ID: 1004193946

View in Genome Browser
Species Human (GRCh38)
Location 6:13487582-13487604
Sequence TCCCAGAGCCTGAGCCGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 317}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004193946_1004193952 -6 Left 1004193946 6:13487582-13487604 CCAGGCCGGCTCAGGCTCTGGGA 0: 1
1: 0
2: 0
3: 28
4: 317
Right 1004193952 6:13487599-13487621 CTGGGATCCCGCGGGGACGAGGG 0: 1
1: 0
2: 0
3: 7
4: 91
1004193946_1004193953 -3 Left 1004193946 6:13487582-13487604 CCAGGCCGGCTCAGGCTCTGGGA 0: 1
1: 0
2: 0
3: 28
4: 317
Right 1004193953 6:13487602-13487624 GGATCCCGCGGGGACGAGGGCGG 0: 1
1: 0
2: 0
3: 9
4: 127
1004193946_1004193957 12 Left 1004193946 6:13487582-13487604 CCAGGCCGGCTCAGGCTCTGGGA 0: 1
1: 0
2: 0
3: 28
4: 317
Right 1004193957 6:13487617-13487639 GAGGGCGGAGTTGGCGAGTTTGG 0: 1
1: 0
2: 0
3: 7
4: 125
1004193946_1004193956 3 Left 1004193946 6:13487582-13487604 CCAGGCCGGCTCAGGCTCTGGGA 0: 1
1: 0
2: 0
3: 28
4: 317
Right 1004193956 6:13487608-13487630 CGCGGGGACGAGGGCGGAGTTGG 0: 1
1: 0
2: 2
3: 23
4: 270
1004193946_1004193951 -7 Left 1004193946 6:13487582-13487604 CCAGGCCGGCTCAGGCTCTGGGA 0: 1
1: 0
2: 0
3: 28
4: 317
Right 1004193951 6:13487598-13487620 TCTGGGATCCCGCGGGGACGAGG 0: 1
1: 0
2: 0
3: 5
4: 99
1004193946_1004193958 22 Left 1004193946 6:13487582-13487604 CCAGGCCGGCTCAGGCTCTGGGA 0: 1
1: 0
2: 0
3: 28
4: 317
Right 1004193958 6:13487627-13487649 TTGGCGAGTTTGGCTGTCAGCGG 0: 1
1: 0
2: 0
3: 2
4: 97
1004193946_1004193959 26 Left 1004193946 6:13487582-13487604 CCAGGCCGGCTCAGGCTCTGGGA 0: 1
1: 0
2: 0
3: 28
4: 317
Right 1004193959 6:13487631-13487653 CGAGTTTGGCTGTCAGCGGCCGG 0: 1
1: 0
2: 0
3: 1
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004193946 Original CRISPR TCCCAGAGCCTGAGCCGGCC TGG (reversed) Intronic
900019923 1:181260-181282 TCTCTGCGCCTGCGCCGGCCCGG - Intergenic
900090107 1:916553-916575 CCCCAGAGCCTGCTCAGGCCTGG - Intergenic
900373332 1:2342150-2342172 ACCGAGAGGCTGAGCCAGCCCGG + Intronic
900399234 1:2466243-2466265 TCCCAGGGCCTGTGTCCGCCTGG - Intronic
900474408 1:2869477-2869499 TCCCAGAGCCTGGCCTGGCACGG + Intergenic
900493800 1:2967055-2967077 CCCCAGTGCCTGACCCGGCTGGG - Intergenic
900923026 1:5685637-5685659 GCCCAGTGCCTGGCCCGGCCCGG - Intergenic
901202491 1:7474642-7474664 TCCCAAAGCCTGAGCCAGGCAGG + Intronic
902522373 1:17027247-17027269 TCCCAGAGAGTGAGCAGGCCAGG + Intronic
902977236 1:20097887-20097909 TCCCAGAACCTGGACCAGCCAGG + Intergenic
903377736 1:22876999-22877021 TCCCAGAGCTGGGGCGGGCCGGG + Intronic
903739819 1:25552276-25552298 TGCCAGAGCCTCAGCTGCCCTGG + Intronic
903907310 1:26696219-26696241 GCCCGGAGCCTGAGCCGGCGGGG + Exonic
905315028 1:37076972-37076994 ACCCAGAGCCAGAGGAGGCCAGG - Intergenic
905321878 1:37123415-37123437 TCCCAGAGTCAGTGCTGGCCTGG + Intergenic
905664201 1:39752801-39752823 TCCCCGAGTCTGAGCCTGACTGG + Intronic
906636786 1:47415717-47415739 TCCCAGAGACAAAACCGGCCTGG + Intergenic
908434664 1:64093301-64093323 CCCCAGAGCCAGAGGCAGCCTGG - Intronic
910722635 1:90303529-90303551 TACCAGCGCCTGAGGTGGCCTGG + Intergenic
911729808 1:101281256-101281278 TCCCAGAGCCTGAGGAGTCCAGG - Intergenic
912270101 1:108200141-108200163 TCCCAGAGGCGCAGGCGGCCTGG + Exonic
