ID: 1004206711

View in Genome Browser
Species Human (GRCh38)
Location 6:13598260-13598282
Sequence TTTCACTCCCTCCTACCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 303}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004206711_1004206717 26 Left 1004206711 6:13598260-13598282 CCCTGAGGTAGGAGGGAGTGAAA 0: 1
1: 0
2: 0
3: 33
4: 303
Right 1004206717 6:13598309-13598331 AGGAAAGCTGGCTACATACTGGG 0: 1
1: 0
2: 2
3: 9
4: 140
1004206711_1004206713 -1 Left 1004206711 6:13598260-13598282 CCCTGAGGTAGGAGGGAGTGAAA 0: 1
1: 0
2: 0
3: 33
4: 303
Right 1004206713 6:13598282-13598304 AGAAGAGAGATTTTTAGTAATGG No data
1004206711_1004206716 25 Left 1004206711 6:13598260-13598282 CCCTGAGGTAGGAGGGAGTGAAA 0: 1
1: 0
2: 0
3: 33
4: 303
Right 1004206716 6:13598308-13598330 CAGGAAAGCTGGCTACATACTGG 0: 1
1: 0
2: 1
3: 12
4: 121
1004206711_1004206715 14 Left 1004206711 6:13598260-13598282 CCCTGAGGTAGGAGGGAGTGAAA 0: 1
1: 0
2: 0
3: 33
4: 303
Right 1004206715 6:13598297-13598319 AGTAATGGACACAGGAAAGCTGG No data
1004206711_1004206714 6 Left 1004206711 6:13598260-13598282 CCCTGAGGTAGGAGGGAGTGAAA 0: 1
1: 0
2: 0
3: 33
4: 303
Right 1004206714 6:13598289-13598311 AGATTTTTAGTAATGGACACAGG 0: 1
1: 0
2: 0
3: 9
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004206711 Original CRISPR TTTCACTCCCTCCTACCTCA GGG (reversed) Intronic
900463205 1:2811134-2811156 TTTCACCCTCTCCTACTGCAGGG + Intergenic
902890238 1:19438072-19438094 TCCCACTACCTCCTACGTCAGGG + Intronic
903285699 1:22275498-22275520 CCTCACTCCCTCCTGACTCATGG + Intergenic
904801948 1:33099276-33099298 TCTCCCTCCCTCCTTCCTCCAGG + Intronic
905238748 1:36568352-36568374 TCTCCTTCCCTCCTCCCTCAAGG + Intergenic
905871216 1:41405631-41405653 TGTCACTCTCGCCTACCTTAAGG - Intergenic
907934269 1:59028198-59028220 TTCTACTCCCTCCTCCCCCATGG - Intergenic
907934293 1:59028355-59028377 TTCTACTCCCTCCTCCCTCATGG - Intergenic
912245665 1:107959560-107959582 TTGGTTTCCCTCCTACCTCATGG + Intronic
912496093 1:110092674-110092696 TGACACTCCGTCCCACCTCAGGG + Intergenic
912594001 1:110855862-110855884 CCTCCCTCCCTCCTACCTCTTGG - Intergenic
913282834 1:117201951-117201973 TCTAACTCTCTCCTGCCTCAGGG + Intronic
914918321 1:151831576-151831598 TTTCACTCCCTGCCAACCCAGGG + Intronic
915531062 1:156502378-156502400 TTTAACTTTCCCCTACCTCATGG + Intergenic
917241626 1:172954962-172954984 TTCCACTGCCTCCCACCTGACGG + Intergenic
917476719 1:175375134-175375156 TTTCCCTCCCTCCTTCCACTTGG + Intronic
918054074 1:181003460-181003482 TTTCCTTCCCTCCTTTCTCAAGG + Intronic
921298177 1:213723977-213723999 TTTCACTCATTCCTGCCTGAAGG - Intergenic
921320170 1:213931044-213931066 TTTTACTCCTTCCCTCCTCAGGG + Intergenic
921463826 1:215461651-215461673 TCTCACCCCCTCCTCCATCAGGG + Intergenic
922500790 1:226095533-226095555 TTTCGCTCCCTCCACCCTCTAGG - Intergenic
922791430 1:228313329-228313351 TTTCCCACCCTCCCACCTCTAGG - Intronic
924140561 1:241018732-241018754 TTTCTGTCCCTCCCTCCTCAAGG + Intronic
924146055 1:241075848-241075870 TTTCACTCCACAGTACCTCAAGG - Intronic
924300960 1:242637270-242637292 TATCTCTCCATGCTACCTCATGG + Intergenic
