ID: 1004207736

View in Genome Browser
Species Human (GRCh38)
Location 6:13608004-13608026
Sequence CACTTTTAGGAGCTTGAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 343}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004207736_1004207741 9 Left 1004207736 6:13608004-13608026 CCTAGCTCAAGCTCCTAAAAGTG 0: 1
1: 0
2: 2
3: 22
4: 343
Right 1004207741 6:13608036-13608058 CAGGTGTGAGCCACTGTGCCTGG 0: 5858
1: 25977
2: 70674
3: 125747
4: 139903
1004207736_1004207740 -10 Left 1004207736 6:13608004-13608026 CCTAGCTCAAGCTCCTAAAAGTG 0: 1
1: 0
2: 2
3: 22
4: 343
Right 1004207740 6:13608017-13608039 CCTAAAAGTGCTGGGATTACAGG 0: 30
1: 1479
2: 20524
3: 321887
4: 265770

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004207736 Original CRISPR CACTTTTAGGAGCTTGAGCT AGG (reversed) Intronic
900613653 1:3554787-3554809 CACTTTCAGGAATTTGAGATGGG - Intronic
901295331 1:8156801-8156823 GACCTCTAGGAGCTTGTGCTAGG - Intergenic
901827119 1:11869567-11869589 CATGTTTTCGAGCTTGAGCTTGG + Intergenic
902180403 1:14684109-14684131 CACTTATAGGAGCTTGATACGGG - Intronic
903173739 1:21568877-21568899 CACTCCAAGGAGCTGGAGCTTGG - Intronic
905011207 1:34748128-34748150 CACTTTTAGCACCTGGAGCCTGG - Intronic
905150248 1:35921475-35921497 CTCTTTGAGGAGCCTGGGCTTGG + Exonic
905156667 1:35989626-35989648 CATTTTTGGGAGGTTGAGGTGGG + Intronic
905432427 1:37934176-37934198 CACTTTTGAGAGGTTGAGGTGGG - Intronic
906039901 1:42780538-42780560 TCCTTTAAGGAGCTGGAGCTTGG + Intronic
906344152 1:45004789-45004811 CACTTCCAGGAGCTTCACCTAGG + Exonic
908229761 1:62092129-62092151 GACTTTTAGGAGGCTGAGATGGG + Intronic
909110793 1:71474425-71474447 CACTTTTGGGAGGTCGAGGTGGG + Intronic
909707531 1:78605253-78605275 CACTTTTAGGAGGCCGAGGTGGG - Intergenic
910834396 1:91493725-91493747 CACTTTTGGGAGGCTGAGGTGGG - Intergenic
912396532 1:109349098-109349120 CACTTTTGGGAGGCTGAGGTGGG + Intronic
914736417 1:150421728-150421750 CACTTTTAGGAGGCTGAAGTGGG + Intronic
915011221 1:152687872-152687894 CACTTTGAGGAACTGAAGCTAGG - Intergenic
918318411 1:183342242-183342264 CACTTTTGGGAGGCTGAGATGGG + Intronic
918664438 1:187132221-187132243 CTCTTTTAGGAAGTTTAGCTGGG - Intergenic
918998091 1:191789107-191789129 CACTTTTTGGACCATGAGGTTGG + Intergenic
919142048 1:193584743-193584765 CACTTTTATTAGCTTGAATTAGG + Intergenic
919639564 1:200035500-200035522 CGCATTTCGGAGCGTGAGCTGGG - Intronic
919979998 1:202637072-202637094 CACTTTTTGGAGGCTGAGGTAGG + Intronic
920392303 1:205615679-205615701 CACTTTTAGGAGGATGAACTTGG - Exonic
920661794 1:207921648-207921670 GAGTTTTAGGAGCTGGAGCGAGG - Intergenic
920838104 1:209530662-209530684 CACTTTTGGGAGGCTGAGGTGGG - Intergenic
922532135 1:226352857-226352879 GATTTTTGGGAGCTTCAGCTAGG + Intergenic
922973583 1:229763707-229763729 AACTTTTAGGATCTAGGGCTAGG - Intergenic
924045120 1:240021346-240021368 CACTTTTAGGAGGTCGAGAAGGG + Intronic
924060087 1:240165420-240165442 CACTTTTGGGAGGTCGAGTTGGG - Intronic
924224024 1:241906107-241906129 CACTTTTAGGAGGTCGAGGTGGG + Intergenic
1063649142 10:7915730-7915752 CACCTTTGGGAGGTTGAGGTGGG + Intronic
1064549337 10:16483026-16483048 CACTTTTGGGAGGCTGAGGTGGG - Intronic
1064669369 10:17694317-17694339 ATCTTTTAGGACCTTGAGGTAGG - Intronic
1064860483 10:19820058-19820080 CAAGTTTTGGAGCTTGAGGTTGG + Intronic
