ID: 1004205477

View in Genome Browser
Species Human (GRCh38)
Location 6:13587875-13587897
Sequence GGTAGGCTTTGGGGTCCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 172}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004205467_1004205477 6 Left 1004205467 6:13587846-13587868 CCAAAGGGAAGGTGAACTGGGGG 0: 1
1: 0
2: 1
3: 24
4: 227
Right 1004205477 6:13587875-13587897 GGTAGGCTTTGGGGTCCAGTGGG 0: 1
1: 0
2: 1
3: 13
4: 172
1004205465_1004205477 7 Left 1004205465 6:13587845-13587867 CCCAAAGGGAAGGTGAACTGGGG 0: 1
1: 0
2: 3
3: 27
4: 224
Right 1004205477 6:13587875-13587897 GGTAGGCTTTGGGGTCCAGTGGG 0: 1
1: 0
2: 1
3: 13
4: 172
1004205463_1004205477 8 Left 1004205463 6:13587844-13587866 CCCCAAAGGGAAGGTGAACTGGG 0: 1
1: 0
2: 1
3: 22
4: 183
Right 1004205477 6:13587875-13587897 GGTAGGCTTTGGGGTCCAGTGGG 0: 1
1: 0
2: 1
3: 13
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004205477 Original CRISPR GGTAGGCTTTGGGGTCCAGT GGG Intronic
900317888 1:2068504-2068526 GGTCGGCTTTGGGGCCCACCAGG + Intronic
901127755 1:6941322-6941344 AGAAGGCTTTGGGGGCCACTGGG - Intronic
901376856 1:8845807-8845829 GCGTGGGTTTGGGGTCCAGTTGG - Intergenic
902503259 1:16924279-16924301 GGTTGGCTTCTGGGTCCAGTGGG - Intronic
902875045 1:19335923-19335945 GGAAAGCTCTGGGGTCCAGCAGG - Intergenic
903237885 1:21962100-21962122 GGTGGGCTTTTTGGTCCACTGGG - Intergenic
903511038 1:23875047-23875069 GGTAGTCATTGGGGATCAGTGGG + Exonic
905168745 1:36098242-36098264 GGCAGGCCTTGGGGCCCAATAGG + Exonic
905410118 1:37762823-37762845 GGGAGGCTTTGGAATCCAGGAGG + Exonic
907934880 1:59033112-59033134 GGTAGGCAATGGGGAGCAGTGGG + Intergenic
908127565 1:61046217-61046239 GTTAGCTTTTGGGGACCAGTTGG - Intronic
909716358 1:78712095-78712117 GGTAGAGTCTGTGGTCCAGTGGG + Intergenic
915556619 1:156664402-156664424 GGTGGGGCTGGGGGTCCAGTTGG + Intergenic
916510391 1:165467909-165467931 AGTGACCTTTGGGGTCCAGTAGG + Intergenic
918553053 1:185766365-185766387 GGTAGGCCTTGGGCTCAAGTTGG - Intronic
920068990 1:203289215-203289237 GGTGGGCTTTGGGGTCAGATGGG - Intergenic
920696956 1:208188205-208188227 TGTAGGTTTTGGGCTACAGTAGG - Intronic
920977655 1:210801106-210801128 GGGAGGCTTTGAAGTCCAGAAGG + Intronic
922043153 1:221916824-221916846 GCTAGGCTTTGGGGGTCAGGAGG + Intergenic
922252725 1:223864507-223864529 GGTTGGCCTTGGGGTTCAGGGGG + Intergenic
922345211 1:224690775-224690797 GGTAGGCTTTGAGGGTGAGTGGG + Intronic
923004542 1:230036480-230036502 GGTAGGCCTTGGAGACCTGTGGG - Intergenic
923289910 1:232534678-232534700 GGCAGGCATTTGGGGCCAGTGGG - Intronic
923504050 1:234590425-234590447 GCTAGGCTATGGTGCCCAGTTGG + Intergenic
1065894877 10:30154448-30154470 GGTGGGCTTTGGGTATCAGTGGG + Intergenic
1066192175 10:33066243-33066265 TTTTGGCTTTGGGGTCCATTTGG - Intergenic