924443461 1:244105610-244105632 TTTGAATCCCTCCTGCTTCATGG + Intergenic
1062914483 10:1236341-1236363 GTTCACTCCCCCCTGCCTCCCGG + Intronic
1062914843 10:1237530-1237552 GTTCACTCCCCCCTGCCTCCCGG + Intronic
1062915166 10:1238531-1238553 GTTCACTCCCCCCTCCCTCCCGG + Intronic
1064615403 10:17149637-17149659 AGTCACTCCCTACTACCTCCCGG + Intronic
1064695257 10:17958475-17958497 TTTCTCTCCCTCCTATTTGATGG - Intronic
1066142006 10:32514229-32514251 TCTCACCCCCTGCTACCTCAGGG + Intronic
1066756351 10:38716477-38716499 TTTCTTTCCTTCCTTCCTCAGGG + Intergenic
1069231131 10:66009717-66009739 TGTCACCCCTTTCTACCTCATGG + Intronic
1069616935 10:69812194-69812216 TGTCACTCTCTCCAGCCTCATGG + Intronic
1069997891 10:72354267-72354289 CTTCACTCCCTCTCACCTCTCGG - Intronic
1073036714 10:100569039-100569061 TCTCACTCCCTGCTGCCACAGGG - Intergenic
1075338296 10:121624760-121624782 ATTCACTCCCTCCTTCCTACTGG + Intergenic
1075418260 10:122281684-122281706 TTTCACTCCTCCCTTCCTCTGGG + Intronic
1078972517 11:16430237-16430259 TTTCAATCCCTACTTCCTCAGGG + Intronic
1079352071 11:19700074-19700096 TTCCTCTCCCACCTACCTTAGGG - Intronic
1079562698 11:21842601-21842623 TTCCAATGCCACCTACCTCAAGG + Intergenic
1079749366 11:24177809-24177831 TTTCACTCCCTCCTAGCTGTAGG + Intergenic
1080835570 11:35937390-35937412 TTTCTCTGCCCCCTACCCCATGG + Intergenic
1080994187 11:37580264-37580286 TATCAATCCCTCCTTACTCAAGG - Intergenic
1081111350 11:39137809-39137831 CTGCACTCCCTCCTTCCTTAGGG + Intergenic
1081889293 11:46527056-46527078 TTGCACTCTCTCCTATCTCAAGG + Intronic
1084564944 11:69923364-69923386 TGTCCCTGCCTCCTCCCTCACGG - Intergenic
1084774582 11:71367030-71367052 TTTCACTGCCACCTCTCTCAGGG + Intergenic
1084996893 11:72989528-72989550 TTTCACTCCCTCTTGTCTAAGGG - Intronic
1085695447 11:78700780-78700802 TTTCTCTGCCTCCTCCCTCAGGG - Intronic
1085983639 11:81756913-81756935 TTTCTCTTCCTCTTTCCTCAGGG - Intergenic
1087232054 11:95676837-95676859 TTAAACTCTCTCCTATCTCAAGG - Intergenic
1087235350 11:95711992-95712014 TTTCACTACCTCCTACCCACAGG - Intergenic
1091207175 11:133829853-133829875 TTTCATTGCCTCCTGCCTCGGGG - Intergenic
1091284771 11:134402493-134402515 TTTCACCACCTCCTACTTCCAGG + Intronic
1092241888 12:6840665-6840687 CTTCACCCCCTCCTCTCTCAGGG + Intronic
1093557717 12:20496548-20496570 ATTCTCTCTCTGCTACCTCATGG + Intronic
1094489428 12:30949750-30949772 TCTCATTTCCTCCCACCTCATGG + Intronic
1095117189 12:38368675-38368697 TTCCACTCTCTCCTAGCTGAGGG - Intergenic
1100209139 12:92383210-92383232 TATTAATCCCTCCTCCCTCAGGG - Intergenic
1100221623 12:92510384-92510406 TTTCCCTTCCTCCCACCTCAGGG + Intergenic
1101731664 12:107431926-107431948 TTTAACCCCCTCCAAACTCAGGG - Intronic
1101973145 12:109331613-109331635 TTTCACTCTTTGCTTCCTCAGGG + Intergenic
1102022467 12:109693381-109693403 TCTCTCTCTCTCCTACCACAGGG - Intergenic
1102533676 12:113565442-113565464 TTTCTCTCCCACAAACCTCAGGG - Intergenic
1103044095 12:117720896-117720918 TCTCATTCCCTCCTGCCTCAGGG - Intronic
1104140243 12:125981049-125981071 TTTCTCTCCCTCCAACCTTCAGG + Intergenic
1105059537 12:133136109-133136131 CTTCATTCTCTCCTACCTCCTGG - Intronic