1065274492 10:24072272-24072294 CACTTTTAGGAGGCTGAGGTGGG - Intronic
1065381963 10:25099906-25099928 CACTTTTGGGAGGCTGAGGTGGG + Intergenic
1065626515 10:27635034-27635056 CATTTTTAGCAGCCTGAACTTGG + Intergenic
1068583109 10:58765300-58765322 CACTTTTGGGAGGCTGAGGTGGG - Intronic
1068868429 10:61918785-61918807 CACTTTTGGGAGGCTGAGGTGGG + Intronic
1069005899 10:63317104-63317126 CACTTTTGGGAGGCTGAGGTAGG - Intronic
1070126959 10:73630102-73630124 CGCTTTTAGGAGGCTGAGGTGGG + Intergenic
1070461420 10:76674290-76674312 CACTATCAGAAGCTTCAGCTTGG - Intergenic
1070542510 10:77426486-77426508 CAGTTATAAGAGGTTGAGCTGGG + Intronic
1071535732 10:86428081-86428103 CACTTTTAGGAGGCTGAGGCGGG - Intergenic
1073421390 10:103426546-103426568 CACTTTTGGGAGGCTGAGGTGGG + Intronic
1074083489 10:110187127-110187149 AACTTTTAGGATCTAGGGCTAGG - Intergenic
1074415530 10:113263938-113263960 CACTTTTGGGAGGCTGAGATGGG + Intergenic
1075815895 10:125264594-125264616 CACTTTTGGGAGGCTGAGGTGGG + Intergenic
1075903400 10:126061521-126061543 TACTTTTAGGATCTTGAGGTGGG + Intronic
1077245420 11:1534672-1534694 GACTTTTAGGACAGTGAGCTGGG - Intergenic
1078153813 11:8781036-8781058 CACTTTTAGGATGCTGAACTCGG - Intronic
1078230448 11:9437130-9437152 CACTTTTGGGAGTCTGAGGTGGG - Intronic
1080539687 11:33254502-33254524 CACTTTTGGGAGGCTGAGGTGGG + Intergenic
1083352663 11:62041996-62042018 CACTTTTGGGAGGCTGAGGTGGG - Intergenic
1083559982 11:63665640-63665662 CACTTTTGGGAGGTTGAGGCAGG + Intronic
1084003676 11:66312446-66312468 CACTTTTGTGAGCTTGAGAGGGG + Intergenic
1085357019 11:75847724-75847746 CACTTTTGGGAGGCTGAGGTGGG + Intronic
1086231378 11:84574534-84574556 GATTTTAAGGAGCTTTAGCTTGG - Intronic
1086536392 11:87851845-87851867 CACTTTTAGGGTCTCTAGCTGGG + Intergenic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1087848779 11:103004248-103004270 CACTTTTGGGAGGTTGAGGTGGG - Intergenic
1088615360 11:111621666-111621688 CACTTTTAGGAGGTCAAGGTGGG + Intronic
1090108587 11:123878901-123878923 CACTTTTGGGAGGCTGAGGTGGG - Intergenic
1092153329 12:6266280-6266302 CACTTTTAGGAGGCTGAGGTGGG + Intergenic
1094693458 12:32793003-32793025 CACTTTTGGGAGGCTGAGGTGGG + Intronic
1095706933 12:45247170-45247192 CACTTTTGGGAGGCTGAGGTGGG - Intronic
1096172908 12:49487839-49487861 CACTTTTGGGAGGCTGAGGTGGG - Intronic
1096553092 12:52386790-52386812 CTCTTTTAGGACCCTGAGCCAGG + Intergenic
1097165163 12:57080642-57080664 CACTTTTGGGAGGTTGAGGTGGG + Intronic
1097657730 12:62388824-62388846 CACTTTTAGTATCTTAAACTCGG - Intronic
1098334998 12:69394717-69394739 TAGTTTGAGGAGCTTGAGTTGGG - Intergenic
1098349599 12:69544458-69544480 CACTTTGAGGAGGCTGAGGTGGG + Intronic
1098647539 12:72922472-72922494 CACTTTTTAGAGCTTGATTTTGG + Intergenic
1100487564 12:95044952-95044974 CACTTTTGGGAGGTCGAGGTGGG + Intronic
1102237392 12:111302651-111302673 CACTTTTGGGAGGCTGAGGTGGG + Intronic
1103030921 12:117612157-117612179 CACTTTTGGGAGGCTGAGGTGGG + Intronic
1103361591 12:120357750-120357772 CACTTTGGGGAGGTTGAGGTGGG - Intronic
1103554820 12:121759748-121759770 CACTTTTGGGAGGCTGAGTTGGG + Intronic
1103673982 12:122641363-122641385 CACTTTTAGGAGACTGAGGTGGG + Intergenic
1104218335 12:126757005-126757027 TACATTAAGGATCTTGAGCTGGG - Intergenic
1106660198 13:31791430-31791452 GACTTTCAGGGGCTTGGGCTTGG - Intronic