1072860475 10:98998849-98998871 AGTATGCTTTGGGATCCAGGAGG - Intronic
1072994224 10:100229297-100229319 GGCAGTATTTGGGGGCCAGTGGG - Intronic
1073452944 10:103620194-103620216 GGGAGGCTGTGAGCTCCAGTGGG + Intronic
1073462013 10:103671218-103671240 TGTAGGCTTTGGGGGCCAGATGG + Intronic
1073989842 10:109250367-109250389 GGTAGTCATTAGGTTCCAGTCGG - Intergenic
1076980308 11:200638-200660 GGTGGGCTCTGGTGTCCAGGCGG - Intronic
1083358014 11:62082086-62082108 GGTGGGTTTTGAGGTCCAGTAGG + Intergenic
1083431099 11:62613806-62613828 GGATTGGTTTGGGGTCCAGTGGG + Exonic
1085695695 11:78702669-78702691 GGTAGACTTTGGAGTCAAATAGG + Intronic
1086855361 11:91859385-91859407 TACAGGCTTTGTGGTCCAGTTGG - Intergenic
1092735330 12:11577046-11577068 GGTAGGATTTGGAGTTTAGTAGG - Intergenic
1101969051 12:109299932-109299954 GGTAGGCTTTGGGGTCAGCCAGG + Intronic
1104521749 12:129481991-129482013 GGTGGTCTTGGGGTTCCAGTTGG - Intronic
1109508566 13:63337812-63337834 GCTGGGCTTCTGGGTCCAGTGGG + Intergenic
1109852577 13:68086492-68086514 GGTAGACTTTGGGGTCTTGGGGG - Intergenic
1118005901 14:61563975-61563997 GTTAGGCCCTGGGTTCCAGTTGG + Intronic
1118608890 14:67524301-67524323 GACAGGGATTGGGGTCCAGTGGG - Intronic
1118620259 14:67608543-67608565 GGGAGGCTTAGGGCTTCAGTGGG + Intergenic
1122763671 14:104049806-104049828 GGATGGCTTTGGGGGCCAGCTGG + Intronic
1124181658 15:27481447-27481469 GGTAGGGTGTGGGGTGCAGATGG + Intronic
1125003253 15:34793347-34793369 GGTTGGCCTTGGGGTTCAGCGGG + Exonic
1125402837 15:39322369-39322391 GGGGGGCTTTGGGATCCTGTAGG - Intergenic
1128520038 15:68369247-68369269 GGTAGCCATTGGTTTCCAGTGGG + Exonic
1130670251 15:85905935-85905957 GGAAGGCCTTGGTTTCCAGTGGG + Intergenic
1131991807 15:98100279-98100301 TGTAGGCTTTGTGGGCCAGTTGG - Intergenic
1132852381 16:2030526-2030548 GGCAGGCCTTGGGGACCAGGAGG + Intronic
1134333408 16:13271072-13271094 GGAAGACTTTGGGGTTCAGTGGG + Intergenic
1135026336 16:19002114-19002136 GGTAGGATGTGGTGTCCTGTGGG + Intronic
1137550598 16:49434941-49434963 GGTAGGCTGTCGGCTCCAGGAGG - Intergenic
1139711428 16:68779361-68779383 GATGGGCTTTGGGGTCCGGCAGG + Intronic
1139729922 16:68934578-68934600 GATAGGCCTGGGGGTCCAGGAGG + Intronic
1139837835 16:69853901-69853923 GGTCGGCTTTGGTGTTCAGCAGG + Intronic
1140431649 16:74909342-74909364 GGTAGGGTCTGAGGCCCAGTCGG - Intronic
1141029404 16:80574612-80574634 GCCAGGCTTTGGGGTCAATTCGG - Intergenic
1142306739 16:89290250-89290272 GGTAGGCTCAGGGCTCCAATGGG + Intronic
1142306746 16:89290273-89290295 GGTAGGCTCAGGGCTCCAGCCGG + Intronic
1142306856 16:89290568-89290590 GGGAGGCTCAGGGCTCCAGTGGG + Intronic
1142553327 17:753937-753959 GGTAGGCCCTGTGTTCCAGTGGG - Intronic
1143093595 17:4464442-4464464 GGTGGGCTTTGTGGTCAAGGTGG + Intronic
1143236978 17:5411153-5411175 GGTGGGATTTGGTGTCCAATAGG - Intronic