1105327154 13:19381043-19381065 TTTCTCTCCCTCCTGCTACAGGG - Intergenic
1106470208 13:30047512-30047534 TTCTACTCCCTCCTACCTTTGGG - Intergenic
1106758512 13:32845575-32845597 TTTCACTGCCTACTTCCTCAAGG - Intergenic
1107022403 13:35765383-35765405 TTTCTCTCCCTCCTTCTTCCTGG - Intergenic
1107033564 13:35878110-35878132 ATTCACCACCTCCTGCCTCATGG + Intronic
1107048382 13:36019709-36019731 ATTCAATCCCTCCTAACTCTTGG + Intronic
1108811421 13:54228883-54228905 ATTCACTCCCCCCTACTACAAGG + Intergenic
1110182644 13:72635810-72635832 ACTCACTCTCTCCCACCTCAGGG - Intergenic
1113928350 13:113953284-113953306 GCTCACACCTTCCTACCTCAGGG - Intergenic
1114212839 14:20630655-20630677 TCTCACTTCCTACTGCCTCAAGG - Intergenic
1114983781 14:28198994-28199016 TTTCACTCTCCCCTACCTTATGG + Intergenic
1115110644 14:29817427-29817449 TTTCACTAACTCATACCACAAGG + Intronic
1117107068 14:52408636-52408658 TTTAACTCTCTCCTACTTTAGGG + Intergenic
1119114876 14:72010125-72010147 TTTCTCTCCCTTCTATGTCATGG + Intronic
1119978503 14:79052924-79052946 TTTCACTACCTGCTACTTAAAGG - Intronic
1120139939 14:80918100-80918122 TGTCACTCCCTCCCACCATAAGG + Intronic
1120731120 14:88002549-88002571 TGTCACCCACCCCTACCTCAGGG + Intergenic
1122940619 14:104979411-104979433 TTTCACTCCCTCCCATACCATGG - Intergenic
1123440614 15:20288549-20288571 TTTCCTTCCTTCCTTCCTCAGGG + Intergenic
1125021304 15:34989292-34989314 TTTCATTTCCTCCTTTCTCAAGG - Intergenic
1126987306 15:54327108-54327130 ATTGACTGCCTCCCACCTCATGG - Intronic
1128649284 15:69398685-69398707 TTCCCCTCACTCCTTCCTCAAGG + Intronic
1129320173 15:74770364-74770386 TATCTCTGCCTCCCACCTCAAGG + Intergenic
1130235325 15:82128006-82128028 TTTCATTCCGTCATACCTCTTGG - Intergenic
1130880168 15:88048147-88048169 TCTCCCTGCCTCCTTCCTCAGGG + Intronic
1131439278 15:92446813-92446835 GAACACACCCTCCTACCTCAAGG - Intronic
1131619613 15:94053754-94053776 ACTCACTTCCTCCTACCCCAAGG - Intergenic
1131661797 15:94525059-94525081 ACTAACTCCCTCCTTCCTCAGGG - Intergenic
1132372027 15:101306074-101306096 TTCCATTCCCTCCTGCCTCCAGG - Intronic
1132377604 15:101340546-101340568 CTTCACTCCATTCTACCTCTTGG + Intronic
1134335806 16:13298773-13298795 TTTCAAGCCCTCCTTCCTTAGGG - Intergenic
1135421357 16:22307731-22307753 TTTCACTCTTTGCTTCCTCATGG + Intronic
1135800695 16:25492411-25492433 TTTCTCTCCCTGCTCCCTTAGGG + Intergenic
1136726321 16:32360381-32360403 TTTCCTTCCTTCCTTCCTCAGGG - Intergenic
1137257198 16:46785744-46785766 TTCCAATTCCTTCTACCTCAGGG - Intronic
1137446753 16:48536613-48536635 TTTCACCCCCTCCTGCCTGGTGG - Intergenic
1137619084 16:49864615-49864637 TTTCTCTCCCTCCTTCCTGGAGG - Intergenic
1137935266 16:52629026-52629048 ATTCAAGCCCTTCTACCTCAAGG - Intergenic
1138188553 16:54995882-54995904 TTTCACTGCCTCTTACCTGTGGG + Intergenic
1138457884 16:57131786-57131808 CTTCATTCACTCCCACCTCAGGG + Intronic
1139166884 16:64576820-64576842 TTCCTCTCCCAGCTACCTCATGG + Intergenic
1139891282 16:70254588-70254610 CTTCCCTCCCTCCGTCCTCAGGG - Intronic
1140297685 16:73725328-73725350 TCTCCCTCCCTGCTGCCTCAAGG - Intergenic
1140338590 16:74135531-74135553 TTTGACTTTCTCCTACCTCGTGG + Intergenic