1108670345 13:52681167-52681189 CACTTTTGGGAGACTGAGGTGGG + Intronic
1108742984 13:53357918-53357940 CTGTTTTAGGAGCTTGGACTTGG + Intergenic
1111351513 13:87036978-87037000 CACTTTTGGGAGGCCGAGCTGGG + Intergenic
1111820242 13:93204931-93204953 CACTTTTGGGAGGCTGAGGTGGG - Intergenic
1114650522 14:24281647-24281669 AACTTCTAGGAGGTTGAGATGGG + Intergenic
1115023025 14:28706148-28706170 CACTTTTAGGAGGTAGAGGCAGG + Intergenic
1116138445 14:40957840-40957862 CACTTTTGGGACTTTTAGCTAGG + Intergenic
1116903095 14:50380157-50380179 CAGTTTCAGGAGCTTGTGTTTGG - Intronic
1117151290 14:52890847-52890869 CACTTTTGGGAGGCTGAGGTGGG - Intronic
1117701475 14:58417708-58417730 CTTTTTTAGGTGCTTGAGGTAGG - Intronic
1118132352 14:62981251-62981273 CTCTTTTAGGTTCTTCAGCTGGG - Exonic
1118170559 14:63384938-63384960 CACTTTTGGGAGGCTGAGGTGGG - Intronic
1119381092 14:74228823-74228845 CCATTAGAGGAGCTTGAGCTGGG - Intergenic
1119514046 14:75233997-75234019 CACTTTTGGGAGGCTGAGGTGGG + Intergenic
1119915747 14:78399892-78399914 CACTATTAGGATCTTGAGGGAGG - Intronic
1120016408 14:79478951-79478973 CACCTTTTGGAGCTTCAGTTTGG + Intronic
1122668853 14:103354571-103354593 CGCTTATAGGAACTTGACCTAGG + Intergenic
1122702112 14:103596867-103596889 CACTTTTAGGAGTCTGAGGCAGG + Intronic
1124205366 15:27714307-27714329 CACTTTTAGGAGCTGTAACACGG + Intergenic
1125200440 15:37097504-37097526 CACTAACAGCAGCTTGAGCTGGG - Intronic
1125658286 15:41376147-41376169 CACTTTTGGGAGGCTGAGGTGGG + Intronic
1125886823 15:43235560-43235582 CACTTTGAGGTCCTTGAACTGGG + Exonic
1126630977 15:50735149-50735171 CACTTTTGGAGGCTTGAGGTGGG - Intronic
1127272659 15:57415277-57415299 TAATTTAAGGACCTTGAGCTGGG + Intronic
1129176857 15:73846591-73846613 CCCATTTGGGAGCTGGAGCTTGG - Intergenic
1129204351 15:74026896-74026918 CACTTTTGGGAGGCTGAGGTGGG - Intronic
1129432196 15:75507519-75507541 CACTTTTGGGAGGCTGAGGTGGG + Intronic
1129628727 15:77234110-77234132 CACTTTGAGGGGCCTGAGATGGG - Intronic
1130412042 15:83655118-83655140 TACTTTTAGGAGATTGTGTTAGG + Intronic
1130641389 15:85678992-85679014 CACTTTTGGGAGACTGAGGTGGG + Intronic
1130763010 15:86840378-86840400 ATCTTTTGGGAGCTTAAGCTTGG - Intronic
1131133685 15:89916421-89916443 CACTTTTGGGAGGTTGAGGTGGG + Intergenic
1132150956 15:99458457-99458479 CACTTTGAGGAGGCTGAGGTAGG + Intergenic
1133833010 16:9341578-9341600 CACTTTTGGGAGGCTGAGGTGGG + Intergenic
1133940498 16:10305216-10305238 CATTTTTAGGAGGCTGAGGTGGG + Intergenic
1134059685 16:11191574-11191596 CACTTTTGGGAGTCTGAGGTGGG + Intergenic
1135375211 16:21940535-21940557 CACTTTTGGGAGGCTGAGGTGGG + Intergenic
1136346992 16:29682282-29682304 CACTTTTGGGAGGCTGAGGTTGG - Intronic
1137646850 16:50082673-50082695 CACTTTTGGGAGGCTGAGGTGGG + Intronic
1138293883 16:55870452-55870474 CACTTTTGGGAGGTTGACGTGGG + Intronic
1139948228 16:70656289-70656311 CACTTTGAGGGGCTTGAGCCCGG + Intronic
1140061483 16:71573925-71573947 CACTTTCAGGAGGCTGAGGTGGG - Intronic
1140645611 16:77026697-77026719 CACTTTTGAGAGATTGAGGTTGG - Intergenic
1140898760 16:79349271-79349293 CCCTCTTAGGAGCCTGACCTGGG - Intergenic
1141162402 16:81638232-81638254 CACGTTTGGGATCTTGAGATGGG - Intronic
1141892594 16:86936545-86936567 CACTTGTAAGAGGTGGAGCTAGG - Intergenic
1141969737 16:87472958-87472980 CACTTTTGGGAGGCTGAGTTGGG - Intronic
