ID: 1004201298

View in Genome Browser
Species Human (GRCh38)
Location 6:13550395-13550417
Sequence ATTCACAGGGGAAATACAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004201298_1004201303 30 Left 1004201298 6:13550395-13550417 CCTATTGTATTTCCCCTGTGAAT No data
Right 1004201303 6:13550448-13550470 TAAATACTCTGTATCATACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004201298 Original CRISPR ATTCACAGGGGAAATACAAT AGG (reversed) Intergenic
No off target data available for this crispr