1203000112 16_KI270728v1_random:157376-157398 TTTCCTTCCTTCCTTCCTCAGGG + Intergenic
1203131712 16_KI270728v1_random:1693777-1693799 TTTCCTTCCTTCCTTCCTCAGGG + Intergenic
1143039381 17:4022193-4022215 GCTCACTCCCTCCTACATGATGG + Intronic
1143707006 17:8705602-8705624 ATTCACCCCCTTCTACCACAGGG + Intergenic
1144220003 17:13091283-13091305 TTTCAGTCTCTCACACCTCAAGG - Intergenic
1144766299 17:17734600-17734622 TTTCCCTCCCACCCACCTGAAGG + Intronic
1146564557 17:33901231-33901253 TATCACTCCCTCCTAACTTCTGG + Intronic
1147048754 17:37774850-37774872 TTTCTCTCTCTCCTACCTTTGGG - Intergenic
1147915392 17:43882511-43882533 TTACACTCCCTCTGACCTCCAGG - Exonic
1149366969 17:55954405-55954427 TCTCTCACCCTCCTCCCTCAAGG + Intergenic
1149812450 17:59690416-59690438 TTTGAATCCCTCCTTCCTGAGGG + Intronic
1151171230 17:72247883-72247905 TTTCTCTCCTTCCTCCCTCATGG - Intergenic
1151204567 17:72496691-72496713 TTTCCGTTGCTCCTACCTCATGG - Intergenic
1151401363 17:73857989-73858011 TAGCCCTCCCTCCTCCCTCAGGG + Intergenic
1151422711 17:74008920-74008942 TTTCCCTGACTCCTTCCTCACGG + Intergenic
1155523198 18:26689970-26689992 TTTCTCTGTCTCCTCCCTCAGGG - Intergenic
1156831425 18:41496535-41496557 TTTCACTCACTCCTCCCTGAAGG - Intergenic
1157682157 18:49615561-49615583 TTTCACCACCTCCAACATCAAGG - Intergenic
1157746504 18:50140686-50140708 TTGCACCCCCTTCTACTTCAAGG - Intronic
1158300280 18:56044209-56044231 TATCAATGCCACCTACCTCATGG + Intergenic
1158636709 18:59165293-59165315 TTTTAGTCCCTCATACCTCATGG + Intergenic
1159351998 18:67287001-67287023 TTTCACTCACCCCTTCCTTAGGG + Intergenic
1159552471 18:69909499-69909521 TTTCAGCCTCTTCTACCTCAGGG - Intronic
1160218845 18:76957657-76957679 CTCCTCTCCCTCCTCCCTCAAGG + Intronic
1160752542 19:741335-741357 GCTGACTCCATCCTACCTCAGGG - Intronic
1161146792 19:2683732-2683754 TTTCCCTCCCTCCTCCTCCAGGG - Intronic
1162418153 19:10550628-10550650 TTTCAGACACTCCCACCTCAGGG + Intronic
1162935420 19:13979355-13979377 TTTCCCTCCCTGCGGCCTCAGGG + Intronic
1162935451 19:13979419-13979441 TGTCTCCCCCTCCTACCCCACGG - Intronic
1163869332 19:19806015-19806037 TTTCACTCGCACCTACCTGGGGG + Exonic
1163873823 19:19848697-19848719 TTTCACTCGCACCTACCTGGGGG + Intergenic
1163880494 19:19916649-19916671 TTTCACTCACACCTACCTGAGGG - Exonic
1163921984 19:20297920-20297942 TTTCACTCACACCTACCTGAGGG - Intergenic
1163947448 19:20552459-20552481 TTTCACTTGCACCTACCTGAGGG + Exonic
1163956365 19:20645668-20645690 TTTCACTCACACCTACCTGAGGG + Exonic
1163959847 19:20678714-20678736 TTTCACTCACACCTACCTGGGGG - Intronic
1163970923 19:20793872-20793894 TTTCACTCACACCTACCTGAGGG - Exonic
1164007846 19:21167660-21167682 TTTCACTCTCACCTACCTGGGGG - Exonic
1164054728 19:21612847-21612869 TTTCCCTCACTGCTATCTCAGGG + Intergenic
1164075889 19:21817872-21817894 TTTCACTCTCACCTACCTGGGGG + Exonic
1164102817 19:22073558-22073580 TTTCACTCTCACCTACCTGGGGG - Exonic
1164134625 19:22402773-22402795 TTTCACTCTCACCTACCTGGGGG + Exonic
1164164190 19:22654009-22654031 TTTCACTCTCACCTACCTGGGGG - Exonic
1164279290 19:23754807-23754829 TTTCACTCTCACCTACCTGGGGG + Exonic
1164473968 19:28559104-28559126 CTTCCCTCCCTCCTAACTCCTGG + Intergenic