1142879431 17:2872908-2872930 CACTTTTGGGAGGCTGAGGTTGG - Intronic
1143559030 17:7681030-7681052 CACTTTTAGGAGGCTGAGGCAGG - Intronic
1146014010 17:29218146-29218168 CACTTTTGGGAGGCTGAGGTGGG - Intergenic
1146144030 17:30394802-30394824 GACTTTGAGGATTTTGAGCTTGG + Intronic
1146151206 17:30474223-30474245 CACTTTTGGGAGGCTGAGGTGGG + Intergenic
1146912034 17:36654697-36654719 GACTTTTGGGATCTTGAGGTAGG + Intergenic
1148272912 17:46277885-46277907 CACTTTTGGGAGGCTGAGGTGGG - Intronic
1149243455 17:54678201-54678223 CACTTTGAGGAGGCTGAGGTGGG - Intergenic
1150234040 17:63578115-63578137 CACTTTTGGGAGGCTGAGGTGGG + Intronic
1150612489 17:66745037-66745059 CAAATTAAGGATCTTGAGCTAGG - Intronic
1151411757 17:73935130-73935152 CCCATTTAGGAGCTATAGCTAGG + Intergenic
1151497785 17:74469274-74469296 GAATTTTAGGAGGTTGAGGTGGG + Intronic
1152392153 17:80009485-80009507 CACTTGCAGGAGCTAGAGTTGGG - Intronic
1152876883 17:82791436-82791458 CACTTTTGCGAGCTTTTGCTGGG + Intronic
1153847749 18:9065031-9065053 CACTTTTGGGAGGCTGAGGTGGG + Intergenic
1155089610 18:22493883-22493905 CACTTTGTTGAGCTTGAGCCAGG + Intergenic
1155749938 18:29409558-29409580 CAATTTTAAGAGCTAGATCTAGG - Intergenic
1156018737 18:32575850-32575872 CACTTTTGGGAGGCTGAGCAGGG + Intergenic
1156030567 18:32707749-32707771 CACTCTTGGAAGCTTGAGCTGGG + Intronic
1156113779 18:33761014-33761036 CACTTTTGGGAGGCTGAGGTGGG - Intergenic
1157220091 18:45823234-45823256 CAAATTTAGGAATTTGAGCTTGG + Intergenic
1157642585 18:49232853-49232875 CACTTTTGGGAGGCTGAGGTGGG - Intronic
1157665062 18:49479195-49479217 TACTTTTAGGAGGTTGAGTATGG - Intronic
1159572370 18:70131593-70131615 CACTTTTGGGAGGCTGAGGTGGG + Intronic
1161387380 19:4002939-4002961 CACTTTTGGGAGATTGAGGCAGG + Intergenic
1161721605 19:5905665-5905687 CACTTTTAGGAGGCTGAGGCGGG - Intronic
1162213571 19:9113216-9113238 CACTTTTGGGAGGCTGAGGTGGG + Intergenic
1163058097 19:14737438-14737460 CATTTTTGGGAGGTTGAGATGGG - Intronic
1163961950 19:20704992-20705014 CACTTTTAGGTGCATGACCCGGG - Intronic
1164890825 19:31821674-31821696 CACTTTGAGGAGGCTGAGATGGG + Intergenic
1164906245 19:31970588-31970610 CACTTTTGGGAGGCTGAGGTGGG + Intergenic
1166586522 19:43953834-43953856 CACTTTTGGGAGGCTGAGGTGGG + Intronic
1167089585 19:47334382-47334404 CACTTTTGGGAGGCTGAGGTGGG + Intronic
1167918680 19:52763003-52763025 CACTTTTGGGAGGTCGAGGTGGG + Intergenic
925348387 2:3185670-3185692 CACTTTTGGGAGGCTGAGGTGGG + Intergenic
925378852 2:3409500-3409522 CACTTTTGGGAGGCTGAGGTAGG + Intronic
925960639 2:9011898-9011920 CAGTTTTAAGAGCTTCATCTAGG + Intergenic
927546902 2:23962089-23962111 CACTTTTGGGAGGCTGAGGTGGG - Intronic
928404207 2:31002181-31002203 CACTTTTGGGAGGCTGAGGTGGG + Intronic
929180467 2:39032713-39032735 CACTTTTGGGAGGCTGAGGTGGG + Intronic
929209286 2:39336224-39336246 CACTTTTAGGAGGCCGAGGTGGG + Intronic
929229141 2:39541316-39541338 CCCTCTTGGAAGCTTGAGCTTGG + Intergenic
929715526 2:44305672-44305694 CACTTTTGGGAGGCTGAGGTGGG - Intronic
931225646 2:60327392-60327414 GACTTTTAGAAGCTTAAGGTGGG - Intergenic
931440633 2:62287831-62287853 CACTTTTGGGAGGCTGAGGTGGG - Intergenic
931565026 2:63607289-63607311 CACTTTGGGAAGCTTGAGATGGG + Intronic
931784455 2:65606952-65606974 CACTTTTGGGAGGCTGAGGTGGG + Intergenic
