ID: 1004202488

View in Genome Browser
Species Human (GRCh38)
Location 6:13562186-13562208
Sequence GCTCCATTCCTACCTGGTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004202483_1004202488 8 Left 1004202483 6:13562155-13562177 CCGGTGGGTTTTGTTACTCCACA No data
Right 1004202488 6:13562186-13562208 GCTCCATTCCTACCTGGTCCGGG No data
1004202485_1004202488 -10 Left 1004202485 6:13562173-13562195 CCACACTCAACAGGCTCCATTCC No data
Right 1004202488 6:13562186-13562208 GCTCCATTCCTACCTGGTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004202488 Original CRISPR GCTCCATTCCTACCTGGTCC GGG Intergenic
No off target data available for this crispr