1164732876 19:30519323-30519345 TTCCAGTCCCTCCTGCCACAGGG - Intronic
1164759346 19:30717251-30717273 TTTCACCCACTCCTTCCTAAGGG - Intergenic
1164883906 19:31760700-31760722 TTTTACTCCCCCCTACCCCAAGG - Intergenic
1164979983 19:32606618-32606640 TTTCTATCCTTTCTACCTCAGGG + Intronic
1165215640 19:34270258-34270280 TTTCACTACCTTCTTCCTCTAGG + Intronic
1165819417 19:38665173-38665195 TTTCACTACCTCCTAGTTCTGGG - Intronic
1166644189 19:44519030-44519052 TTACACTCTCTCTTGCCTCAAGG + Intronic
1167859356 19:52270381-52270403 TTTCTCTCCCTGCTACTTCCTGG - Intronic
1168061762 19:53897045-53897067 TTGTCCTCCCTCCCACCTCAGGG - Intronic
925096714 2:1210615-1210637 ATTCACTCACTCCTCACTCATGG + Intronic
925374754 2:3376237-3376259 TCTCCCTCCCCCCCACCTCATGG - Intronic
925454585 2:4004348-4004370 TTTCACCCACTACTCCCTCAGGG + Intergenic
927266631 2:21160076-21160098 TTTCCATCCCTACAACCTCAGGG - Intergenic
928194731 2:29207062-29207084 TTTCCCTCCCTACTAACACACGG + Intronic
928740589 2:34347680-34347702 TTTCACTTCTCCCTACCACAAGG + Intergenic
928907291 2:36381265-36381287 TTTCCCTCCATCCCACCTCAAGG - Intronic
928933377 2:36648624-36648646 TTTGCCTCCCTCCTGCTTCACGG + Intergenic
929663956 2:43818844-43818866 TTTCAGCCCCACCTGCCTCAAGG - Intronic
931670740 2:64644640-64644662 TTTAACACCCTCCTCCCCCAAGG + Intronic
933320351 2:80768334-80768356 TTTCTCTCCCTCTTGCCCCATGG - Intergenic
933560939 2:83885302-83885324 TTTCCCTTCCTCTCACCTCAGGG - Intergenic
934319647 2:91960735-91960757 TTTCCTTCCTTCCTTCCTCAGGG + Intergenic
934522613 2:95029254-95029276 TCTCTCTCCCTCCGTCCTCAGGG + Intronic
936780676 2:116029060-116029082 CTTCCTTCCCTCCTTCCTCAGGG - Intergenic
937226344 2:120372106-120372128 CTTCACTCCTGCCTGCCTCATGG - Intergenic
937320256 2:120956684-120956706 TTTCACTCCCTGATAGCCCACGG + Intronic
938844535 2:135195273-135195295 CCTCACTCCCTCCTCCCTAAAGG + Intronic
939368605 2:141267747-141267769 TTTCTTACACTCCTACCTCAAGG - Intronic
939441959 2:142261106-142261128 TTTCACTCACCCCTTCCTTAAGG + Intergenic
940383476 2:153043517-153043539 TTATGCTCCCTCCTACCACAGGG - Intergenic
941342405 2:164323739-164323761 TTCCAATGCCTCCTAACTCATGG + Intergenic
941398481 2:165001069-165001091 TTTCACTCTCTCCTATCAAATGG - Intergenic
941909300 2:170747629-170747651 TCTCACCCCCTCCAATCTCAGGG - Intergenic
942375192 2:175329203-175329225 TTCCCCTCCCTCCTTCCTTAAGG - Intergenic
943867915 2:192953002-192953024 TTTCACCCACTCCTATCTTAGGG + Intergenic
945653297 2:212591835-212591857 TCTAACTCCCTCCTCCCTCAAGG + Intergenic
946894545 2:224310018-224310040 GCTCCCTCCCTCCTTCCTCACGG + Intergenic
947037559 2:225876397-225876419 TCACACTCCCTTCTACCACAGGG + Intergenic
948248469 2:236506156-236506178 TTCCACTCGCTTCTTCCTCATGG + Intronic
948417263 2:237819409-237819431 TTTCTCTCCCTCCCACTTCCTGG - Intronic
948697464 2:239739415-239739437 TCTGACTCCCTCCCACCGCAGGG + Intergenic
949058307 2:241941909-241941931 GCTCACTCCCTGCTACCTCCAGG + Intergenic
1169485919 20:6032548-6032570 TTTCACTCCCTCCTTCCCTGTGG + Intronic
1171987768 20:31672511-31672533 CTCCTCTCCCTCCCACCTCAGGG - Intronic
1173056971 20:39624065-39624087 TTGAACTCCCTCTTAGCTCAGGG - Intergenic
