ID: 1004202483

View in Genome Browser
Species Human (GRCh38)
Location 6:13562155-13562177
Sequence TGTGGAGTAACAAAACCCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004202483_1004202487 7 Left 1004202483 6:13562155-13562177 CCGGTGGGTTTTGTTACTCCACA No data
Right 1004202487 6:13562185-13562207 GGCTCCATTCCTACCTGGTCCGG No data
1004202483_1004202488 8 Left 1004202483 6:13562155-13562177 CCGGTGGGTTTTGTTACTCCACA No data
Right 1004202488 6:13562186-13562208 GCTCCATTCCTACCTGGTCCGGG No data
1004202483_1004202486 2 Left 1004202483 6:13562155-13562177 CCGGTGGGTTTTGTTACTCCACA No data
Right 1004202486 6:13562180-13562202 CAACAGGCTCCATTCCTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004202483 Original CRISPR TGTGGAGTAACAAAACCCAC CGG (reversed) Intergenic
No off target data available for this crispr