ID: 1004202485

View in Genome Browser
Species Human (GRCh38)
Location 6:13562173-13562195
Sequence GGAATGGAGCCTGTTGAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004202485_1004202488 -10 Left 1004202485 6:13562173-13562195 CCACACTCAACAGGCTCCATTCC No data
Right 1004202488 6:13562186-13562208 GCTCCATTCCTACCTGGTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004202485 Original CRISPR GGAATGGAGCCTGTTGAGTG TGG (reversed) Intergenic
No off target data available for this crispr