1173495081 20:43513054-43513076 AATCACTCCCTCCTCCCTCTGGG - Intronic
1177120649 21:17133099-17133121 TTGCACTCCCTCCTCCCTTAGGG - Intergenic
1177921068 21:27153171-27153193 TATTACTCACTCTTACCTCATGG - Intergenic
1178292995 21:31385575-31385597 TTTTCCTCCCTCCTATTTCAGGG - Intronic
1179064174 21:38008652-38008674 CTTCATTCCCTACTTCCTCAAGG - Intronic
1179571374 21:42280711-42280733 CTTCTCTCCCTCCACCCTCACGG - Intronic
1181734598 22:24871755-24871777 TTTCACTCCCTTCAGTCTCAAGG + Intronic
1182239497 22:28903747-28903769 TTCCACTCCTTCCTACGTCAAGG + Intronic
1183110195 22:35643017-35643039 TTTACCTCCCTCCAACCTCATGG + Intergenic
1183354163 22:37349560-37349582 TTGCAGCCCCTCCTACCCCAGGG + Intergenic
1184010557 22:41744952-41744974 TGTCTCTCCTTCCCACCTCAGGG + Exonic
1184455303 22:44606776-44606798 TTCCCCTCCCTCCTACCTGGAGG + Intergenic
1184465440 22:44666728-44666750 TCTCCCTCCCTCCTCCCTCCTGG - Intergenic
950019846 3:9779509-9779531 TTTCCCTCCCCCCTCCCCCAAGG - Intronic
950214192 3:11146599-11146621 TTCAAGTGCCTCCTACCTCAGGG - Intronic
950667343 3:14505576-14505598 TGTGACTCCCTCCTCCTTCACGG + Intronic
950886424 3:16366578-16366600 TTTCTATCCCGCCCACCTCATGG + Intronic
953113780 3:39970609-39970631 TTTCCCTCCAACCTACCTCATGG + Intronic
954092983 3:48300313-48300335 TTTCTCTAGCTCCAACCTCATGG + Intronic
955864121 3:63364009-63364031 TTTCTCACCCTTCTACATCAGGG - Intronic
956910511 3:73811587-73811609 CTTCTCTCCCGCCTACCTCTTGG + Intergenic
957384043 3:79472216-79472238 TTTCTCTCCCTCCAACTTCATGG + Intronic
960330857 3:116359253-116359275 TTTCACTACCTGCTAACTCAAGG - Intronic
960699381 3:120425815-120425837 TTTCATTCCCTCCCAGATCATGG + Intronic
961092889 3:124130244-124130266 TTTCACTCTCTCCTCCTTCATGG - Intronic
961933949 3:130563461-130563483 TTTCACTCCGTCTTTCCGCAGGG - Exonic
967274402 3:187759739-187759761 ATTCTCTCCCTCCCACCTCTAGG - Intergenic
967385306 3:188905269-188905291 TTTTGCTCTCTCCTGCCTCAGGG + Intergenic
969254595 4:5993414-5993436 TTTCCAGCCCTCCAACCTCAAGG - Intergenic
969941107 4:10732791-10732813 TTTCTCTCTCTCCCTCCTCATGG + Intergenic
974328528 4:60446127-60446149 ATTCACTCATTCCTGCCTCAGGG + Intergenic
975614106 4:76229866-76229888 TTTCACTGCCTGCAACATCATGG - Intronic
979226750 4:118294790-118294812 TGTCACTCCCTCATTCCACAGGG + Intronic
979406995 4:120325405-120325427 TTTCACACCATCCAACCTCCTGG + Intergenic
979644406 4:123051763-123051785 TTTCACTCCCTCCAACCCTAAGG + Intronic
980159416 4:129141332-129141354 TCTCTGTCCCTCCTACTTCAAGG - Intergenic
981768518 4:148279640-148279662 TCTTACTTCATCCTACCTCAAGG - Intronic
982330999 4:154182038-154182060 TTTCTCTCTCTTCAACCTCAAGG + Intergenic
982866662 4:160521760-160521782 TTTCCCACCCTTCTACATCATGG + Intergenic
987564871 5:19571661-19571683 TTCCATGCCTTCCTACCTCATGG - Exonic
988061757 5:26179169-26179191 TTTCAGTCTCTCATACCCCATGG - Intergenic
988322456 5:29716437-29716459 TTATACTCCCTCATGCCTCAAGG - Intergenic
988789957 5:34598605-34598627 TTTTACTCCATCCTCCGTCAAGG - Intergenic
990683247 5:58269807-58269829 TCTCATTCCCTCCTGCTTCATGG + Intergenic
992322541 5:75628206-75628228 TTTCCCTTCCTCCTAGCTCCTGG - Intronic