914947314 1:152079026-152079048 TCCCATACCGTGAGGCGGCCAGG + Intergenic
917345069 1:174021752-174021774 TCCCAGGGCCTGGGCCAGGCGGG - Intronic
917487051 1:175464986-175465008 GCACTGAGCCTGAGCAGGCCTGG + Intronic
919031787 1:192251796-192251818 TCCCTGAGCCTGAGCCCACAGGG - Intergenic
919757487 1:201074995-201075017 TGGCAGTGCCTGAGCCGTCCTGG - Intronic
920189392 1:204183025-204183047 ACACAGAGCTTGAGCTGGCCTGG - Intergenic
920722716 1:208402558-208402580 TCTCAGAGCCTGGACAGGCCTGG - Intergenic
921069562 1:211647955-211647977 GCCCAGAGCTTGATCAGGCCAGG - Intergenic
922764955 1:228151853-228151875 TCCCAGGGCCTGGGCTGTCCAGG + Intronic
924469218 1:244325110-244325132 TCCCTGAGCCTGCTCTGGCCTGG - Intergenic
1064030534 10:11880161-11880183 TCCCCGAGGCTGGGCAGGCCTGG + Intergenic
1064340210 10:14478679-14478701 TGCCAGAGCCTCAGCAGGGCAGG + Intergenic
1067029502 10:42870918-42870940 TGGCAGAGCCAGGGCCGGCCTGG + Intergenic
1069074914 10:64029016-64029038 TCCCAGAGCCTGAAAAGGCATGG - Intergenic
1069928131 10:71865457-71865479 TCCCAGAGCCTGTGCATCCCAGG + Intergenic
1069944614 10:71977267-71977289 GCCCAGAGCCTGAGACTGCTAGG - Intronic
1070305043 10:75234807-75234829 TCACAGAGCCCGGGCCGGCCTGG - Intronic
1072288307 10:93938622-93938644 TCCCAGAGACTGAGGCTGCAGGG - Intronic
1073099775 10:101000379-101000401 TCCAAGAGCGGGAGCCGGCCTGG + Exonic
1073363351 10:102917918-102917940 TCCCGGAGCCTGGACCGGCCAGG - Intergenic
1074003377 10:109393961-109393983 TCCCTGAGCCTGAGCCCGTAGGG + Intergenic
1075082126 10:119391253-119391275 CCCCAGAGCTTGTGCCCGCCTGG - Intronic
1075347535 10:121695046-121695068 TGCCGGAGCCTGAGCCTGCCTGG + Intergenic
1075419011 10:122287063-122287085 TCCCTGAGCCTGAGCCTGGAGGG + Intronic
1075661488 10:124200014-124200036 TCCAGCAGCCTGAGTCGGCCAGG + Intergenic
1076402088 10:130190968-130190990 TCCCCAAGCCTGGGCCGGCTTGG + Intergenic
1076514475 10:131036138-131036160 TCCCAGGGCCTGAGGCAGGCTGG + Intergenic
1076584180 10:131533920-131533942 TCCCAGAGCATCAGCCTGGCAGG + Intergenic
1077021036 11:417251-417273 TCCCAGAGCCGCTGCAGGCCTGG - Intronic
1077036499 11:497992-498014 TGCCAGGGCCTGGGCCAGCCTGG - Exonic
1077463402 11:2722094-2722116 TCCCATACCCTGTGCCTGCCAGG - Intronic
1078066212 11:8081118-8081140 CCGCAGGCCCTGAGCCGGCCGGG + Intronic
1079001458 11:16760670-16760692 TCCCAGTGCCTAAGACTGCCTGG - Intergenic
1079127810 11:17731225-17731247 GCCCAGAGCCTCAGCCCTCCTGG - Intergenic
1079535791 11:21513873-21513895 TCTTAGAGCCTGAGCCCCCCTGG + Intronic
1080268647 11:30426945-30426967 TACCAGAGACTGAGCCTGCAAGG + Intronic
1081131617 11:39388153-39388175 TCCCAGAGGTTGAGGCGGCAGGG - Intergenic
1083253490 11:61482751-61482773 GCCCATAGCCTGAGCTGGTCTGG - Exonic
1084568967 11:69948379-69948401 TCCCAGAGCCTGTGCTGGGTGGG + Intergenic
1088883153 11:113987275-113987297 TCCCAGAGGCTGAGCATGTCAGG + Intronic
1090807685 11:130212616-130212638 TCCAAGAGCCTGAGCTGACAGGG + Intergenic
1095812235 12:46383460-46383482 TCCGAGCGCCAGAGCCGCCCGGG + Intergenic
1096630119 12:52921110-52921132 TCCCTGAGGCTAAGCTGGCCTGG - Intronic
1096652970 12:53071182-53071204 TGCTGGAGCCTGAGCTGGCCAGG - Intronic
1097191264 12:57220666-57220688 TCCCACAGCCTGATCCTGCCTGG + Intronic
1098963782 12:76764517-76764539 TCCCAGAGCCCGCCCCGGTCGGG - Intronic