932194221 2:69769174-69769196 CACTATTCGAAGCTTGAGCCTGG + Intronic
932357945 2:71082039-71082061 CACTTTTGGGAGGGTGAGGTGGG + Intergenic
933555452 2:83825252-83825274 CACTTTTGGGAGACTGAGGTGGG + Intergenic
935647870 2:105356142-105356164 CACTTTTGGGAGGTCGAGATGGG + Intergenic
936002878 2:108851546-108851568 CACTTTTGGGAGGCTGAGGTGGG - Intronic
937485684 2:122312667-122312689 CACTTTTGGGAGGCTGAGGTGGG + Intergenic
937729806 2:125214903-125214925 CACATTTTGGAGATTGAGTTTGG + Intergenic
938077496 2:128347398-128347420 CACTTTTAGGACCATCAGCTAGG + Intergenic
938582918 2:132663519-132663541 CACTTTGGGAAGCTTGAGGTAGG - Intronic
938692140 2:133801563-133801585 CACTTAAAGGAGCCTGAGCTGGG + Intergenic
939561025 2:143731916-143731938 CACTTTTAGTTGGTTGATCTAGG - Intronic
940246658 2:151626359-151626381 CACTTTTGGGAGGCTGAGGTGGG - Intronic
940385401 2:153065487-153065509 CTCTATTAGGAGATTGAGGTAGG + Intergenic
942252707 2:174061273-174061295 CACTTTTGGGAGGTCGAGGTGGG + Intergenic
942894661 2:181037720-181037742 CACTTTTAGGAGGTTAAGGGGGG + Intronic
944204268 2:197140968-197140990 CACTTTTGGGAGGTCGAGGTGGG + Intronic
944551297 2:200846890-200846912 CACTTTTGGGAGGCTGAGGTGGG - Intergenic
944681158 2:202078064-202078086 CACTTTTAGGAGCTGGCCCTAGG + Intronic
945455121 2:210043137-210043159 CATTTTTGGGAGGTTGAGGTGGG + Intronic
947254537 2:228147595-228147617 CACTTTTACGAGTTCGACCTTGG + Intronic
948225673 2:236307584-236307606 CACTGTTAGGACGCTGAGCTGGG - Intergenic
948382483 2:237560358-237560380 CACTTTTGGGAGGCTGAGGTGGG - Intergenic
1171469623 20:25359814-25359836 CACTTTTTGGAGGCTGAGGTGGG - Intronic
1172294502 20:33799015-33799037 CACTTGTAGGAGGCAGAGCTGGG - Intergenic
1172916791 20:38449263-38449285 CACTTTTGGGATCCTGTGCTGGG + Intergenic
1173060342 20:39654355-39654377 CACTTTCAAGAGCTAGAGCTGGG + Intergenic
1173486813 20:43447184-43447206 CACTTTTGGGAGGCTGAGGTGGG - Intergenic
1173489544 20:43468685-43468707 CACTTTTGGGAGGCTGAGGTAGG + Intergenic
1174248836 20:49202792-49202814 CACTTTTGGGAGGCTGAGGTGGG + Intergenic
1174399605 20:50269014-50269036 CACTTTTGGGAGGCTGAGGTGGG - Intergenic
1174471239 20:50762648-50762670 CACTTTTGGGAGGCTGAGCCAGG - Intergenic
1175085803 20:56457766-56457788 CACTTTAAGGAGGCTGAGGTGGG + Intronic
1178622246 21:34186950-34186972 CACTTTTGGGAGGCTGAGGTGGG - Intergenic
1180610542 22:17094230-17094252 CACTTTTGGGAGGCTGAGGTAGG - Intronic
1182638029 22:31744516-31744538 CACTTTTGGGAGGCTGAGGTGGG - Intronic
1183759666 22:39804742-39804764 CATCTTTAGGAGCCTGTGCTTGG - Intronic
1184649076 22:45911436-45911458 CACGCTGAGGAACTTGAGCTGGG - Intergenic
949745996 3:7292783-7292805 CACTTTTGGGAGGCTGAGGTGGG + Intronic
949895775 3:8766838-8766860 AAGTTGAAGGAGCTTGAGCTTGG + Intronic
950509950 3:13420128-13420150 CACTTTGGGGATGTTGAGCTTGG + Exonic
950820541 3:15753694-15753716 CACTTTTGGGAGGCTGAGGTGGG + Intronic
952293286 3:32039077-32039099 CACTTTTGGGAGGTTGAGGCAGG + Intronic
952304582 3:32134732-32134754 CACTTTTGGGAGGCTGAGGTGGG - Intronic
953394533 3:42556967-42556989 CACTTCTGGGAGGTTGAGGTGGG - Intronic
953784589 3:45901531-45901553 CACTTTTAGGGCTTTGTGCTTGG - Exonic
954549930 3:51472909-51472931 CACTTTTAGGAGGCTGAGGCGGG - Intronic
954661114 3:52227396-52227418 CAATTCTAGGGGCTTGAGCAGGG + Intergenic
