ID: 1004187061

View in Genome Browser
Species Human (GRCh38)
Location 6:13430075-13430097
Sequence CACCTTTTATAGCTGACCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 106}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004187061_1004187062 9 Left 1004187061 6:13430075-13430097 CCAAGGGTCAGCTATAAAAGGTG 0: 1
1: 0
2: 2
3: 7
4: 106
Right 1004187062 6:13430107-13430129 TCTGTGTAGCTGCACTCTGTAGG 0: 1
1: 0
2: 2
3: 10
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004187061 Original CRISPR CACCTTTTATAGCTGACCCT TGG (reversed) Intronic
900422364 1:2561109-2561131 CACCTTCAAATGCTGACCCTGGG + Intronic
901349348 1:8579292-8579314 AAACTTTAATAGCTGACTCTTGG + Intronic
902193614 1:14781445-14781467 CCCCTTCTGAAGCTGACCCTGGG - Intronic
904342279 1:29844466-29844488 CACTTCTTATAGAAGACCCTGGG - Intergenic
907157137 1:52344962-52344984 CAGCTTTTAAAGCTGGCCTTGGG + Intronic
913024910 1:114828334-114828356 CACCTTTTTTATCTGACTCTAGG - Intergenic
914807361 1:151001500-151001522 TAGCTTTTGTATCTGACCCTGGG - Intronic
917264624 1:173207305-173207327 CGCCTTTTATCTCTGGCCCTGGG - Exonic
921527465 1:216235454-216235476 CATATTATTTAGCTGACCCTTGG + Intronic
1074620983 10:115121791-115121813 CACCTTTAATAGCTGTACTTAGG + Exonic
1075678976 10:124318906-124318928 CACCTTTTATGCCTTAGCCTTGG - Intergenic
1078815648 11:14819709-14819731 CACCTTTTCTAGCTGCCCTCAGG - Intronic
1081424043 11:42905385-42905407 CACCTGTAATAGCAGCCCCTTGG + Intergenic
1083919230 11:65772419-65772441 CACCACTTATATCTGAACCTTGG + Intergenic
1086274306 11:85107002-85107024 CACGTATTTTAACTGACCCTTGG - Intronic
1088644067 11:111902196-111902218 CTCCTTTTTTTGCTAACCCTAGG + Intergenic
1088819404 11:113444632-113444654 CACCATTTATAGATGGCCCATGG - Intronic
1090018067 11:123103373-123103395 CAACTTTCATAGCTGGCTCTTGG - Intronic
1090414614 11:126532144-126532166 CACATTTTATAGATGAACCAAGG + Intronic
1091652493 12:2320295-2320317 CACCCTCTATAGCTGCCTCTTGG + Intronic
1095498867 12:42814696-42814718 CACCTTTTAAAAATGGCCCTAGG - Intergenic
1096117722 12:49065182-49065204 CTCCTCTTATAGCTGACTCAAGG - Exonic
1099469515 12:83030129-83030151 CACCCTTTACAGCTTATCCTTGG - Intronic
1099469611 12:83031350-83031372 CACCCTTTACAGCTTATCCTTGG - Intronic
1102005454 12:109586602-109586624 CACCTTTTGTAACTGAAGCTGGG + Intronic
1107010100 13:35661858-35661880 CAGATTTTATTTCTGACCCTGGG - Intronic
1108579439 13:51816138-51816160 TAGATTTTATAGCTGACCTTGGG + Intergenic
1108702670 13:52957041-52957063 CACTCTTTATAGCAGGCCCTGGG + Intergenic
1110439921 13:75516510-75516532 CCCTTTTAAGAGCTGACCCTAGG + Intergenic
1113913145 13:113854079-113854101 CACCTGTCACCGCTGACCCTGGG - Intronic
1115314600 14:32012895-32012917 CACCAATCATATCTGACCCTCGG - Intronic
1119885668 14:78139187-78139209 CACAATTTCTAGCTTACCCTGGG + Intergenic
1126332965 15:47553799-47553821 CACTTTTTATAGCAGAGCTTGGG - Intronic