1101875153 12:108592522-108592544 TCCCAGGGCCTGAGCCCCGCTGG + Intronic
1102261230 12:111444740-111444762 GGCCAGAGCCTGAGCTGTCCAGG + Intronic
1103284785 12:119791497-119791519 GCCCAGAGCATGAACTGGCCTGG - Intronic
1104620473 12:130308117-130308139 TCCCAGAGCTGCAGACGGCCAGG - Intergenic
1104789343 12:131472147-131472169 TCCCTGAGGATGAGCCGGGCTGG - Intergenic
1104889293 12:132132623-132132645 TCCCAGGGGCTGCGCCGGGCAGG - Intergenic
1104962738 12:132495866-132495888 TCCCAGAGCCAAAGCAGGCCAGG - Intronic
1106087716 13:26558022-26558044 TGCCAGCGCGGGAGCCGGCCGGG - Intronic
1106628422 13:31444379-31444401 TCCCAGAGGCTCAGAGGGCCAGG - Intergenic
1111848875 13:93547033-93547055 TCACCAAGACTGAGCCGGCCAGG + Intronic
1113666238 13:112143617-112143639 CCCCTGAGCCGGAGCAGGCCAGG + Intergenic
1113794016 13:113046334-113046356 TCCCAGAGCCTGGGAGGGACGGG - Intronic
1114549580 14:23525259-23525281 TCCCAGAGCCTGAGGCAGGGGGG - Exonic
1115198901 14:30832877-30832899 TCCCAGAGCTTTAGGAGGCCAGG + Intergenic
1118305547 14:64652051-64652073 TCCCATAGGCTGAGGTGGCCTGG + Intergenic
1119379884 14:74221778-74221800 TCCCACAGCCTGGGCTGGTCTGG - Intergenic
1119420031 14:74502988-74503010 TCCCAGAGACAAAGCCAGCCAGG - Intronic
1119475151 14:74922849-74922871 ACCCACAGCCTCAGCCGGCGGGG + Intronic
1119533641 14:75381844-75381866 TCCCAGAGCCTTAGCCCCCCTGG + Intergenic
1121429413 14:93876470-93876492 TGCCAGGGCCTGGGCCTGCCTGG + Intergenic
1122009992 14:98738375-98738397 TACCAGAGCTTGAGGAGGCCAGG - Intergenic
1122746446 14:103899808-103899830 GGGGAGAGCCTGAGCCGGCCAGG + Intergenic
1124142932 15:27093257-27093279 TGTCAGAGCCTGAGTCAGCCTGG - Intronic
1124512139 15:30336507-30336529 TCCCAGAGCCTGCTCAGGTCAGG + Intergenic
1124591930 15:31061326-31061348 TGCTAGACCCTGAGCCAGCCAGG - Intronic
1124730775 15:32194244-32194266 TCCCAGAGCCTGCTCAGGTCAGG - Intergenic
1125726063 15:41868696-41868718 TCACACAGCCCGAGCCGACCTGG + Intronic
1126410814 15:48371342-48371364 TCCCAGAGCCTGACCTGGAATGG + Intergenic
1126792142 15:52231156-52231178 ACCCACAGCCTGAGCTGGTCAGG + Intronic
1127045137 15:55017518-55017540 TATAAGACCCTGAGCCGGCCGGG - Intergenic
1127975041 15:63990895-63990917 TCCCACAGCCACAGCCTGCCTGG + Intronic
1127993476 15:64137504-64137526 TGGCAGAGCCTAAGCCAGCCTGG - Intronic
1128512963 15:68325041-68325063 GCCCAGAGCCTGAGTGTGCCGGG - Intronic
1128529195 15:68432247-68432269 GCCCAGAGCCCGAGCCGGAGTGG - Intergenic
1130149936 15:81303797-81303819 TCCCAGAGCCTGGGGCTGCGTGG + Intronic
1132541131 16:510343-510365 TCAGAGGGCCTGAGCCCGCCAGG - Intronic
1132556897 16:576491-576513 CCCCAGAGCCTCAGCCCGGCTGG - Intronic
1132648409 16:1009681-1009703 CCCCAGAGCCTGGGGCTGCCTGG - Intergenic
1132831587 16:1930747-1930769 TCCCTGAGCCTCAGCCTCCCAGG + Intergenic
1132854923 16:2040453-2040475 TCCCATCACCTGAGCCAGCCTGG + Intronic
1132904671 16:2276426-2276448 TCCCAGAGCTGGGGCAGGCCGGG - Exonic
1132973026 16:2698202-2698224 TCCCAGAGTCTGGGCCGGGCAGG - Intronic
1133188190 16:4115452-4115474 TCCCGGGGCCTGCCCCGGCCGGG + Exonic
1133338857 16:5023806-5023828 TCCCTGAATCTGAGCTGGCCTGG + Intergenic
1135074554 16:19382289-19382311 ACCCAAAGCCTGAGCTGACCTGG + Intergenic
1135396818 16:22138140-22138162 GCCCAGAGCCTGTGCCTCCCAGG + Intronic