992334700 5:75753683-75753705 TTTCAATCCCCGCTACCTCTAGG + Intergenic
992688965 5:79224666-79224688 TCTCCCTCCCTCCTTGCTCAGGG - Intronic
994113552 5:96036227-96036249 TCTCACTCCCACCTCTCTCAAGG - Intergenic
994255358 5:97587158-97587180 TTGGACTCCCTCCCACATCAAGG - Intergenic
994382637 5:99089385-99089407 TTTCACTTCTTCTCACCTCATGG - Intergenic
994475342 5:100261666-100261688 TTTCCCTCCCTCCTGTCACAAGG + Intergenic
995468075 5:112471224-112471246 TTTCCCTGCCTCCAGCCTCATGG + Intergenic
999356846 5:150943031-150943053 TTTCACTTCTTCCTTCCTCTTGG - Intergenic
1000290876 5:159870027-159870049 TTTTACACCCTCCAACCTCTTGG - Intergenic
1001144780 5:169174173-169174195 TTTCGGGCCATCCTACCTCAAGG + Intronic
1001203086 5:169737232-169737254 TCAAACTCCCTCCTATCTCAGGG - Intronic
1001530894 5:172460920-172460942 ATTCATTCCCACCTACATCATGG - Intergenic
1002423497 5:179162684-179162706 TCTCAGTCCCGCCTACCGCAGGG + Intronic
1003148908 6:3532179-3532201 CTTCACTCCCTCCTTCCCCCAGG + Intergenic
1003266404 6:4568347-4568369 TTCCATTCCCTCCAGCCTCACGG + Intergenic
1003353480 6:5342848-5342870 TCTCACTCCCTCCTATCACTTGG - Intronic
1003993058 6:11506861-11506883 TCTCCCTCCCTCCACCCTCAAGG - Intergenic
1004206711 6:13598260-13598282 TTTCACTCCCTCCTACCTCAGGG - Intronic
1004842152 6:19599381-19599403 TTTCAATCCGTTCAACCTCATGG - Intergenic
1005607825 6:27493016-27493038 TTTCACTCCTTTCTGCCTCCTGG + Intergenic
1007218073 6:40256699-40256721 CTTCTCCCCCTCCAACCTCAAGG - Intergenic
1007219944 6:40270494-40270516 TTTTCCTCTCTCCTATCTCATGG + Intergenic
1007384043 6:41508673-41508695 TTTCCCTCCCTCCAGCCTCCAGG + Intergenic
1010922223 6:81696915-81696937 CTTCACGGACTCCTACCTCATGG + Intronic
1012555688 6:100508645-100508667 TTTCTTTCCCTTCTACTTCAAGG - Exonic
1016264607 6:142216882-142216904 TTTAAGTCTCTCCTATCTCAGGG - Intronic
1016378328 6:143447392-143447414 AGTCACTCCTCCCTACCTCATGG - Intronic
1016810715 6:148258733-148258755 TTTCACTGCCTACTGACTCACGG + Intergenic
1018551603 6:165004552-165004574 TTTCCCTCCCTCCTCTCCCAGGG + Intergenic
1018551810 6:165006863-165006885 TTTCCCTCCCTCCTCTCCCAGGG + Intergenic
1018847514 6:167565957-167565979 TCCCACACCCTCCTAGCTCAGGG + Intergenic
1019051689 6:169188446-169188468 TTTCCTTCCCTCCAACCCCATGG - Intergenic
1020120715 7:5501707-5501729 GTTCACTCCCTCCTACGGCGTGG - Exonic
1020715844 7:11674101-11674123 CCTCACTCTCCCCTACCTCAGGG - Intronic
1021243131 7:18229642-18229664 AATCACTCCTTCCTACCTGACGG - Intronic
1021381324 7:19970035-19970057 TTTCACTCCACCCTAGCCCAGGG + Intergenic
1021545291 7:21806516-21806538 TTTCATGACCTCCGACCTCAGGG + Intronic
1021643166 7:22760855-22760877 TTCCACTCCCTCCATCCTTAAGG - Intergenic
1024088026 7:45913082-45913104 TCTCTGTCCCTCCTACCCCACGG + Intronic
1025791530 7:64691954-64691976 TTTCACTCTCACCTACCTGGGGG - Exonic
1026873259 7:73865916-73865938 TCTCACTCCCTCTTCCCTAATGG + Intergenic
1028775914 7:94675969-94675991 TTTCTCTCCCTCCTACCTTTTGG + Intergenic
1028808352 7:95055025-95055047 TTTCTCTCCCTCCTATACCAAGG - Intronic
1029403372 7:100358668-100358690 ACTCACTCCCTCCTTCCTCTAGG + Exonic