1132283683 15:100643233-100643255 CACCTTTTATGACTTAGCCTTGG + Intronic
1132464155 16:70029-70051 CACATTTGCTAGCTGAGCCTTGG - Intronic
1133008607 16:2897971-2897993 CACCTGTTCTGGCTGACCCCAGG - Intronic
1133880894 16:9780607-9780629 CACATTTTATAGCTCAATCTGGG + Intronic
1137598031 16:49737784-49737806 ACCCTTTTCTAGCTGGCCCTTGG - Intronic
1138248241 16:55482920-55482942 CACCTTCTATGGCTGCCCCAAGG + Exonic
1139801296 16:69525195-69525217 AACTTTTAAAAGCTGACCCTGGG - Intergenic
1141842239 16:86580362-86580384 CAGCTTCTATAGCTGAACATTGG - Exonic
1144999356 17:19292626-19292648 CATCTTTTATACCTGATACTTGG - Intronic
1149661685 17:58337477-58337499 CACCTTTTCCAGCTGGTCCTGGG - Intergenic
1153751648 18:8238237-8238259 CACCTTTTGTAGTTGCCCCATGG + Intronic
1156266590 18:35494441-35494463 CTTCTTTTATTGCTGACCCCTGG - Intronic
1158546581 18:58403037-58403059 AACCTTTTAGGGCTGACCTTAGG + Intergenic
1159016294 18:63104162-63104184 CCCCTTTTGAAGCTGAGCCTCGG - Intergenic
1159755965 18:72366204-72366226 CACCTTTTATTTCTGAGCATAGG - Intergenic
1161642093 19:5430595-5430617 CACCCTTTATGGCTCAGCCTGGG + Intergenic
1161993347 19:7697788-7697810 CTGCTTTTATAGTTAACCCTGGG - Intronic
1164533952 19:29070424-29070446 CACCTTTCTTAGCTGCCCCATGG - Intergenic
929795546 2:45055883-45055905 CTCCTTGTATTGCTGACACTGGG + Intergenic
935060160 2:99600441-99600463 CAGCTTTTATAGCGGTGCCTTGG - Intronic
936486658 2:112931569-112931591 CAACTTTTATTTCTGTCCCTTGG + Intergenic
937251108 2:120524391-120524413 CACCTTTGATGGCTGACCCATGG - Intergenic
938754804 2:134369877-134369899 CTCCTATAATAGCAGACCCTAGG - Intronic
941541143 2:166786414-166786436 CCCCTTTTATTTCTGATCCTAGG - Intergenic
942646745 2:178119768-178119790 CACCTTTTGAAGCTCATCCTTGG + Intronic
943922532 2:193727778-193727800 CACCTTTCATAGGTTAGCCTGGG - Intergenic
945574566 2:211514602-211514624 CATCTTTTATAGTAGAGCCTAGG - Intronic
946503500 2:220274942-220274964 CTGCTTTTATAGCTGTCTCTAGG + Intergenic
946949149 2:224853672-224853694 CACCTTTTAAAACCTACCCTTGG + Intronic
1169602003 20:7272132-7272154 TACCTTTTATTGCTGACCAAAGG - Intergenic
1172982756 20:38956779-38956801 CACTTTTTATCCCTCACCCTTGG - Intergenic
1176513182 21:7763932-7763954 CACCTGTTTTAGCTGACACATGG + Intronic
1178647295 21:34394456-34394478 CACCTGTTTTAGCTGACACATGG + Intronic
951740303 3:25914165-25914187 CAACTTTTGTGCCTGACCCTAGG - Intergenic
954785079 3:53086815-53086837 CACCTTTGGGAGCTGACCCACGG - Intronic
957143016 3:76385466-76385488 CACCTTATCTACCTGACTCTAGG + Intronic
960534875 3:118804509-118804531 CAAGTTTTATAGCTGTACCTAGG + Intergenic
961427234 3:126857896-126857918 CATCTTTTAAAGCTGAACATGGG + Intronic
964630885 3:158808964-158808986 CACCTTTTATAACTGAGCCTTGG + Intronic
975614357 4:76231696-76231718 GACCTTTTAAAGCTGAGCCCAGG + Intronic
979314083 4:119239255-119239277 CACCTTTTATAACTTCACCTGGG + Exonic
980450317 4:132960456-132960478 CAGCTTCTACAGCTGACACTGGG - Intergenic