1136583934 16:31171425-31171447 ACCCAGAGCCTGTCCTGGCCAGG - Intergenic
1136672716 16:31873056-31873078 CCACAGAGCCTGAGCCAGCACGG + Intergenic
1137738494 16:50742341-50742363 TGCCCGGGCCCGAGCCGGCCGGG + Intronic
1138829213 16:60358124-60358146 TCCCATACCGTGAGGCGGCCGGG + Intergenic
1139470362 16:67174955-67174977 GCCCAAACCCTGAGCCGGCTTGG + Intronic
1139479838 16:67224405-67224427 TCCCAGAGCCTGAGCCATGAGGG - Intronic
1139505169 16:67394966-67394988 TCCCAGAGCAGGACCCGGACAGG + Intronic
1140951892 16:79826276-79826298 TCCAACAGCCTCAGCTGGCCAGG - Intergenic
1141556544 16:84840186-84840208 TGCCACAGGCTGAGCTGGCCTGG + Intronic
1142263864 16:89054660-89054682 TCCCAGAGCCTCCTCCAGCCTGG - Intergenic
1142413163 16:89926278-89926300 TCCCATTGGCTGAGACGGCCAGG - Intronic
1142743481 17:1943410-1943432 TCCCTGTGCCTGAGCAGGGCTGG + Intronic
1142874702 17:2844574-2844596 TCCCAGAGCTTCACCCAGCCGGG - Intronic
1144445483 17:15323377-15323399 TCCCAGAGCCAGACCAGGGCAGG + Intronic
1146842616 17:36166322-36166344 TCCCTGAGCCAGGGCCGGGCTGG + Exonic
1146854928 17:36254281-36254303 TCCCTGAGCCAGGGCCGGGCTGG + Exonic
1146865692 17:36334095-36334117 TCCCTGAGCCAGGGCCGGGCTGG - Exonic
1146870828 17:36378173-36378195 TCCCTGAGCCAGGGCCGGGCTGG + Exonic
1146878187 17:36429255-36429277 TCCCTGAGCCAGGGCCGGGCTGG + Exonic
1146882136 17:36450401-36450423 TCCCTGAGCCAGGGCCGGGCTGG + Intergenic
1147068561 17:37934707-37934729 TCCCTGAGCCAGGGCCGGGCTGG - Exonic
1147073712 17:37978797-37978819 TCCCTGAGCCAGGGCCGGGCTGG + Intronic
1147080084 17:38014244-38014266 TCCCTGAGCCAGGGCCGGGCTGG - Intronic
1147085233 17:38058335-38058357 TCCCTGAGCCAGGGCCGGGCTGG + Exonic
1147096033 17:38138204-38138226 TCCCTGAGCCAGGGCCGGGCTGG - Intergenic
1147101180 17:38182301-38182323 TCCCTGAGCCAGGGCCGGGCTGG + Intergenic
1149845778 17:60008807-60008829 TCCCTGAGCCAGGGCCGGGCTGG + Intergenic
1150084126 17:62265387-62265409 TCCCTGAGCCAGGGCCGGGCTGG + Intergenic
1151657494 17:75502660-75502682 TCCCACAGCCTAAGCCGCCCTGG - Exonic
1151885563 17:76921458-76921480 ACCCAGATCCAGAGCCGGGCAGG - Intronic
1151961402 17:77407810-77407832 ACCCAGAGCCTGAGAGGACCAGG - Intronic
1152044551 17:77927471-77927493 TCCCAGCCCCTGAGCAGCCCTGG - Intergenic
1152078446 17:78172276-78172298 TCCCACGGCCTGACCCGGGCCGG - Exonic
1152217600 17:79042793-79042815 CCCCAGAGCCTCAGCCAGTCAGG - Intronic
1152438020 17:80288071-80288093 TCCCAAAGCCTGGGCCTGCAGGG - Exonic
1152592068 17:81218640-81218662 TCCCAAAGCCTGGGCCAGCAGGG - Intronic
1152753701 17:82078182-82078204 TCCCAGAGCCGGGGCTGGGCCGG - Intergenic
1152927298 17:83093114-83093136 TTCCAGAGCCTGTCCCGTCCAGG + Intronic
1154176445 18:12089166-12089188 TCCCAGACCCTGGCCCTGCCAGG + Intergenic
1154383252 18:13871172-13871194 TCCCAGAGCCAGGGCAGCCCCGG + Intergenic
1157301090 18:46479935-46479957 ACCCAGAGCCAGAGCCTGCCTGG + Intronic
1160511159 18:79454314-79454336 ACGCAGAGGCTGAGCTGGCCTGG - Intronic
1160566531 18:79789673-79789695 GCGGGGAGCCTGAGCCGGCCGGG - Intergenic
1160660441 19:295714-295736 CCCCAGAGCCTCAGCCTCCCAGG - Intergenic
1160837343 19:1131161-1131183 TGCAGGAGCCTGGGCCGGCCTGG - Intronic
1160952176 19:1672885-1672907 TCAAAATGCCTGAGCCGGCCAGG - Intergenic