955301844 3:57787720-57787742 CACTTTTGGGAGGCTGAGGTGGG - Intronic
956186387 3:66566635-66566657 CACTTTTGGGAGCCTGAGATGGG - Intergenic
956441134 3:69281178-69281200 CACTTTTGGGAGGCTGAGGTGGG - Intronic
956624212 3:71250682-71250704 CACTTTTGGGAGGCTGAGGTGGG + Intronic
956881997 3:73520256-73520278 CACTTTTGGGAGGCTGAGGTGGG + Intronic
961247323 3:125466678-125466700 CACTTTTGGGAGGTTGAGGCAGG + Intronic
961929860 3:130521880-130521902 CACTATGAGCAGCTGGAGCTCGG - Intergenic
963128627 3:141837943-141837965 CACTTTTAGGAGTTTACCCTGGG - Intergenic
964618029 3:158690830-158690852 CACTTCTGAGTGCTTGAGCTGGG + Intronic
966018101 3:175168275-175168297 CACTTTTAGGAACTAAAACTAGG + Intronic
966889439 3:184396059-184396081 CATTTTTAGGAGGCTGAGTTGGG - Intronic
967264190 3:187675714-187675736 CAGTTCCAGGGGCTTGAGCTGGG - Intergenic
968259301 3:197306877-197306899 CACTTTTGGGAGGCTGAGGTGGG + Intergenic
969763936 4:9213337-9213359 CACATTTGGGTGCTTGAGCAGGG - Intergenic
969764545 4:9218084-9218106 CACATTTGGGTGCTTGAGCAGGG - Intergenic
969765149 4:9222832-9222854 CACATTTGGGTGCTTGAGCAGGG - Intergenic
969765760 4:9227576-9227598 CACATTTGGGTGCTTGAGCAGGG - Intergenic
969766369 4:9232320-9232342 CACATTTGGGTGCTTGAGCAGGG - Intergenic
969766984 4:9237063-9237085 CACATTTGGGTGCTTGAGCAGGG - Intronic
969767591 4:9241810-9241832 CACATTTGGGTGCTTGAGCAGGG - Intronic
969768198 4:9246559-9246581 CACATTTGGGTGCTTGAGCAGGG - Intronic
969768801 4:9251309-9251331 CACATTTGGGTGCTTGAGCAGGG - Intronic
969769406 4:9256058-9256080 CACATTTGGGTGCTTGAGCAGGG - Intronic
969770023 4:9260804-9260826 CACATTTGGGTGCTTGAGCAGGG - Intronic
969770627 4:9265552-9265574 CACATTTGGGTGCTTGAGCAGGG - Intronic
969771242 4:9270299-9270321 CACATTTGGGTGCTTGAGCAGGG - Intronic
969771610 4:9323100-9323122 CACATTTGGGTGCTTGAGCAGGG - Intronic
969772223 4:9327845-9327867 CACATTTGGGTGCTTGAGCAGGG - Intronic
969772839 4:9332591-9332613 CACATTTGGGTGCTTGAGCAGGG - Intronic
969773456 4:9337338-9337360 CACATTTGGGTGCTTGAGCAGGG - Intronic
969774071 4:9342083-9342105 CACATTTGGGTGCTTGAGCAGGG - Intronic
969774686 4:9346828-9346850 CACATTTGGGTGCTTGAGCAGGG - Intronic
969775302 4:9351573-9351595 CACATTTGGGTGCTTGAGCAGGG - Intronic
969775916 4:9356318-9356340 CACATTTGGGTGCTTGAGCAGGG - Intronic
969776527 4:9361063-9361085 CACATTTGGGTGCTTGAGCAGGG - Intronic
969777145 4:9365809-9365831 CACATTTGGGTGCTTGAGCAGGG - Intergenic
971227516 4:24768816-24768838 CTCTTTTTGGAGCTTGGTCTGGG + Intergenic
971320171 4:25599223-25599245 CACTTTTCGGAGGCTGAGGTGGG - Intergenic
971772538 4:30915766-30915788 CACTTTTGGGAGGCTGAGGTGGG - Intronic
972716471 4:41651249-41651271 CACTTTTGGGAGGCTGAGGTGGG - Intronic
973958402 4:56086387-56086409 CACTTTTAGGAGCCTGAGGTAGG - Intergenic
974894095 4:67917728-67917750 CACTTTCAGGAGTTTGAGACTGG - Intronic
974981271 4:68960267-68960289 CACCTTCAGGAGCTGCAGCTGGG + Intergenic
975065831 4:70062406-70062428 CATCTTCAGGAGCTTTAGCTGGG - Intergenic
975798049 4:78030589-78030611 CACATTTAGTAACTTGAGGTGGG + Intergenic
975939693 4:79627969-79627991 CACTTTTAGGAGGCTGAGGCAGG + Intergenic
976599748 4:86927270-86927292 CACTTTTGGGAGGCTGAGGTGGG + Intronic
979019671 4:115480645-115480667 CACTTTTGGGAGGTTGAGGAAGG + Intergenic
979228556 4:118319920-118319942 CACTTTTGGGAGGTTGAGGTGGG - Intronic
