ID: 1004202414

View in Genome Browser
Species Human (GRCh38)
Location 6:13561439-13561461
Sequence CCTCAGCCTCTCCCGAGTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004202414_1004202418 3 Left 1004202414 6:13561439-13561461 CCTATACTCGGGAGAGGCTGAGG No data
Right 1004202418 6:13561465-13561487 GAGAATCGCTTGAACCCAGGAGG 0: 23932
1: 88155
2: 151333
3: 195450
4: 141377
1004202414_1004202417 0 Left 1004202414 6:13561439-13561461 CCTATACTCGGGAGAGGCTGAGG No data
Right 1004202417 6:13561462-13561484 CAGGAGAATCGCTTGAACCCAGG 0: 41137
1: 134699
2: 211581
3: 171799
4: 128801
1004202414_1004202419 9 Left 1004202414 6:13561439-13561461 CCTATACTCGGGAGAGGCTGAGG No data
Right 1004202419 6:13561471-13561493 CGCTTGAACCCAGGAGGCAGAGG 0: 9838
1: 44006
2: 89933
3: 127473
4: 130712

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004202414 Original CRISPR CCTCAGCCTCTCCCGAGTAT AGG (reversed) Intergenic
No off target data available for this crispr