1143291666 17:5836084-5836106 GGTAGGCTTTTGGATCAAGGAGG + Intronic
1143662850 17:8337663-8337685 CATAGGCTTTGGGGTCCAACAGG - Intergenic
1145767842 17:27471579-27471601 GGTTGGCCTTGGGGTCAAGGAGG + Intronic
1146371985 17:32270455-32270477 TCTAGCCCTTGGGGTCCAGTTGG - Intronic
1147304457 17:39553694-39553716 GGCAGGCTCTGGGGCCCATTGGG + Intronic
1150132122 17:62674941-62674963 GGGAGGCTTTGGGGTCCAGGTGG - Intronic
1156287248 18:35709371-35709393 GAAAGGCACTGGGGTCCAGTAGG - Intronic
1159093733 18:63877883-63877905 GAGAGGCTTTGTGGTCAAGTTGG + Intronic
1160929887 19:1565692-1565714 GGCAGGCCCTGGGGTACAGTGGG - Intronic
1161617522 19:5280266-5280288 GGTAGGCGTTGGGGCCCACAGGG - Intronic
1161638485 19:5404461-5404483 GGTAGGGTTTGGGGCCAGGTGGG - Intergenic
1161975935 19:7607754-7607776 GGTGGGCTTGGGGGCCCAGCAGG + Intronic
1162478879 19:10916518-10916540 GGCAGGCTGTGGGGCCCAGGCGG - Intronic
1162502280 19:11060614-11060636 GATAGTTTTTGGGGTGCAGTGGG + Intronic
1163570775 19:18081041-18081063 AGTCGGCTGTGGGGTCCACTAGG - Intronic
1163838901 19:19593693-19593715 GGTATGTTTTGGGGTACAGTAGG - Intronic
1164399978 19:27895753-27895775 AGTAGGCTTTGGGTTCCCATGGG - Intergenic
1165186737 19:34028915-34028937 GGTAGACTTTGGGGGCCATATGG - Intergenic
1166491448 19:43264184-43264206 GGTGGTTTTTGGGGACCAGTTGG - Intronic
1166802857 19:45468925-45468947 GGTAGGCTTTGGGGCGAGGTGGG + Intronic
1168310986 19:55460843-55460865 GGTCGGCGCTGGGGCCCAGTGGG + Intronic
1168701625 19:58443353-58443375 GCTGGGCTTCTGGGTCCAGTGGG - Intergenic
1168719792 19:58548675-58548697 GGCAGGGAATGGGGTCCAGTAGG + Intronic
927519971 2:23692766-23692788 GCTAGGCTCTGGGGTCCATCTGG - Intronic
927525097 2:23732670-23732692 GGTAAGTTTGGGGGTACAGTGGG - Intergenic
928334050 2:30380798-30380820 GCTAGGCTATGAGGTTCAGTAGG + Intergenic
929555072 2:42920957-42920979 TGAAGGCTCAGGGGTCCAGTGGG - Intergenic
930000192 2:46856193-46856215 GCTAGGCTTTGGGAGCGAGTGGG + Intronic
930113848 2:47701951-47701973 GGTAATATTTGGGGGCCAGTGGG + Intronic
934046950 2:88180144-88180166 GGTAGGCTCTGGGCTGCAGAGGG - Intronic
935128972 2:100247301-100247323 TGTAGGCTTTGGGGACCTGCTGG + Intergenic
936036899 2:109120353-109120375 GGAAGCCCTTGGGGTCCAGGTGG - Intergenic
937060079 2:118974523-118974545 GGTGGGCCTTGGGGTCCCGAGGG - Exonic
937513676 2:122628408-122628430 GCAAGGCTCTGGGGTGCAGTGGG - Intergenic
938333222 2:130463598-130463620 GGTTGGCCTTGGGGTTCAGGGGG + Exonic
938356590 2:130657073-130657095 GGTTGGCCTTGGGGTTCAGGGGG - Exonic
938433022 2:131263879-131263901 GGTTGGCCTTGGGGTTCAGGGGG - Exonic
938477075 2:131626462-131626484 GGTTGGCCTTGGGGTTCAGGGGG - Intergenic
939255847 2:139743941-139743963 GCTGGGCTTCTGGGTCCAGTGGG + Intergenic
939366846 2:141244421-141244443 GTTAGGTTCTGGAGTCCAGTAGG + Intronic
940413716 2:153395949-153395971 TTTAGGCTTTGTGGTCCAGATGG + Intergenic