981042840 4:140238818-140238840 GACTATTAGGAGCCTGGGCTGGG - Intergenic
981778150 4:148394049-148394071 CCATTTCAGGAGCTTGGGCTAGG + Intronic
983225661 4:165084064-165084086 CACTTTTAAGAGGCTGAGGTGGG - Intronic
985147972 4:186914028-186914050 CACTTTGAGGAGGCTGAGGTGGG + Intergenic
986689717 5:10304255-10304277 GCCTTTTAGGAGGCTGAGCTAGG + Intronic
988619316 5:32806288-32806310 CACTATTAGGAACCTGGGCTGGG - Intergenic
990263319 5:54048647-54048669 CACTTTTGGGAGGTTGAGGTGGG - Intronic
990428252 5:55710452-55710474 CACTTTTGGGAGGCTGAGGTGGG - Intronic
992345824 5:75876784-75876806 CACTTTTAGGTGGTTGCTCTAGG - Intergenic
993161007 5:84290848-84290870 CACTCTTAGGATCTTTGGCTAGG - Intronic
993909887 5:93668349-93668371 CACTTTTTGGAGGCTGAGTTGGG - Intronic
994184272 5:96801209-96801231 CATTTTTGGGAGGTTGAGGTGGG + Intronic
996448252 5:123583936-123583958 CACTTTTGGGAGGTCGAGCCAGG - Intronic
996868827 5:128162502-128162524 CAATTTTATGACCTTTAGCTAGG + Intronic
997804014 5:136895916-136895938 CACTTTTGGGAGGCTGAGGTGGG - Intergenic
999210067 5:149880463-149880485 CACTTTTAGGAGGCCGAGGTGGG + Intronic
1003683777 6:8281058-8281080 CACTTTTGGGAGGCTGAGGTGGG + Intergenic
1004207736 6:13608004-13608026 CACTTTTAGGAGCTTGAGCTAGG - Intronic
1004389594 6:15198842-15198864 CACTTTTGGGAGGCTGAGGTAGG + Intergenic
1004454553 6:15779760-15779782 CACTTTCAGGAGCTGGATCCAGG - Intergenic
1004618129 6:17309842-17309864 CACTTTTGGGAGGCTGAGGTGGG - Intergenic
1004657870 6:17681959-17681981 CACTTTTAGGAGGCTGAGGCAGG + Intronic
1005128874 6:22480034-22480056 TACTTTTAGGTGCATGACCTGGG + Intergenic
1005950742 6:30629488-30629510 CACTTTTGGGAGGCTGAGGTGGG - Intronic
1006524984 6:34596557-34596579 CACTTTTGGGAGGCTGAGGTGGG - Intronic
1006540289 6:34734550-34734572 CACTTTTGGGAGGCTGAGGTGGG - Intergenic
1006934773 6:37709810-37709832 CACTGTGGGGAGCTGGAGCTCGG - Intergenic
1007156922 6:39753845-39753867 CAGATAGAGGAGCTTGAGCTGGG - Intergenic
1008548350 6:52603512-52603534 CCTTGTCAGGAGCTTGAGCTAGG + Intergenic
1011730521 6:90258018-90258040 CACTTTTGGGAGGCTGAGGTAGG - Intronic
1014101251 6:117514356-117514378 CACTTTGAGGAGGCTGAGATGGG + Intronic
1017174793 6:151493091-151493113 CACTTTTGGGAGGCTGAGATGGG - Intergenic
1019673070 7:2293154-2293176 CACTTTTGGGAGGCTGAGGTGGG + Intronic
1020215250 7:6185337-6185359 CACTTTTGGGAGGCTGAGGTGGG + Intronic
1020869701 7:13612008-13612030 CACTTTTGGGAGGCTGAGGTGGG - Intergenic
1021579620 7:22139145-22139167 CTCTTGTAGGAGTTTGAGTTGGG + Intronic
1022089768 7:27100006-27100028 CACTTTCAAGAGCTTGGGCTTGG + Intergenic
1024402833 7:48944875-48944897 CTCTTTTAACAGCTTGAGATAGG + Intergenic
1025174295 7:56789740-56789762 CACTTTTGGGAGGCTGAGGTGGG - Intergenic
1025697509 7:63786682-63786704 CACTTTTGGGAGGCTGAGGTGGG + Intergenic
1025867071 7:65392780-65392802 CACTTTTGGGAGGCTGAGGTGGG - Intronic
1026055733 7:66982006-66982028 CACTTTTGGGAGGCTGAGATGGG + Intergenic
1028734716 7:94195070-94195092 CAATTTTAGGTACTTGTGCTTGG + Intergenic
1029129865 7:98321849-98321871 CACTTTTGGGAGGCTGAGGTGGG + Intronic
1029446148 7:100613694-100613716 CACTTCCAGGAGCGTGAGTTGGG + Exonic
1029653217 7:101907871-101907893 CACTTTGAGGAGGCTGAGGTGGG + Intronic
1030080177 7:105770839-105770861 CACTTTGAGAAGCAAGAGCTTGG - Intronic
1032417072 7:131744013-131744035 CACTTTTATGGAATTGAGCTTGG + Intergenic
