ID: 1004202583

View in Genome Browser
Species Human (GRCh38)
Location 6:13563220-13563242
Sequence CTGTGGTTAAGGCGCTGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004202580_1004202583 12 Left 1004202580 6:13563185-13563207 CCAGGGAGAGATGTCTCTAGTGA No data
Right 1004202583 6:13563220-13563242 CTGTGGTTAAGGCGCTGAGCTGG No data
1004202579_1004202583 13 Left 1004202579 6:13563184-13563206 CCCAGGGAGAGATGTCTCTAGTG No data
Right 1004202583 6:13563220-13563242 CTGTGGTTAAGGCGCTGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004202583 Original CRISPR CTGTGGTTAAGGCGCTGAGC TGG Intergenic
No off target data available for this crispr