ID: 1004197536 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:13518489-13518511 |
| Sequence | AAAGAAAAGTCGGCCCGGTG CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1004197531_1004197536 | 8 | Left | 1004197531 | 6:13518458-13518480 | CCTGAGCAACAGAGTAAGACCCT | 0: 48 1: 1351 2: 13551 3: 53139 4: 132469 |
||
| Right | 1004197536 | 6:13518489-13518511 | AAAGAAAAGTCGGCCCGGTGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1004197536 | Original CRISPR | AAAGAAAAGTCGGCCCGGTG CGG | Intergenic | ||
| No off target data available for this crispr | |||||