1161144651 19:2670535-2670557 TCCCAGACCCTGAGCTGCCTCGG + Intronic
1161357567 19:3827441-3827463 TGGCAGAGCCTGGGCCGGGCGGG + Intronic
1162110689 19:8398087-8398109 CCCCAGAGCCTGGGGCGGCTGGG + Intronic
1162139223 19:8575885-8575907 TCCCAGGACCTGAGCCTCCCTGG + Intronic
1163798282 19:19349577-19349599 TCCCACAGCCTGGGCAGGCAGGG + Intronic
1163838728 19:19592774-19592796 TCCTAGACCCTGCGCTGGCCAGG + Intronic
1164802915 19:31092542-31092564 TTCCAGCGCCTGAGCCTGCCAGG + Intergenic
1165286958 19:34850606-34850628 TCCCAGAGCTTGAGTCTTCCAGG + Intergenic
1165308048 19:35014087-35014109 TTCCAGAGCCTGTGCAGACCCGG - Intronic
1166967043 19:46535279-46535301 CCCCAGACCCTGAGGAGGCCAGG - Intronic
1167247661 19:48383389-48383411 TCCCACAGCCAGAGCAGGGCAGG + Intronic
1167925902 19:52820989-52821011 TCCCAGAGCTGGAGCTGGGCGGG + Intronic
1202647092 1_KI270706v1_random:152770-152792 TGCCAGACCCTGCCCCGGCCCGG + Intergenic
925318107 2:2940446-2940468 CCCCAGAGCCTGCCCCTGCCAGG + Intergenic
925318148 2:2940571-2940593 CCCCAGAGCCTGTCCCTGCCAGG + Intergenic
925764092 2:7214295-7214317 CCCCAGAGCCTCAGCTGTCCTGG + Intergenic
926750866 2:16197555-16197577 CCCCAGAGCCAGATGCGGCCTGG - Intergenic
927910974 2:26899549-26899571 TCCCAGAGCCTGGACTGACCTGG + Intronic
927971173 2:27307086-27307108 TCCCAGAACCTGAGACCGTCTGG + Exonic
928386167 2:30870209-30870231 TCCCAGAGCCTCAGCTGCCTAGG + Intergenic
929452805 2:42048127-42048149 CCTCGGAGCCTGAGCCGCCCGGG + Exonic
932311598 2:70746823-70746845 ACCCACAGCCTGGGCCTGCCAGG + Intronic
933633644 2:84683252-84683274 TCCCAGTGCCTAATCGGGCCTGG + Intronic
937268823 2:120634093-120634115 TCCCAGCTCTTGAGCTGGCCTGG - Intergenic
938246224 2:129779914-129779936 TCCCAGAGCCTGCTCCAGTCTGG + Intergenic
938408355 2:131045039-131045061 TCCCAGACCAAGAGCCGACCTGG - Intronic
946185643 2:217979034-217979056 TCCCAGAGCCAGAGCCCCTCCGG + Intronic
946327661 2:218993124-218993146 TCCCAGAGCGTGAGGCTGGCGGG + Exonic
946399728 2:219461951-219461973 TCCCAGAGCCTGGGGAGACCTGG + Exonic
948461100 2:238130417-238130439 TCCCAGCGGCTGAGCCCGCAGGG + Exonic
1169244506 20:4015282-4015304 TCCCGGCGCCTCGGCCGGCCGGG - Intronic
1171225428 20:23438480-23438502 TCCCTGAGCCTGAGCTGCCGAGG - Intergenic
1172287783 20:33753283-33753305 CCCCAGAGCCTGGGCCCCCCTGG + Exonic
1172293197 20:33790685-33790707 TCCCTGAGCCTGAGATGACCTGG + Intronic
1172801417 20:37578987-37579009 GCACAGAGGCTGAGCTGGCCTGG - Intergenic
1172838722 20:37889116-37889138 TTCCAGAGCAGGAGCCAGCCGGG - Intergenic
1172963390 20:38814745-38814767 CCCCAGAGTCTGTGCCAGCCTGG + Intronic
1173390350 20:42626657-42626679 TCACAGGGCCTGAGCCAGCTCGG + Intronic
1174302844 20:49594770-49594792 TCCCAGTGCCTGATACAGCCTGG - Intergenic
1174550277 20:51357062-51357084 TCCCAGAGCCTGAGCAGCCAGGG + Intergenic
1175210951 20:57354363-57354385 TCCCAGGGCCTGGCCCAGCCAGG + Intronic
1175256823 20:57652740-57652762 GCCCAGAGCCTGATCCCGCGGGG + Intronic
1175273211 20:57749255-57749277 TCCCAGGGCCTGAGAGGGCAAGG + Intergenic
1175277750 20:57783483-57783505 TCCGAGAGCCTGGGCTGTCCTGG + Intergenic
1175806035 20:61829908-61829930 TCCCAGCCCCAGGGCCGGCCGGG - Intronic
1176017930 20:62946309-62946331 TGCCAGTACCTGAGCCGGTCGGG + Exonic
1176024486 20:62978782-62978804 TCCCGCAGCCTGAGCCAGCATGG + Intergenic
