8:142237297-142237319 CTCCATGAGGGCAGGAGTCTTGG + Intronic
1049797225 8:144502393-144502415 CTCCATGGGGGCCAGGGCCTAGG + Intergenic
1050587744 9:7130667-7130689 CTGGAGGGGGGCAGGTACCATGG + Intergenic
1051740300 9:20245150-20245172 CTCCTTGAGGGCAGGAACCATGG - Intergenic
1052997356 9:34558217-34558239 CTCAATGGAGGCAGGAACCGTGG + Intronic
1054379233 9:64471237-64471259 ATCCATGGGGGCAAGCACCAAGG + Intergenic
1056327062 9:85488931-85488953 CTCCATGAAGGCAGGAAGCTGGG + Intergenic
1056363531 9:85881764-85881786 CACCATGGGGACACGTGCCTTGG + Intergenic
1056935727 9:90913769-90913791 CTCCATGTGGGCAGCTTCATGGG - Intergenic
1058618436 9:106860485-106860507 TTCCCTGGGGGCAGGGACGTAGG - Intergenic
1059471815 9:114510804-114510826 CTCCAGGAGGGCAGGGACCATGG - Intergenic
1059669095 9:116476552-116476574 CTCCATGAGGGCAAATACTTTGG + Intronic
1061269428 9:129529119-129529141 AGCCATGGTGGCAGGTGCCTGGG + Intergenic
1061875147 9:133539869-133539891 CCCCAGGGCGGCAGGTACCCGGG - Exonic
1061880600 9:133567058-133567080 GCCCCTGGTGGCAGGTACCTGGG - Exonic
1062019218 9:134308526-134308548 CACCATGGGAGCAGATACCGTGG + Intergenic
1203462311 Un_GL000220v1:52700-52722 CTCCTTAGGGACAGTTACCTTGG + Intergenic
1185456652 X:314141-314163 CATCATGGGGTCAGGTAACTCGG - Exonic
1187157286 X:16732856-16732878 CCCCATGAGTGCAGGGACCTGGG - Intronic
1187933373 X:24313618-24313640 TTCCCTGGGGGCAGGTTTCTGGG - Intergenic
1187933409 X:24313784-24313806 TTCCCTGGGGGCAGGTTTCTGGG - Intergenic
1187933445 X:24313949-24313971 TTCCCTGGGGGCAGGTTTCTGGG - Intergenic
1187938854 X:24362436-24362458 TTCCCTGGGGGCAGGTTTCTGGG + Intergenic
1190524017 X:51310575-51310597 CTGCAGGGAGGCAGGTACCCTGG - Intergenic
1190921732 X:54859712-54859734 CTCCATGGGCGTAGGACCCTCGG + Intergenic
1191006045 X:55712426-55712448 CTCCATGGGAGCCATTACCTAGG - Intergenic
1192146796 X:68687931-68687953 CTCCAGGAAGGCAGGTACCCAGG + Intronic
1192626828 X:72737542-72737564 CTCCTTGAGGGCAGGAACCATGG + Intergenic
1194441539 X:93940094-93940116 CTCCATGGGCGTAGGACCCTCGG - Intergenic
1195296461 X:103482976-103482998 CTACATGGGGTCAGGTACACGGG + Intergenic
1195544485 X:106100074-106100096 CTACATGGAGGCAGGTATCCTGG - Intergenic
1196602123 X:117613863-117613885 GTCCATGGGGACAGGCACCGAGG - Intergenic
1199680021 X:150217846-150217868 CTACATAGGGGAAGGAACCTTGG - Intergenic
1202029225 Y:20554065-20554087 CTTCAAGGGCACAGGTACCTTGG + Intergenic