948802663 2:240439947-240439969 GGGAGGCTTGGCGGTCCAGCAGG - Intronic
1171509370 20:25668540-25668562 GGGAGGCTTTAGGGACCAGGTGG + Intergenic
1172935442 20:38616809-38616831 GGGATGCTTTGGCGTCTAGTGGG + Intronic
1174638986 20:52026792-52026814 GGGAGGCATTGAGGTCCAGTGGG - Intergenic
1175555490 20:59852005-59852027 CGTAGGCTTTGTGGCCCAGAAGG - Intergenic
1183910412 22:41074895-41074917 AGTTGGCTTTGGGGTTCAGGGGG + Intergenic
1184914899 22:47562694-47562716 TGCAGGCTGTGGGGTCCAGCTGG - Intergenic
952966931 3:38626915-38626937 GGTAGGATATGGAGTTCAGTTGG + Intronic
953454720 3:43032445-43032467 GGCAGGCTTTGAGCTCCAGCCGG + Exonic
954706468 3:52483362-52483384 GGTAGGCCTAGGGCTCCTGTAGG + Intronic
962845156 3:139267476-139267498 GGTTGGCTTTGGAGTCCTTTAGG - Intronic
966186085 3:177228565-177228587 GGTGGGCTCTTGAGTCCAGTGGG - Intergenic
966290409 3:178349544-178349566 GCTGGGCTTCTGGGTCCAGTGGG - Intergenic
966515896 3:180820840-180820862 GGTTGGCTTTGGGGTTTAGGGGG - Intronic
968794913 4:2696945-2696967 GGTGGGCTTTTGGGGCCTGTGGG + Intronic
972940437 4:44188658-44188680 GATTGACTTTAGGGTCCAGTGGG - Intronic
973887970 4:55341967-55341989 GTTAGGCTTTTGCGTACAGTAGG + Intergenic
975477612 4:74841765-74841787 AGTAGGCTTTGGGGTATATTAGG - Intergenic
975699557 4:77049960-77049982 GGTAGGCATTGGGGTGCCGCTGG - Intronic
981168743 4:141595965-141595987 TATATGCTTTGGGGTTCAGTAGG - Intergenic
985929707 5:3047340-3047362 GGTGGGGTTGGGGGTCCAGCAGG + Intergenic
987329127 5:16839844-16839866 GCTAGGCTATGGCGTTCAGTAGG + Intronic
994196220 5:96925714-96925736 AGTAGGCTTAGGGTTCCATTTGG + Intronic
995187944 5:109290793-109290815 GGTAGTCTTGGGTGTCCAGGGGG + Intergenic
997058057 5:130467816-130467838 GGAAGGCTCTGGTGTCCAGTGGG - Intergenic
1000197390 5:158972819-158972841 GGAAGGCTATGGAGGCCAGTGGG - Intronic
1000298975 5:159937960-159937982 GGGAAGCTTTGGCCTCCAGTGGG - Intronic
1000877131 5:166654748-166654770 TGTAGTCTTTGGGGGCCAGAAGG + Intergenic
1003095177 6:3137096-3137118 TGTAGGCCCTGGGGTACAGTGGG + Intronic
1003115689 6:3282520-3282542 GGAAGGCTTTGGGAGCAAGTAGG - Intronic
1003117787 6:3294930-3294952 GGTACGTGTAGGGGTCCAGTGGG - Intronic
1004205477 6:13587875-13587897 GGTAGGCTTTGGGGTCCAGTGGG + Intronic
1006586694 6:35119532-35119554 GGCAGGCTATAGGGCCCAGTGGG + Intronic
1007180439 6:39925795-39925817 GGTTGGCTTTGGGGGTCAGCGGG + Exonic
1007419705 6:41712250-41712272 GGTAGGATCTGGAGTCCTGTAGG - Intronic
1007707773 6:43801495-43801517 CCTTGGGTTTGGGGTCCAGTAGG + Intergenic
1008666478 6:53721908-53721930 GGTGGGCTTTGGGCTGCTGTTGG - Intergenic
1008884961 6:56422858-56422880 AGTAGGTTTTGGGGTACAGGTGG - Intergenic
1008975336 6:57419340-57419362 GGTTGGTTTTGGTGTCCAATAGG + Intronic
1009164213 6:60320853-60320875 GGTTGGTTTTGGTGTCCAATAGG + Intergenic