1176289752 21:5037751-5037773 CCCCAGGGCCTGGGCCTGCCTGG - Intronic
1176858125 21:13986881-13986903 TCCCAGACCCTGGCCCTGCCAGG + Intergenic
1176866450 21:14057270-14057292 TCCCAGACCCTGGCCCTGCCAGG - Intergenic
1179552158 21:42150424-42150446 TCCCAGAGCCAGGGCAGGCATGG - Intergenic
1179867478 21:44225836-44225858 CCCCAGGGCCTGGGCCTGCCTGG + Intronic
1180160755 21:45997798-45997820 TCCCAGGGCCTCTGGCGGCCAGG - Intronic
1180354813 22:11829699-11829721 TGCCAGACCCTGTCCCGGCCCGG - Intergenic
1180383438 22:12162632-12162654 TGCCAGACCCTGTCCCGGCCCGG + Intergenic
1180877119 22:19179703-19179725 TCCCAGAGCCTGGGGAGGCCAGG - Exonic
1181756411 22:25028101-25028123 CCCCAGAGGCTTCGCCGGCCTGG - Exonic
1183234922 22:36609986-36610008 TCCCAGAGCGTGATCAGGCAGGG + Intronic
1183452906 22:37906390-37906412 AGCCAGAGCCGGAGCCGGGCGGG + Exonic
1183515746 22:38264889-38264911 TCCCACTGACTGAGACGGCCAGG + Intronic
1183524949 22:38317322-38317344 GCCCAGAGCCAGAGCCCGGCCGG - Exonic
1183736982 22:39649652-39649674 TCCCGGAGCCCGAGCCCTCCTGG - Exonic
1183824085 22:40371049-40371071 TCCCGGTGCCAGAGCCAGCCAGG - Intronic
1184388384 22:44189025-44189047 TCCAGGAGGCTGAGCCTGCCTGG - Intronic
1184514611 22:44954343-44954365 TCCCTGAGCGTGAGAGGGCCTGG - Intronic
1184735280 22:46394362-46394384 TCCCAGAGCTGGACCCAGCCAGG - Intronic
1185092539 22:48784134-48784156 TCCCTGAGCCTGCGGGGGCCTGG + Intronic
1185317040 22:50183751-50183773 TCCCTGAGCATAAGCAGGCCTGG + Intergenic
950206975 3:11088388-11088410 TCCCAGATCCTGGGCAAGCCGGG - Intergenic
950545327 3:13634777-13634799 GCCCAGAGTCTGAGGCGGTCCGG + Intronic
951043280 3:18011612-18011634 CCCCAGAGCCTCACCTGGCCAGG - Intronic
951059467 3:18188460-18188482 CCCCAGATCCTGAGCCATCCTGG + Intronic
953912493 3:46900004-46900026 TCCCAGAGCCTGTGGGGGGCTGG - Intronic
954801368 3:53188958-53188980 GCCCATAGGCTGAGGCGGCCTGG + Intronic
954879505 3:53823900-53823922 TCTCAGAGCCTGCGCTGGCCAGG + Exonic
956392533 3:68788873-68788895 TCCCAGAGCCTTGGAAGGCCAGG - Intronic
958732285 3:97972334-97972356 TCCCAGCGCCGGGGCAGGCCGGG - Exonic
959849703 3:111071944-111071966 GCCCAGAGCCTGAGGCGCCGGGG + Exonic
965390385 3:168096074-168096096 TCCCAGTGCCGGGGCCGGCTAGG + Intergenic
967198015 3:187046146-187046168 TACCACAGCCTGGGCAGGCCTGG - Intronic
968001054 3:195207084-195207106 TACCACAGGCTGAGCCAGCCTGG + Intronic
968458306 4:710174-710196 TCCCTGAGCCAGAGCCCACCTGG - Intronic
968462674 4:733103-733125 TCCCAGAGCCTGAGGCAGCACGG - Intronic
968488814 4:878850-878872 TCCCGGAGCTTGTGCGGGCCAGG + Intronic
968666547 4:1825462-1825484 TCCCAAACTCTGGGCCGGCCTGG - Intronic
969465568 4:7354336-7354358 TCCCAGGTCCAGAGCCTGCCAGG + Intronic
972643133 4:40943473-40943495 TCCTAGAAGCTGAGCCGGCCAGG - Intronic
972686879 4:41360698-41360720 TCCCGGGACCTGCGCCGGCCGGG + Intronic
973339097 4:48986181-48986203 TGCCAGAGCCTGGCCAGGCCGGG - Intergenic
973373347 4:49270933-49270955 TGCCAGACCCTGCCCCGGCCCGG + Intergenic
973387661 4:49524275-49524297 TGCCAGACCCTGCCCCGGCCTGG - Intergenic
973533066 4:51852108-51852130 TCCCAGATCCTGATCCTGCTGGG - Intronic
973551334 4:52038419-52038441 CCGCAGAGCCTGAGCCCGCAGGG - Exonic
980024584 4:127749754-127749776 TCCCAGATCCTGAGGAGGCTGGG + Intronic
