ID: 1004197536

View in Genome Browser
Species Human (GRCh38)
Location 6:13518489-13518511
Sequence AAAGAAAAGTCGGCCCGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004197531_1004197536 8 Left 1004197531 6:13518458-13518480 CCTGAGCAACAGAGTAAGACCCT 0: 48
1: 1351
2: 13551
3: 53139
4: 132469
Right 1004197536 6:13518489-13518511 AAAGAAAAGTCGGCCCGGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004197536 Original CRISPR AAAGAAAAGTCGGCCCGGTG CGG Intergenic
No off target data available for this crispr