ID: 1004210534

View in Genome Browser
Species Human (GRCh38)
Location 6:13637564-13637586
Sequence TAACTTTACTAGAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004210529_1004210534 -6 Left 1004210529 6:13637547-13637569 CCCTGAATTTGTCCTTATAACTT 0: 1
1: 0
2: 3
3: 17
4: 307
Right 1004210534 6:13637564-13637586 TAACTTTACTAGAGGGAAGAAGG No data
1004210530_1004210534 -7 Left 1004210530 6:13637548-13637570 CCTGAATTTGTCCTTATAACTTT 0: 1
1: 0
2: 1
3: 26
4: 280
Right 1004210534 6:13637564-13637586 TAACTTTACTAGAGGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004210534 Original CRISPR TAACTTTACTAGAGGGAAGA AGG Intronic
No off target data available for this crispr