982860336 4:160440789-160440811 TCCCGGAGGCTGAGGCGGGCAGG - Intergenic
983649764 4:170026420-170026442 TACAGGAGCCTGGGCCGGCCGGG + Intronic
984884985 4:184442089-184442111 TTCCAGCTCCTGAGCTGGCCCGG + Intronic
984908247 4:184649301-184649323 TCCCAGGCCCTGCGCCCGCCCGG - Intronic
989168146 5:38450367-38450389 TCCCAGAGCCTGAGCTCGTCAGG - Intronic
997195580 5:131977091-131977113 TCCCTGGGCCTGAGTGGGCCTGG + Intronic
997337465 5:133118373-133118395 TCCCACAGCCTGACCTGCCCTGG + Intergenic
997980488 5:138465140-138465162 TCCCAGAGCCGGAAGCGGCCGGG - Intergenic
1002136312 5:177110035-177110057 AGCCGGAGCCGGAGCCGGCCAGG - Intergenic
1002402053 5:178996361-178996383 TCCGAGGGCCTGAGCCGGCTTGG + Intergenic
1002445199 5:179286411-179286433 TCCCAGAGACAGAGCCGGCACGG + Intronic
1002784502 6:391611-391633 GCCGAGAGCCGGGGCCGGCCGGG - Intergenic
1004193946 6:13487582-13487604 TCCCAGAGCCTGAGCCGGCCTGG - Intronic
1005855950 6:29863588-29863610 TCCCAGAGCTGGAGACGCCCAGG - Intergenic
1006350098 6:33514644-33514666 TTCCAAAGCATGTGCCGGCCGGG + Intergenic
1006453892 6:34121333-34121355 TTCCAGAGCCTGAGCTGGGAAGG + Intronic
1006565526 6:34953306-34953328 TTGAAGAGCCTGACCCGGCCTGG + Intronic
1007414354 6:41683356-41683378 TGCCAGAGCCAGAGCGGGGCGGG + Intergenic
1007681494 6:43636643-43636665 TCCCAAAGCCTGTGCCTACCTGG - Exonic
1009398315 6:63228236-63228258 TCCCAGAGAGTGAGGAGGCCAGG + Intergenic
1009398352 6:63228436-63228458 TCCCATACCGTGAGGCGGCCAGG + Intergenic
1011617745 6:89212553-89212575 TCCCACAGCCTGAGCTGGCATGG + Intronic
1013251852 6:108342217-108342239 TCCCACAGGCTGAACCAGCCAGG + Intronic
1016653985 6:146496625-146496647 TGCCATAGCCTGAGCCAGTCAGG - Intergenic
1016938555 6:149466303-149466325 CCACAGAGCCTGAGTCGCCCAGG + Intronic
1017147533 6:151248237-151248259 TCCCAGACCCTGAGATTGCCTGG - Intronic
1017282185 6:152637032-152637054 GCCCAGAGGCTGAACCGGCCTGG - Intronic
1019179586 6:170177944-170177966 CCCCTGACCCTGAGCTGGCCGGG + Intergenic
1019275427 7:173176-173198 TCCGAGAGCCTCAGCTGGACTGG - Intergenic
1019350914 7:553562-553584 CCCCACAGCCCCAGCCGGCCTGG + Intronic
1019426488 7:979783-979805 TCCCAGAGACTGAGCAGGCATGG - Intergenic
1019485276 7:1286318-1286340 TCGCTGAGCCTGAGGCCGCCCGG - Intergenic
1019516599 7:1442876-1442898 TGTCAGAGGCTGGGCCGGCCTGG + Intronic
1019539528 7:1545534-1545556 GCCCAGTGCCTGAGCCCCCCAGG + Exonic
1021099992 7:16576838-16576860 TCACAGAGCCTGGGCCTGGCAGG + Intronic
1022693139 7:32677680-32677702 TCCCAGATCCAGAGCTGCCCAGG + Intergenic
1022920814 7:35012240-35012262 TCCCAGATCCAGAGCTGCCCAGG + Intronic
1024212022 7:47214258-47214280 GCACAGAGTCTGAGCCAGCCTGG - Intergenic
1026104954 7:67413564-67413586 TCCCCAAGCCTGAGCTGGGCAGG + Intergenic
1026965272 7:74435369-74435391 ACCCAGAGTCTGAGGCTGCCAGG - Intergenic
1028621458 7:92833444-92833466 CCCGAGCGCCTGAGCCGGCGGGG - Exonic
1028790683 7:94849839-94849861 TCCCAGAGGGTGGGGCGGCCAGG + Intergenic
1028790744 7:94850075-94850097 TCCCAGACCATGGGGCGGCCGGG + Intergenic
1029210996 7:98908266-98908288 TGCCAGATCCTGGGCCTGCCAGG - Intronic
1031313878 7:120232903-120232925 TACCAGAACCTGAACCTGCCTGG - Intergenic
1032096170 7:128939396-128939418 CCCCAGAGCCTCAGCCTGTCTGG + Intronic
1033514719 7:142094511-142094533 TCCCAGGGCCTGTGCCGGTAGGG + Intronic