1013367800 6:109448248-109448270 GGTAGGCAATGAGGCCCAGTGGG + Exonic
1017479102 6:154832283-154832305 GGTAAGTTTTGAGGTCCAGCTGG - Exonic
1019214721 6:170435795-170435817 GGTGCCCTTTGGGGTCCACTAGG - Intergenic
1019934726 7:4246783-4246805 GGTAGGCCCTGGGGTCCTGGAGG - Intronic
1020125091 7:5529178-5529200 GGTTGGCCTTGGGGTTCAGGGGG + Exonic
1021138373 7:16993322-16993344 AGTGGGCTTTGGGTCCCAGTTGG + Intergenic
1024565968 7:50681285-50681307 GGTAGTCTTTGGGGTAGAGCCGG - Intronic
1029114511 7:98230467-98230489 GGTAGGGTTTGAAGTCCAGCAGG - Intronic
1030287850 7:107844957-107844979 AGTAGGCTTAGGGTGCCAGTAGG + Intergenic
1032261004 7:130337387-130337409 TTTAGGCTTTGGGGTCCAGAAGG - Intergenic
1034231105 7:149529205-149529227 GGAAGCCTTTTGGGTCGAGTAGG + Intergenic
1035142613 7:156777892-156777914 GGTAGGGTATGGGGTTCAGCAGG - Intronic
1036190413 8:6664788-6664810 CGTAGGCTTTGAAGTCCAGACGG + Intergenic
1036924799 8:12893959-12893981 GGTGGGTGGTGGGGTCCAGTGGG - Intergenic
1037180762 8:16003263-16003285 GGGAGGCATTGGGGTCCTGAGGG - Intergenic
1038077802 8:24097249-24097271 GGTAGGCTTTTGAGTTCTGTTGG + Intergenic
1043827678 8:84948908-84948930 GGTTGGCCTTGGGGTTCAGGGGG - Intergenic
1048019957 8:130528957-130528979 GCTAAGCTTTGGTGTTCAGTAGG - Intergenic
1051248563 9:15136347-15136369 TGTAGGCTTTGGTGTCCTGGGGG - Intergenic
1053171979 9:35894192-35894214 GGTAGGCTTTGGGGTCAGACAGG + Intergenic
1053595927 9:39561725-39561747 GCTAAGCTATGAGGTCCAGTAGG + Intergenic
1053853894 9:42318366-42318388 GCTAAGCTATGAGGTCCAGTAGG + Intergenic
1054570332 9:66803290-66803312 GCTAAGCTATGAGGTCCAGTAGG - Intergenic
1057884026 9:98815391-98815413 GCTAGGCTGTGGTGTTCAGTAGG + Intronic
1059345741 9:113626790-113626812 GGTTGGCATAGGGGTCCAGTGGG - Intergenic
1059553520 9:115254424-115254446 GTTAGGCTTTGCAGTCCAGGTGG + Intronic
1060996738 9:127878231-127878253 GGTGGTCTTTGGGGTCCTGGCGG - Intergenic
1061202515 9:129145976-129145998 GGCTGGCTCTGGGGTCCTGTGGG + Intronic
1061305884 9:129733043-129733065 GGTAGACTCAGGGATCCAGTCGG + Intergenic
1188295324 X:28440569-28440591 GGGAGGCTTTGGGGTCACGGAGG + Intergenic
1190268932 X:48847468-48847490 GCTGGGCTTTGGTGTCCTGTAGG + Intergenic
1191955664 X:66640018-66640040 GGAAGGGTTTGGGGGCCAGTAGG + Intergenic
1192428477 X:71097021-71097043 GGGAGGCTAGGGGGTCCAGGGGG - Intronic
1194756634 X:97746089-97746111 GGTGGGGTTTGGGTTCCAGAAGG + Intergenic
1195980435 X:110571491-110571513 TTTAGGCTTTGTGGGCCAGTTGG + Intergenic
1197868027 X:131039008-131039030 GCTAGTCTTTTGGGTCCAGTTGG - Intergenic
1200962976 Y:9011928-9011950 GCTGGGCTTCTGGGTCCAGTGGG - Intergenic
1201792976 Y:17862563-17862585 TCAAGCCTTTGGGGTCCAGTGGG + Intergenic
1201808578 Y:18043423-18043445 TCAAGCCTTTGGGGTCCAGTGGG - Intergenic
1202150128 Y:21836853-21836875 GCTGGGCTTCTGGGTCCAGTGGG + Intergenic