1033208197 7:139440356-139440378 CACTTTTGGGAGGCTGAGGTGGG - Intergenic
1033208218 7:139440500-139440522 CACTTTTGGGAGGTTGAGGTGGG - Intergenic
1034424167 7:151005647-151005669 CACTTTTAAATGCTTCAGCTGGG - Intronic
1035162186 7:156959346-156959368 CACTTTTGGGAGGCTGAGGTGGG - Intronic
1035424947 7:158764112-158764134 CACTTTAAAGAGCTTTATCTGGG + Intronic
1036274076 8:7335062-7335084 CACATTTGGGTGCTTGAGCAGGG - Intergenic
1036274647 8:7339783-7339805 CACATTTGGGTGCTTGAGCAGGG - Intergenic
1036346705 8:7970563-7970585 CACATTTGGGTGCTTGAGCAGGG + Intergenic
1036347273 8:7975286-7975308 CACATTTGGGTGCTTGAGCAGGG + Intergenic
1036409200 8:8482936-8482958 GAGTTTTATGAGTTTGAGCTAGG - Intergenic
1036635379 8:10546925-10546947 CACTTTGAGAGGCTTGAGGTGGG - Intronic
1036842031 8:12131317-12131339 CACATTTGGGTGCTTGAGCAGGG + Intergenic
1036842588 8:12136072-12136094 CACATTTGGGTGCTTGAGCAGGG + Intergenic
1039035103 8:33351199-33351221 CACTTTTGGGAGGATGAGGTGGG - Intergenic
1040065963 8:43144071-43144093 CACTTTTGGGAGGTCGAGGTGGG + Intronic
1040768554 8:50945328-50945350 CACTTTTGGGAGGTTGAGGTGGG - Intergenic
1040778137 8:51072145-51072167 CACTTTTGGGAGGTCGAGGTGGG - Intergenic
1041738269 8:61133588-61133610 CACCTTGAGGGGCTTGAGGTTGG + Intronic
1043450465 8:80361154-80361176 CACTTTTGGGAGGCTGAGGTGGG + Intergenic
1045486558 8:102636081-102636103 CACTTTTGGGAGGCTGAGGTGGG + Intergenic
1046736380 8:117780516-117780538 CACTTTTGGGAGGCTGAGGTGGG + Intergenic
1047764267 8:127977484-127977506 CACTTTTGGGAGGCTGAGGTGGG + Intergenic
1051168376 9:14291236-14291258 CACTTTTGGGAGGCTGAGGTGGG + Intronic
1053066684 9:35074079-35074101 CGTTTTGAAGAGCTTGAGCTGGG - Exonic
1055082886 9:72284560-72284582 CACTTTTGGGAGGCTGAGCCAGG - Intergenic
1055544303 9:77351536-77351558 CACTTTTGGGAGGCTGAGGTGGG + Intronic
1055625356 9:78171436-78171458 CAGTTTCATGAGCTTGAGGTGGG + Intergenic
1056152028 9:83800579-83800601 CACTTTTGGGAGGCTGAGGTGGG - Intronic
1056380706 9:86054644-86054666 CACTTGTTGGAGCTGGAGTTTGG - Intronic
1056396039 9:86182079-86182101 CACTTTGAGAGGCTTGAGGTGGG - Intergenic
1056532740 9:87501272-87501294 CACTTTTGGGAGGCTGAGGTAGG + Intronic
1058479981 9:105382148-105382170 TACTTTTATGACCTTGACCTTGG + Intronic
1058626311 9:106936758-106936780 CACTTTTACCAGCGAGAGCTGGG + Intronic
1059761737 9:117344298-117344320 CAGGTTTGGGAGCTAGAGCTAGG + Intronic
1061062307 9:128256737-128256759 CACTTTTGGGAGGCTGAGGTTGG - Exonic
1061298157 9:129688308-129688330 CACTTTTAGGAGGCTGAGGTGGG - Intronic
1062354535 9:136155526-136155548 CAGTTTGAGGAGCAGGAGCTGGG - Intergenic
1187024118 X:15415851-15415873 CATTTTTATGATCTTGAGTTAGG + Intronic
1187379372 X:18786534-18786556 CACTTTTGGGAGGCTGAGGTGGG + Intronic
1187402278 X:18972051-18972073 CACTTTTATGATCTTGAGACAGG - Intronic
1189807332 X:44749106-44749128 CACTTTTGGGAGGTCGAGGTGGG - Intergenic
1189979944 X:46499407-46499429 CACTTTTGGGAGGCTGAGGTGGG - Exonic
1190042589 X:47083151-47083173 CACTTTTGGGAGGCTGAGGTGGG + Intronic
1192569795 X:72193622-72193644 CATTTTTGGGAGGTTGAGGTAGG + Intronic
1196700913 X:118667288-118667310 CACTATCAGGATCTTGAGGTAGG - Intronic
1197235760 X:124060675-124060697 CACTTTTTGGAGGCTGAGGTGGG + Intronic
1200744666 Y:6893368-6893390 CAATTTTAGGGGCTTGGCCTAGG - Intergenic