1034179453 7:149126299-149126321 CCCCAAAGGCAGAGCCGGCCGGG + Exonic
1034337522 7:150333101-150333123 TCCCAGAACATGAGCCCGCTCGG - Intronic
1034534735 7:151719730-151719752 TCCCAGAGCCTATGTGGGCCTGG + Intronic
1034895364 7:154872914-154872936 TCACAGAACCTGAGGCAGCCTGG - Intronic
1035024280 7:155815936-155815958 ATCCAGAGCCTGAGCCCTCCAGG - Intergenic
1035671730 8:1423282-1423304 TCCCATGGACTGAGCAGGCCTGG - Intergenic
1035682062 8:1495432-1495454 AGCCGGAGACTGAGCCGGCCAGG + Intergenic
1036283728 8:7424389-7424411 GTCCAGAGCCTGGGCTGGCCTGG + Intergenic
1036337743 8:7887140-7887162 GTCCAGAGCCTGGGCTGGCCTGG - Intergenic
1039685901 8:39801661-39801683 TCCCTGAGCCTGAGCCCCCAGGG - Intronic
1047226831 8:122962073-122962095 GCACAGTGCCTGAGCAGGCCTGG - Intronic
1047754892 8:127911072-127911094 TCCCAGAACCTGAGGCAGGCTGG + Intergenic
1048321537 8:133404132-133404154 TCCCAGAGTCTGGCCTGGCCTGG - Intergenic
1048496721 8:134941781-134941803 TCTCAGAGCCTGAGGCAGGCTGG - Intergenic
1048872638 8:138812073-138812095 TGGCTGAGCCTGGGCCGGCCAGG - Intronic
1052413607 9:28149824-28149846 TCCCATACCGTGAGGCGGCCGGG - Intronic
1053431192 9:38042828-38042850 GCCCAGAGCCTGGCCTGGCCTGG - Intronic
1055030432 9:71768219-71768241 GCCCAACGCCGGAGCCGGCCAGG + Intronic
1055623555 9:78150164-78150186 TCCCACAGCCTGACCTGGGCTGG + Intergenic
1056576197 9:87857691-87857713 TCCCAGACTGTGAGGCGGCCAGG + Intergenic
1057161887 9:92894965-92894987 ACCCAGAGCCTGTGCATGCCAGG - Intergenic
1057192275 9:93094793-93094815 TGCCAGAGCCTGACCCGGAATGG - Intergenic
1057314903 9:93961692-93961714 TACCAGAGGCTGATCCTGCCTGG - Intergenic
1057332875 9:94132107-94132129 TCCCAGAGCAAGATCCGGCAGGG - Intergenic
1057636956 9:96777901-96777923 TCCCTGTGCCTCGGCCGGCCCGG - Exonic
1058808065 9:108612030-108612052 TCCCTGAGCCAGTGCCGACCTGG + Intergenic
1059335989 9:113568802-113568824 TCCCTGAGGCTGAGCCTGGCTGG - Intronic
1059425855 9:114220530-114220552 TCCCTGAGCCTGACCCAGCCAGG + Intronic
1059449536 9:114361818-114361840 AGCAAGAGCCTGAGCCGCCCGGG - Exonic
1060822860 9:126671601-126671623 TTAGAGAGCCAGAGCCGGCCTGG - Intronic
1060951801 9:127608655-127608677 TCCCAGCGCCAGGGCCAGCCGGG - Intergenic
1061373659 9:130211914-130211936 TCCTGGAGCATGACCCGGCCTGG + Intronic
1061976508 9:134070596-134070618 TCCAAGAGCCTGAGCAGGAAGGG - Intergenic
1062352680 9:136146967-136146989 TCCCAGAGCCTGGCCAGGGCGGG + Intergenic
1062419013 9:136470180-136470202 CCCCAGAGCCTGCGCAAGCCAGG + Intronic
1062525693 9:136977271-136977293 TCCCAGAGACAGAGCTGGCAGGG - Intergenic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1062578098 9:137217834-137217856 GCCCAGAGCTGGAGTCGGCCAGG - Intergenic
1203779958 EBV:95829-95851 GCCCTGATCCTGAGCCGCCCGGG - Intergenic
1203697056 Un_GL000214v1:108936-108958 TGCCAGACCCTGCCCCGGCCCGG + Intergenic
1203552153 Un_KI270743v1:172093-172115 TGCCAGACCCTGCCCCGGCCCGG - Intergenic
1187507067 X:19887039-19887061 TCCCTCAGCCCGAGCCGCCCGGG + Intronic
1192445873 X:71210788-71210810 TTCCACAGCCTGAGCTGGCATGG + Intergenic
1195128381 X:101831066-101831088 TCCGAGAGCCTGAGCTGAACAGG + Intergenic
1195564215 X:106323241-106323263 GCCCAGAGACTGAGTCAGCCAGG - Intergenic
1196441396 X:115722918-115722940 TCCTAGAGCCTGCTCCGCCCAGG - Intergenic