980720004 4:136683194-136683216 CCCCTTTTCTTGCTGACTCTAGG + Intergenic
981475474 4:145182427-145182449 CACCTGTTATATCTGACCCTGGG + Intergenic
981749543 4:148080946-148080968 AACGTTTTAAAGCTTACCCTTGG - Exonic
987427125 5:17786308-17786330 CACCTTTTAAACCTGTCCCGTGG + Intergenic
987590201 5:19915329-19915351 TTGCTTTTATAGCTGACCCTTGG + Intronic
991224465 5:64253779-64253801 GAGCTTTTATAGGTGACCTTGGG - Intronic
993363392 5:87005036-87005058 CAGCTTTTATAGCTGGCATTAGG - Intergenic
993502533 5:88679306-88679328 CACCTCTTGTTGCTGGCCCTGGG - Intergenic
995677643 5:114681235-114681257 CACCTTTTATAGCCTAACCTTGG + Intergenic
1001429667 5:171649255-171649277 CACTCTTTCTAGCTGAGCCTAGG - Intergenic
1002038328 5:176490596-176490618 TACCTTTTATATTGGACCCTTGG + Intronic
1004187061 6:13430075-13430097 CACCTTTTATAGCTGACCCTTGG - Intronic
1007072123 6:39045520-39045542 CACTTTTCATACCTGAGCCTCGG + Intergenic
1007272980 6:40652389-40652411 CACCTTTTATTGCCCAGCCTTGG + Intergenic
1008686243 6:53929156-53929178 TACCTTTAATAGCCTACCCTTGG + Intergenic
1011262890 6:85487009-85487031 GGCCTTTTATAACTGCCCCTGGG + Intronic
1012634614 6:101522203-101522225 CACCTGTTATCTCTGACCCAAGG + Intronic
1019497099 7:1345799-1345821 CACCTTTGATCTCTCACCCTGGG - Intergenic
1023349733 7:39308711-39308733 CACCTTTTTTGGCTGCCCCCAGG - Intronic
1028528875 7:91816304-91816326 CACCTTTTATGACTTAGCCTTGG + Intronic
1029633514 7:101768391-101768413 CACATGTTAGAGCTCACCCTTGG + Intergenic
1029696083 7:102214192-102214214 CACCTTTTATCTCTGAGCCTTGG - Intronic
1031876786 7:127150797-127150819 CACCATTCTCAGCTGACCCTTGG + Intronic
1032694044 7:134317897-134317919 AACCTTTTATAGTAGACACTGGG - Intergenic
1036567086 8:9946871-9946893 GACTTTTTATAACTGACTCTTGG + Intergenic
1041082554 8:54227223-54227245 CACCTTTTGTGGGTGACCCCAGG - Intergenic
1044183718 8:89226349-89226371 CACCTTTTACAGCTTGTCCTTGG - Intergenic
1045340206 8:101246999-101247021 CTGCTTATAGAGCTGACCCTTGG - Intergenic
1046502175 8:115092864-115092886 CACCTTTTGTAGTTGGCCCACGG + Intergenic
1049245390 8:141559684-141559706 CACCCTTCATAGCTGAGCCAGGG + Intergenic
1056281093 9:85041838-85041860 CATCTGTTATTGCTGACCCAGGG + Intergenic
1056988905 9:91391290-91391312 CACCTCTGGGAGCTGACCCTGGG - Intergenic
1057334364 9:94144185-94144207 CACCTTGTAGATCTGAACCTGGG + Intergenic
1059497139 9:114719210-114719232 CACCTTCTAGCGCTGACCTTGGG - Intergenic
1189161450 X:38813324-38813346 CACCTTTTATAGCCTGGCCTTGG - Intergenic
1190835195 X:54094404-54094426 CTCCTTTTCTATGTGACCCTGGG + Intronic
1192866710 X:75141576-75141598 CAGCTTTTGTATCTGACACTGGG - Intronic
1193887179 X:86996888-86996910 AACCCTTTATTGTTGACCCTTGG + Intergenic
1196093297 X:111770704-111770726 CAACTCTTAAAGCTGACCCTTGG - Intergenic
1196634577 X:117987360-117987382 CTCCTATTAAAGCTCACCCTTGG - Intronic
1200115580 X:153768409-153768431 CACCTTGTACAGCTGGCCCTGGG - Exonic