ID: 1004198160

View in Genome Browser
Species Human (GRCh38)
Location 6:13524360-13524382
Sequence CACAAGGCCCTGCCGCTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004198156_1004198160 8 Left 1004198156 6:13524329-13524351 CCTTTGGGTAGTGGTAGCATTTG No data
Right 1004198160 6:13524360-13524382 CACAAGGCCCTGCCGCTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004198160 Original CRISPR CACAAGGCCCTGCCGCTAGC TGG Intergenic
No off target data available for this crispr