ID: 1004194184

View in Genome Browser
Species Human (GRCh38)
Location 6:13488611-13488633
Sequence CAGTGCCCCCTCGAGGGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004194184_1004194199 22 Left 1004194184 6:13488611-13488633 CCCAGGCCCTCGAGGGGGCACTG No data
Right 1004194199 6:13488656-13488678 CCCGCACCTCTGGAGCCATGGGG No data
1004194184_1004194194 12 Left 1004194184 6:13488611-13488633 CCCAGGCCCTCGAGGGGGCACTG No data
Right 1004194194 6:13488646-13488668 CAAGGCTGGCCCCGCACCTCTGG No data
1004194184_1004194192 -2 Left 1004194184 6:13488611-13488633 CCCAGGCCCTCGAGGGGGCACTG No data
Right 1004194192 6:13488632-13488654 TGAGGAGGACTGGCCAAGGCTGG No data
1004194184_1004194197 21 Left 1004194184 6:13488611-13488633 CCCAGGCCCTCGAGGGGGCACTG No data
Right 1004194197 6:13488655-13488677 CCCCGCACCTCTGGAGCCATGGG No data
1004194184_1004194191 -6 Left 1004194184 6:13488611-13488633 CCCAGGCCCTCGAGGGGGCACTG No data
Right 1004194191 6:13488628-13488650 GCACTGAGGAGGACTGGCCAAGG No data
1004194184_1004194195 20 Left 1004194184 6:13488611-13488633 CCCAGGCCCTCGAGGGGGCACTG No data
Right 1004194195 6:13488654-13488676 GCCCCGCACCTCTGGAGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004194184 Original CRISPR CAGTGCCCCCTCGAGGGCCT GGG (reversed) Intergenic
No off target data available for this crispr