1029596293 7:101539102-101539124 TTTGACTCCTGCCTCCCTCAAGG + Intronic
1030641733 7:112013818-112013840 TTTAAGTCCCTCCATCCTCAAGG + Intronic
1038072254 8:24030127-24030149 CTTCACTCTGTCCTCCCTCATGG - Intergenic
1038188323 8:25295739-25295761 TTTACCTCCACCCTACCTCATGG + Intronic
1038521228 8:28233844-28233866 TTTGACCCCCTCATATCTCATGG - Intergenic
1039337560 8:36608884-36608906 TTTCACTCTCTCCAATGTCATGG + Intergenic
1039338885 8:36624699-36624721 CTTCACTCCTGCCTACCTAATGG - Intergenic
1039893258 8:41698510-41698532 TTTCACTCCCTGCTTGTTCATGG + Intronic
1040557273 8:48491824-48491846 TTTCCCTCTCTCCTCCCCCAGGG + Intergenic
1040904885 8:52457718-52457740 TTTCTCACCCTCCCACCTCAAGG - Intronic
1041336399 8:56789409-56789431 TTTCACCCCCTCCCAGTTCATGG + Intergenic
1041682368 8:60606191-60606213 CTTTACTCCCTCCCAGCTCAGGG - Intronic
1041682376 8:60606269-60606291 CTTTACTCCCTCCTTGCTCAGGG - Intronic
1041965650 8:63672164-63672186 TTTAACTCCCACATACTTCAGGG + Intergenic
1041980555 8:63853586-63853608 TTTCTCTGCCTCCTACTGCATGG - Intergenic
1042366246 8:67940014-67940036 TTTCACTCCCTCCTAATTTTGGG + Intergenic
1043054848 8:75424534-75424556 TTTCTCTCCCTCCCACCTTTTGG + Intronic
1045182266 8:99797065-99797087 ATTCTCTCCCTCCTATCTCAAGG - Intronic
1046570117 8:115952762-115952784 TTTCCTTCCTTCCTACCCCAAGG + Intergenic
1047468742 8:125146173-125146195 TTTGACTTTCTCCTACCTGAAGG + Intronic
1047830458 8:128623625-128623647 ATTCAATCCCTCTAACCTCAAGG - Intergenic
1051127744 9:13823028-13823050 TTTCATTATCTCCTTCCTCAGGG - Intergenic
1051858005 9:21591804-21591826 GCTGACTCACTCCTACCTCAGGG + Intergenic
1055742318 9:79403459-79403481 TTTCAATCCTTCCTACTTCAGGG - Intergenic
1056188417 9:84160602-84160624 TGTCCTTCCCTCCTCCCTCATGG + Intergenic
1056772777 9:89491957-89491979 TGTCCCTCCCACCCACCTCACGG + Intronic
1057644187 9:96857634-96857656 TCACACTCCCTGCAACCTCATGG - Intronic
1060690069 9:125649964-125649986 TTTCAGTGCTTCCTAACTCAGGG + Intronic
1060967466 9:127719982-127720004 TATCTCTCCCTCCTGCCTCAGGG + Intronic
1061218875 9:129237391-129237413 TCTCGCTCCCGCCTGCCTCATGG - Intergenic
1062392444 9:136339337-136339359 TTGCACTCCCTCCACCCTTACGG - Intronic
1185629303 X:1504489-1504511 TTTCACTTCCTGCTACCATAAGG + Intronic
1186502970 X:10066679-10066701 TTTCATTCCCCCCTGCCTCCTGG - Intronic
1186935980 X:14450358-14450380 CTGCACTCCCTGCTCCCTCAGGG - Intergenic
1186972706 X:14865606-14865628 TTTCAACCCTTCCTACTTCATGG - Intronic
1187972906 X:24676585-24676607 TTTTACTCTCTTCTACCACAAGG + Intergenic
1188245173 X:27830142-27830164 TTTCACTTCCTGCGACCCCACGG - Intergenic
1189287350 X:39861043-39861065 TTCCACCCCCTGCTTCCTCATGG - Intergenic
1191629569 X:63307404-63307426 ATTCTCTCCCTCCTCCTTCAAGG - Intergenic
1195849957 X:109272114-109272136 CTACACTCCCTCCTACTACAAGG + Intergenic
1196992544 X:121345676-121345698 TATCACTCCCTGCTACAGCATGG - Intergenic
1197346473 X:125329444-125329466 TTTCACTTCCTCCAAAATCAAGG - Intergenic
1200735420 Y:6788566-6788588 TTTCATTCCCGCCTGCCTCCTGG - Intergenic
1200918574 Y:8592934-8592956 TTTCACTGACACCTACCTCTGGG + Intergenic
1201187176 Y:11415831-11415853 TTTCCTTCCTTCCTTCCTCAGGG + Intergenic